ID: 1105939940

View in Genome Browser
Species Human (GRCh38)
Location 13:25138859-25138881
Sequence CAGAGATTGGCCCAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6577
Summary {0: 1, 1: 1, 2: 18, 3: 615, 4: 5942}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105939940_1105939945 -3 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939945 13:25138879-25138901 CTGTGTTTTTAGTAGAGATGGGG 0: 48
1: 4986
2: 93310
3: 182047
4: 180271
1105939940_1105939947 20 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939947 13:25138902-25138924 TTTCACCATGTCGGCCAAGCTGG 0: 26
1: 3952
2: 97691
3: 165973
4: 177042
1105939940_1105939944 -4 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939944 13:25138878-25138900 TCTGTGTTTTTAGTAGAGATGGG 0: 44
1: 5266
2: 101853
3: 249405
4: 160689
1105939940_1105939943 -5 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939940_1105939946 11 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939946 13:25138893-25138915 GAGATGGGGTTTCACCATGTCGG 0: 39926
1: 95780
2: 131152
3: 108291
4: 62548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105939940 Original CRISPR CAGAGATTGGCCCAGTGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr