ID: 1105939941

View in Genome Browser
Species Human (GRCh38)
Location 13:25138862-25138884
Sequence ACACAGAGATTGGCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 866}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105939941_1105939947 17 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939947 13:25138902-25138924 TTTCACCATGTCGGCCAAGCTGG 0: 26
1: 3952
2: 97691
3: 165973
4: 177042
1105939941_1105939944 -7 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939944 13:25138878-25138900 TCTGTGTTTTTAGTAGAGATGGG 0: 44
1: 5266
2: 101853
3: 249405
4: 160689
1105939941_1105939945 -6 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939945 13:25138879-25138901 CTGTGTTTTTAGTAGAGATGGGG 0: 48
1: 4986
2: 93310
3: 182047
4: 180271
1105939941_1105939943 -8 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939941_1105939946 8 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939946 13:25138893-25138915 GAGATGGGGTTTCACCATGTCGG 0: 39926
1: 95780
2: 131152
3: 108291
4: 62548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105939941 Original CRISPR ACACAGAGATTGGCCCAGTG TGG (reversed) Intergenic
901386165 1:8910749-8910771 ACAATGAGGTTGGCCAAGTGTGG + Intergenic
901482789 1:9537494-9537516 ATACAAAAATTAGCCCAGTGTGG + Intergenic
901598974 1:10407650-10407672 AGAAAAAGATGGGCCCAGTGCGG + Intronic
901720448 1:11193159-11193181 ATACAAAAATTAGCCCAGTGTGG + Intronic
901824777 1:11854032-11854054 ACAAAAAGATTAGCCAAGTGTGG + Intergenic
902564219 1:17300121-17300143 ATACAAAAATTAGCCCAGTGTGG - Intergenic
902904822 1:19548475-19548497 ATACAAAAATTAGCCCAGTGTGG + Intergenic
903180872 1:21604235-21604257 ACACAGACACAGGCCCAGGGAGG + Intronic
903276867 1:22227772-22227794 ATACAAACATTGGCCAAGTGTGG - Intergenic
903513131 1:23891461-23891483 ATACAAAAATTGGCCAAGTGTGG + Intronic
903802717 1:25981635-25981657 ACAAAGGGACTGGCCCAGAGGGG + Intronic
903905346 1:26681881-26681903 ACAGAAAAATTAGCCCAGTGTGG + Intergenic
903958671 1:27042428-27042450 ACACAAATATTGGCCCGGCGTGG + Intergenic
904081475 1:27875132-27875154 ATACAAAAATTAGCCCAGTGTGG - Intronic
904289600 1:29475610-29475632 ACACAGGGCTTGGCCCAGAGTGG - Intergenic
904338560 1:29814370-29814392 ACACAAAAATTGGCCCAGCCTGG - Intergenic
904354980 1:29933116-29933138 ACACAGAGCCTGGCCCACGGAGG - Intergenic
904387150 1:30150851-30150873 AAACAGAGATCAGGCCAGTGGGG + Intergenic
904768878 1:32870301-32870323 ACACAGAGAGAGGCCCAGGTGGG + Intronic
904793155 1:33038899-33038921 ACAAAAAAATTAGCCCAGTGTGG + Intronic
905046162 1:35004334-35004356 ACAAACAAATTAGCCCAGTGTGG + Intronic
905074108 1:35254447-35254469 ATACAAAAATTAGCCCAGTGTGG + Intergenic
905108709 1:35578925-35578947 ATACAAAAATTAGCCCAGTGTGG + Intronic
905216271 1:36410330-36410352 ACACAAAAATTAGCCAAGTGTGG - Intergenic
906177158 1:43784351-43784373 ATACAAAAATTGGCCGAGTGTGG + Intronic
906232370 1:44175246-44175268 ACAAAGAAATTAGCCAAGTGTGG + Intergenic
906257425 1:44360819-44360841 ATACAAAAATTAGCCCAGTGTGG + Intergenic
906549290 1:46649004-46649026 ATACAAAAATTAGCCCAGTGTGG + Intronic
907167122 1:52422766-52422788 ATACAAAAATTGGCCAAGTGTGG + Intronic
907233928 1:53027208-53027230 ACACAAAAATTGGCCTGGTGTGG - Intronic
907691283 1:56669301-56669323 ATACAGAAATTAGCCAAGTGTGG + Intronic
908108701 1:60873676-60873698 ACACAAAAATTAGCCCAGCGTGG + Intronic
908191494 1:61708201-61708223 ATACAAAAATTAGCCCAGTGAGG - Intronic
908201656 1:61802247-61802269 ATACAAAAATTAGCCCAGTGTGG - Intronic
908491098 1:64644939-64644961 ATACAGAAATTAGCCAAGTGTGG + Intronic
908567860 1:65377051-65377073 ACACAGAAATTGGCCAGGTGTGG - Intronic
908725087 1:67167224-67167246 ATACAAAAATTAGCCCAGTGTGG - Intronic
908993843 1:70128115-70128137 ATACAAAAATTAGCCCAGTGTGG - Intronic
909253912 1:73393654-73393676 ACACAAAAATTGGCCAGGTGTGG + Intergenic
909526561 1:76630068-76630090 ACACAGACAATAGCCCAATGGGG - Exonic
909535667 1:76733562-76733584 AAACAAAAATTGGCCCAGTGTGG + Intergenic
909728697 1:78867860-78867882 ACACAAAAATTATCCCAGTGTGG + Intergenic
909995008 1:82268592-82268614 ATACAAAAATTAGCCCAGTGTGG + Intergenic
910616480 1:89204410-89204432 ACACAGAGGTTGGAACAGTTTGG + Intergenic
910673135 1:89793191-89793213 ACAAAAAAATTGGCCGAGTGTGG + Intronic
911370556 1:96989672-96989694 CCACAGAGAAGGGTCCAGTGAGG + Intergenic
911513081 1:98831777-98831799 ATACAAAAATTAGCCCAGTGTGG - Intergenic
911908902 1:103606367-103606389 ACACAGAAATTAGCCCAGCGTGG + Intergenic
911914017 1:103673094-103673116 ACACAGAAATTAGCCCAGCGTGG - Intronic
911993871 1:104737537-104737559 ATACAGAAATTGGCCAGGTGTGG + Intergenic
912299749 1:108502779-108502801 GCACACAGAATGGCCAAGTGAGG - Intergenic
912377571 1:109223646-109223668 ACACAAAAATTAGCCGAGTGTGG + Intronic
912867443 1:113270509-113270531 ACACAAAAATTAGCCAAGTGTGG - Intergenic
913614633 1:120546164-120546186 ATACAAAAATTAGCCCAGTGTGG - Intergenic
913682955 1:121204413-121204435 ATACAAAAATTGGCCCAGCGTGG - Intronic
914034799 1:143992039-143992061 ATACAAAAATTGGCCCAGCGTGG - Intergenic
914154655 1:145075930-145075952 ATACAAAAATTGGCCCAGCGTGG + Intronic
914941846 1:152030115-152030137 ACACAGTGATTGGCCTAGGGTGG - Intergenic
915149049 1:153814818-153814840 ACACAAAAATTGGCCAGGTGTGG + Intronic
915161981 1:153927138-153927160 ATACAAAGATTAGCCAAGTGTGG - Intergenic
915271808 1:154758961-154758983 ATACAAAAATTAGCCCAGTGTGG - Intronic
915299873 1:154945841-154945863 GCACAGAGCTAGCCCCAGTGCGG - Exonic
915312654 1:155012104-155012126 ACACAGGGATTGGGCAAGGGTGG - Intronic
915547395 1:156608696-156608718 ACACAAAAATTAGCCAAGTGTGG - Intergenic
915681438 1:157585519-157585541 GAACATAGCTTGGCCCAGTGTGG + Intronic
916826217 1:168444372-168444394 ATACAGAAATTAGCCAAGTGTGG + Intergenic
917117408 1:171616382-171616404 ATACAAAAATTAGCCCAGTGTGG + Intergenic
917346764 1:174036402-174036424 AAATAGAGAATAGCCCAGTGAGG - Intergenic
917363164 1:174199445-174199467 ATACAGAAATTGGCTGAGTGTGG - Intronic
917565791 1:176210306-176210328 ACACTGTGATTGGCCGGGTGCGG + Intergenic
917575437 1:176316443-176316465 ACACAGAAATTGGCCCATGAAGG - Intergenic
917939945 1:179908873-179908895 AACCAGAGATTGGCCAGGTGCGG + Intronic
917968181 1:180191585-180191607 ACTCAGATACTGGCCCTGTGGGG - Intronic
918569423 1:185970948-185970970 ACCTAGAAAGTGGCCCAGTGTGG - Intronic
919225298 1:194690677-194690699 ACACAAAAATTAGCCAAGTGTGG - Intergenic
920080813 1:203371705-203371727 ACACAGAGACTGGCCCAGAGGGG + Intergenic
920361461 1:205419616-205419638 ACACAAAAATTAGCCGAGTGTGG - Intronic
920470267 1:206222927-206222949 ATACAAAAATTGGCCCAGCGTGG - Intronic
920751574 1:208682924-208682946 AGGCAGAGATTGGCACTGTGGGG + Intergenic
920918049 1:210274266-210274288 ACACAAAAATTAGGCCAGTGTGG - Intergenic
921594473 1:217039221-217039243 ACACAGAGGTTGGAACAGTTTGG - Intronic
922403434 1:225285564-225285586 AAACAGATGCTGGCCCAGTGTGG + Intronic
923756130 1:236792769-236792791 ACACAAAAATTAGCCGAGTGTGG - Intergenic
923799877 1:237198098-237198120 TCAGAGAGAATGGCCCAGTCCGG + Intronic
924096009 1:240551502-240551524 ATACAAAAATTAGCCCAGTGTGG - Intronic
924119703 1:240783883-240783905 ACACACAGAATGGCCAGGTGCGG + Intronic
924742079 1:246800276-246800298 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1063026171 10:2180879-2180901 ACACAGAGATGGTACAAGTGTGG + Intergenic
1063784024 10:9359627-9359649 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1064084636 10:12336147-12336169 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1064303003 10:14139603-14139625 ACAAAAAAATTAGCCCAGTGTGG - Intronic
1064556315 10:16550372-16550394 ATACAGAAATTAGCCCAGTGTGG - Intergenic
1064701721 10:18028873-18028895 ACACAAAAATTAGCCGAGTGTGG - Intronic
1064910377 10:20394876-20394898 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1065337454 10:24668289-24668311 ACACAGACAGGGCCCCAGTGGGG - Intronic
1065345862 10:24747611-24747633 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1065678471 10:28204285-28204307 ATACAAAAATTAGCCCAGTGTGG + Intronic
1065797684 10:29322342-29322364 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1066321593 10:34308359-34308381 ACACAGAGCTTGGACCACTGGGG + Intronic
1066622676 10:37374762-37374784 AGACAGTGAATGGCGCAGTGGGG - Intronic
1066646334 10:37614221-37614243 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1066671519 10:37845175-37845197 ATACAAAAATTAGCCCAGTGTGG - Intronic
1066690546 10:38023099-38023121 ATACAGAAATTAGCCGAGTGTGG - Intronic
1067948974 10:50710607-50710629 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1068176204 10:53462606-53462628 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1068385814 10:56326192-56326214 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1068991545 10:63156103-63156125 ATACAAAGATTAGCCGAGTGTGG + Intergenic
1069254610 10:66316680-66316702 ACACAGACAGTGGCCCAGGTGGG + Intronic
1069297859 10:66869415-66869437 ATACAAAAATTAGCCCAGTGTGG + Intronic
1069311586 10:67044529-67044551 TCACAGAGATTAGCTCAATGGGG - Intronic
1069465795 10:68637714-68637736 ATACAAAAATTAGCCCAGTGTGG + Intronic
1070171574 10:73937063-73937085 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1070217062 10:74396241-74396263 ACTCAGAAATTGGCCGGGTGTGG + Intronic
1070250936 10:74772372-74772394 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1070260388 10:74849135-74849157 ATACAAAAATTAGCCCAGTGTGG - Intronic
1070456335 10:76620894-76620916 ACACAGAGGTTGGAACAGTTTGG - Intergenic
1070558427 10:77547526-77547548 ACACAGAGGTGGGCCCGGTTGGG - Intronic
1070837262 10:79457212-79457234 ACACAGAAATTAGCCAGGTGTGG - Intergenic
1071042061 10:81322435-81322457 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1071148254 10:82600623-82600645 ATACAAAAATTAGCCCAGTGTGG - Intronic
1071226629 10:83537841-83537863 CCACAGAAATTGGCCAAGTTTGG + Intergenic
1071543781 10:86511773-86511795 ATATAGAAATTAGCCCAGTGTGG + Intronic
1071589626 10:86860612-86860634 ATACAAAAATTGGCCAAGTGTGG + Intronic
1071612339 10:87042873-87042895 ATACACAGATTGGCCGGGTGTGG + Intergenic
1072069202 10:91900288-91900310 AAAAAGATATTGGCCGAGTGTGG + Intergenic
1072507352 10:96081763-96081785 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1072688092 10:97550599-97550621 ACACAGTGCCTGGCCCAGCGCGG - Intronic
1072962400 10:99941038-99941060 ACACAAAAATTAGCCAAGTGTGG - Intronic
1072969735 10:100006956-100006978 ATACAAACATTGGCCCAGCGTGG + Intronic
1073257963 10:102166934-102166956 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1075002030 10:118805677-118805699 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1075181917 10:120219075-120219097 AGACAGAGATTGGCTGGGTGTGG - Intergenic
1075328403 10:121553860-121553882 ACCCATGGCTTGGCCCAGTGAGG - Intronic
1075344823 10:121674252-121674274 ACACAGAGATTGACAAAGAGGGG - Intergenic
1076710218 10:132329256-132329278 ATACAAAAATTAGCCCAGTGTGG + Intronic
1077078957 11:714519-714541 ACACAGGAACTGGCCCAGCGCGG - Intronic
1077269498 11:1668752-1668774 ACACAGAAATTAGCCGGGTGTGG + Intergenic
1077526089 11:3066376-3066398 AGACAAAAATTAGCCCAGTGTGG - Intergenic
1079216353 11:18516108-18516130 GCACAGGGATTGTTCCAGTGAGG + Exonic
1079389416 11:20008209-20008231 ACACAAAAATTAGCCAAGTGTGG + Intronic
1079818021 11:25087249-25087271 ACACAGAGATTAGCTAATTGAGG - Intergenic
1080502251 11:32882119-32882141 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1080707587 11:34712531-34712553 AGACAGAGATTGGAACAGTTCGG + Intergenic
1081032944 11:38110091-38110113 ACACAGAGATTGGAACAGTTTGG + Intergenic
1081562371 11:44229555-44229577 ACACGGAGATGGTCACAGTGAGG + Intronic
1081607767 11:44537895-44537917 ACAGAGAGAAAGGCCCAGAGAGG + Intergenic
1081621369 11:44620910-44620932 ATACAGAAATTAGCCGAGTGTGG + Intergenic
1081751897 11:45517368-45517390 GCACAGGGACTGGCCCAGGGCGG - Intergenic
1082009461 11:47440590-47440612 ATACAAAAATTAGCCCAGTGTGG + Intronic
1082879116 11:58021171-58021193 GCACAGAGCCTGGCCCAGAGTGG + Intergenic
1083224480 11:61276250-61276272 ATACAAAAATTAGCCCAGTGTGG + Intronic
1083685546 11:64373055-64373077 CCACAGTGATTGGTTCAGTGTGG - Intergenic
1084505129 11:69561740-69561762 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1084509444 11:69594024-69594046 ACACAGTGATTGGCTCAGGGTGG + Intergenic
1084656019 11:70519063-70519085 ATACAAAAATTAGCCCAGTGTGG - Intronic
1084670121 11:70601505-70601527 ATACAAAGATTGGCCAGGTGCGG - Intronic
1084885973 11:72207123-72207145 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1085052500 11:73387098-73387120 ATACAAAAATTAGCCCAGTGTGG - Intronic
1085089803 11:73701793-73701815 ACACAGAAATTAACCCAGCGTGG - Intronic
1085424748 11:76394052-76394074 ACACAAAAATTGGCCAGGTGTGG - Intronic
1085539295 11:77252216-77252238 ACACAGAAATTAGCCAGGTGTGG - Intronic
1086056361 11:82652132-82652154 ACACAAAAATTAGCCCAATGTGG - Intergenic
1086721016 11:90120795-90120817 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1087015553 11:93551319-93551341 GAACAGGTATTGGCCCAGTGAGG + Intergenic
1087271789 11:96119475-96119497 ACACTGATTTTAGCCCAGTGAGG + Intronic
1087412776 11:97813001-97813023 ACACATTGATTGGCCGGGTGCGG + Intergenic
1088221327 11:107573024-107573046 ACAAAGATATTTGCCCAGAGAGG + Intergenic
1088243362 11:107793070-107793092 ACACAAAAATTGGCCGGGTGTGG - Intronic
1088668054 11:112114291-112114313 ATACAGAAATTAGCCCAGCGTGG - Intronic
1088939131 11:114435972-114435994 ATACAAAAATTAGCCCAGTGTGG + Intronic
1088994725 11:114986519-114986541 ACCCGGAGATTGGCCCAGTCAGG + Intergenic
1089004998 11:115083881-115083903 ACACTGGGCTTGGCACAGTGGGG - Intergenic
1089099124 11:115946084-115946106 TCACAGAGTTTGTGCCAGTGTGG - Intergenic
1089245652 11:117117557-117117579 ACACACACATTAGCCAAGTGTGG - Intergenic
1089276981 11:117343784-117343806 ACACAAAAATTAGCCCAGCGTGG - Intronic
1089449800 11:118585693-118585715 ATACAGAAATTAGCCCAGCGTGG - Intronic
1089537731 11:119170985-119171007 ATACAAAAATTAGCCCAGTGTGG + Intronic
1090544193 11:127744884-127744906 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1090701363 11:129298788-129298810 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1090834939 11:130447525-130447547 ACACACAAATTGGCCTAGCGTGG + Intergenic
1091562629 12:1626718-1626740 ACAAAAAAATTAGCCCAGTGTGG - Intronic
1091591641 12:1846191-1846213 ACACAGAGACCAGCCCAGAGAGG + Intronic
1091900773 12:4142300-4142322 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1092058068 12:5523517-5523539 ACACAGAGGAGGCCCCAGTGTGG + Intergenic
1092252080 12:6905150-6905172 CCAAGGAAATTGGCCCAGTGGGG + Intronic
1092404890 12:8213765-8213787 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1092452503 12:8616033-8616055 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1092976840 12:13753486-13753508 ATACAGAGATGAGCCCAGTGGGG + Exonic
1093074205 12:14740654-14740676 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1093327166 12:17790902-17790924 ACCCAGAGATGTGGCCAGTGTGG - Intergenic
1093354562 12:18150516-18150538 ATACAAAAATTAGCCCAGTGTGG + Intronic
1093379635 12:18477073-18477095 ACACAGAGAAAGGCCATGTGAGG - Intronic
1093622010 12:21302845-21302867 ACACAAAAATTAGCCGAGTGTGG - Intronic
1094298274 12:28932520-28932542 ATACAAAAATTGGCCAAGTGTGG + Intergenic
1094603226 12:31928857-31928879 ATACAGAAATTAGCCCGGTGTGG - Intergenic
1095053614 12:37576117-37576139 ACACAAAAATTGGCCAGGTGTGG - Intergenic
1095469419 12:42520532-42520554 AGACAGAGCTTTGCACAGTGGGG + Intronic
1095615575 12:44184188-44184210 ATACAAAAATTAGCCCAGTGTGG + Intronic
1096135818 12:49199651-49199673 ATACAAAAATTAGCCCAGTGTGG + Intronic
1096481682 12:51945985-51946007 ACACAAAAATTGGCCAGGTGTGG - Intergenic
1096567756 12:52495571-52495593 AGACAGAGCTCCGCCCAGTGGGG + Intergenic
1097375083 12:58833509-58833531 AGATGGAGAATGGCCCAGTGGGG - Intergenic
1097431034 12:59507103-59507125 ACACAGAAATTAGCCAGGTGTGG - Intergenic
1099206674 12:79736534-79736556 ATACAAAAATTGGCCAAGTGTGG + Intergenic
1099785401 12:87256302-87256324 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1100007742 12:89913942-89913964 ACACAAAGATTAGCCAGGTGTGG + Intergenic
1100091478 12:90977221-90977243 ACACAGAGAATGGCATAGTTAGG - Intronic
1100503553 12:95197280-95197302 ATACAAAAATTAGCCCAGTGTGG + Intronic
1100971715 12:100078231-100078253 AGACAGAGAGTGGCGCAGGGAGG - Intronic
1101022980 12:100572655-100572677 ACACAAAAATTAGCCCGGTGTGG + Intergenic
1101536684 12:105624186-105624208 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1101735633 12:107460787-107460809 ACTCAGAGAGGGTCCCAGTGGGG + Intronic
1101741207 12:107501542-107501564 ATACAAAAATTAGCCCAGTGTGG + Intronic
1102353308 12:112211192-112211214 ATACAAAAATTAGCCCAGTGTGG + Intronic
1102525512 12:113509904-113509926 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1102870906 12:116413203-116413225 CCACAAAGACTGGCCCTGTGGGG + Intergenic
1103264430 12:119617123-119617145 AGACAGAGATTGGAACAGTTTGG + Intronic
1103463115 12:121121015-121121037 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1104331047 12:127845299-127845321 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1104392136 12:128400210-128400232 TCCCAGGGGTTGGCCCAGTGAGG - Intronic
1104750363 12:131234582-131234604 ACAAAGGGATTGTCCCAGCGTGG + Intergenic
1104782357 12:131429880-131429902 ACAAAGGGATTGTCCCAGCGTGG - Intergenic
1105939941 13:25138862-25138884 ACACAGAGATTGGCCCAGTGTGG - Intergenic
1106555853 13:30807878-30807900 ACACAGAAAATGGAACAGTGAGG + Intergenic
1106618805 13:31354676-31354698 ACGCAGAGATTGGAACAGTTTGG + Intergenic
1106835255 13:33627479-33627501 ATACAAAAATTGGCCGAGTGCGG + Intergenic
1107050708 13:36045694-36045716 ACACAAAGATTAGCCAGGTGTGG + Intronic
1107169444 13:37322584-37322606 CCACAGAGACTGGCACAGAGGGG - Intergenic
1107477996 13:40759145-40759167 AAAGAGAGATTGGCCAGGTGCGG + Intronic
1108019640 13:46113847-46113869 ATACAGAAATTAGCCCAGTATGG - Intergenic
1108043766 13:46363698-46363720 ACAAAAAAATTAGCCCAGTGTGG + Intronic
1108212993 13:48157133-48157155 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1108329412 13:49370329-49370351 ACAAAGATATTGGGGCAGTGGGG - Intronic
1108625763 13:52227310-52227332 ACACAAAAATTAGCCCAGTGTGG + Intergenic
1108660298 13:52579108-52579130 ACACAAAAATTAGCCCGGTGTGG - Intergenic
1109200566 13:59426311-59426333 ACACAAAAATTAGTCCAGTGTGG + Intergenic
1109718262 13:66245337-66245359 AGACAGAGATTGGCAAAGTTTGG + Intergenic
1110470826 13:75857816-75857838 ACTCAGAAAGTGGCCCAATGAGG - Intronic
1111541198 13:89669357-89669379 ATACAAAAATTGGCCCAGTGTGG - Intergenic
1111716104 13:91880944-91880966 ACACAAAAATTAGCCCTGTGTGG - Intronic
1111869838 13:93817701-93817723 ATACAAAAATTAGCCCAGTGTGG + Intronic
1112858994 13:103807645-103807667 AGACAGAGGTTGGGTCAGTGTGG + Intergenic
1113103132 13:106742683-106742705 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1113512318 13:110866086-110866108 AGACAGAGATTGGAACAGTTTGG - Intergenic
1113970535 13:114185358-114185380 AGGCAGAGAGGGGCCCAGTGGGG + Intergenic
1115571934 14:34674918-34674940 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1116054659 14:39848652-39848674 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1116361283 14:44001457-44001479 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1116418972 14:44711276-44711298 ATACAGAAATTAGCCGAGTGTGG - Intergenic
1116431671 14:44853245-44853267 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1116597693 14:46872357-46872379 ACGCAGAGATTAGCACAGGGAGG - Intronic
1116616162 14:47142286-47142308 ATACAAAAATTAGCCCAGTGTGG + Intronic
1116670391 14:47833889-47833911 ACACAAAAATTAGCCCAGCGTGG - Intergenic
1116913287 14:50494322-50494344 ATACAAAAATTAGCCCAGTGTGG - Intronic
1117253811 14:53958166-53958188 AAACAGATATTGGCCCTGGGTGG + Intronic
1117543148 14:56768318-56768340 ATACAGAAATTAGCCGAGTGTGG - Intergenic
1118026297 14:61772398-61772420 ATACAAAGATTAGCCCAGCGTGG - Intronic
1118411495 14:65483737-65483759 ACAGAGTTATTGGCCAAGTGTGG + Intronic
1118934480 14:70274304-70274326 ACACAGCTATTTGCCCACTGCGG + Intergenic
1119036016 14:71231176-71231198 AGGCAGAGAGTGTCCCAGTGAGG + Intergenic
1119127953 14:72145632-72145654 ACAAAAAAATTAGCCCAGTGTGG - Intronic
1119249607 14:73140364-73140386 ATACAAAAATTAGCCCAGTGTGG - Intronic
1121026825 14:90622272-90622294 ATACAAAAATTGGCCAAGTGTGG - Intronic
1121192044 14:92039635-92039657 ACCCAGAGACTGGCCCAATCCGG + Exonic
1121239556 14:92418990-92419012 ACACAAAAATTGGCCGGGTGCGG - Intronic
1121550192 14:94793598-94793620 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1121585376 14:95059690-95059712 ACACAAAAAATGGCCAAGTGTGG + Intergenic
1122311941 14:100803004-100803026 CCACTGAGATTGCCCCAGAGAGG - Intergenic
1122969194 14:105145586-105145608 TCACAGAGAGTGGCCCTGTGGGG - Intronic
1123976894 15:25562328-25562350 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1124423672 15:29543621-29543643 ATACAAAGATTGGCCAGGTGTGG + Intronic
1125551923 15:40551521-40551543 ACACAGAGAGTGGCTCTCTGTGG - Intronic
1125660184 15:41387952-41387974 ATACAAAGATTAGCCAAGTGTGG + Intronic
1125660412 15:41390117-41390139 ATACAAAAATTAGCCCAGTGTGG - Intronic
1125751000 15:42028560-42028582 ATACAAAAATTAGCCCAGTGTGG - Intronic
1125776795 15:42223235-42223257 ATACAAAGATTAGCCCAGTGTGG + Intronic
1125897176 15:43312379-43312401 ACACAAAAATTGGCTGAGTGTGG - Intergenic
1125929622 15:43591021-43591043 ATACAGAAATTAGCCGAGTGTGG + Intergenic
1125942789 15:43690853-43690875 ATACAGAAATTAGCCGAGTGTGG + Intergenic
1125985885 15:44051305-44051327 ATACAAAAATTAGCCCAGTGTGG - Intronic
1126386032 15:48094307-48094329 ACACAGAGATTATACCAGTCAGG - Intergenic
1126641441 15:50831006-50831028 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1126693412 15:51305714-51305736 ATACAAAAATTAGCCCAGTGTGG - Intronic
1127236195 15:57055244-57055266 ACACAAAAATTAGCCGAGTGTGG + Intronic
1128113529 15:65091434-65091456 ATACAAAGATTGGCCAGGTGTGG - Intergenic
1128157094 15:65398376-65398398 ACACAAAAATTAGCCGAGTGTGG + Intronic
1128158690 15:65408987-65409009 ATACAAAAATTAGCCCAGTGTGG - Intronic
1128338579 15:66804101-66804123 ACTCAGAGATTGGCCCATGCTGG + Intergenic
1128407561 15:67358484-67358506 ATACAGAATTTGGCCCGGTGTGG - Intronic
1128745190 15:70109342-70109364 AGGCAGAGATTGGCACAGTAGGG - Intergenic
1128766235 15:70252847-70252869 ACACAGACATTGGCCAGATGAGG + Intergenic
1129436966 15:75549354-75549376 ATACAGAAATTAGCCAAGTGTGG - Intronic
1129862153 15:78871382-78871404 ACACAAAAATTAGCCCGGTGTGG + Intronic
1130371814 15:83291293-83291315 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1131004848 15:88969166-88969188 ATACAAAAATTGGCCAAGTGTGG + Intergenic
1131033480 15:89205816-89205838 ATACAAAAATTGGCCGAGTGTGG + Intergenic
1131488151 15:92839307-92839329 AAACACAGAATGGCCGAGTGTGG + Intergenic
1131803032 15:96091446-96091468 ACACAAATATTAGCCGAGTGTGG - Intergenic
1132127316 15:99239327-99239349 ATACAAAAATTAGCCCAGTGTGG + Intronic
1132483811 16:180219-180241 ACACAAAAATTGGCCGGGTGCGG - Intergenic
1133231328 16:4368189-4368211 ATACAAAAATTGGCCAAGTGTGG + Intronic
1133390690 16:5407702-5407724 ACACAAAAATTAGCCCAGCGTGG - Intergenic
1133478671 16:6148169-6148191 ATACAGAAATTAGCCGAGTGTGG + Intronic
1133524879 16:6594942-6594964 ACACAAAAATTAGCCCGGTGTGG - Intronic
1133611198 16:7434893-7434915 ATACAAAAATTAGCCCAGTGTGG - Intronic
1133701376 16:8312361-8312383 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1133772257 16:8874032-8874054 ACACAAAAATTAGCCCGGTGTGG - Intergenic
1133817229 16:9207311-9207333 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1134302298 16:13002686-13002708 ATACAAAAATTAGCCCAGTGCGG - Intronic
1134323689 16:13187488-13187510 ATACAAAAATTAGCCCAGTGTGG - Intronic
1134491448 16:14698784-14698806 ATACAAAAATTAGCCCAGTGCGG + Intergenic
1134496829 16:14737902-14737924 ATACAAAAATTAGCCCAGTGCGG + Intronic
1134667601 16:16030367-16030389 ATACAAACATTAGCCCAGTGTGG + Intronic
1135017568 16:18936589-18936611 ACACAAAAATTGGCCAGGTGCGG - Intergenic
1135209036 16:20508297-20508319 ACACAGAGGTTGGAACAGTTTGG - Intergenic
1135279106 16:21138519-21138541 ACACAGAGACTGGCTGGGTGCGG + Intronic
1135598947 16:23765216-23765238 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1136162217 16:28427786-28427808 ATACAGAAATTAGCCAAGTGTGG - Intergenic
1136179406 16:28540639-28540661 AAGCAAAGATTGGCCTAGTGCGG + Intergenic
1136200748 16:28687203-28687225 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1136217090 16:28801390-28801412 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1136367959 16:29817627-29817649 ATACAAAAATTGGCCCAGAGTGG - Intronic
1136378907 16:29882124-29882146 ACACAGAAATTAGCCAGGTGTGG - Intronic
1136471326 16:30482645-30482667 ACACAGACATGGGCCTATTGCGG - Intronic
1137286639 16:47021596-47021618 ATACAGAAATTAGCCAAGTGTGG - Intergenic
1137699709 16:50488831-50488853 CCACAGTGATTGGTCCAGTGTGG - Intergenic
1138175689 16:54896270-54896292 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1138194640 16:55043337-55043359 GCACACAGCCTGGCCCAGTGAGG + Intergenic
1138500275 16:57437679-57437701 ATACAAAAATTAGCCCAGTGTGG - Intronic
1138515339 16:57532996-57533018 GCACAGGGCTTGGCCCAGAGAGG + Intronic
1138934076 16:61697343-61697365 AGACAGAGAATGGCTCAGTTGGG + Intronic
1139617761 16:68110158-68110180 ATACAAAAATTAGCCCAGTGTGG - Intronic
1139773415 16:69297460-69297482 ATACATAAATTGGCCTAGTGTGG + Intronic
1140359956 16:74335807-74335829 ATACAGAAATTAGCCCAGCGTGG + Intergenic
1141328678 16:83087510-83087532 ATACAGAGATTAGCCAGGTGCGG + Intronic
1142065368 16:88059337-88059359 AGGCAGAGATTGGAACAGTGTGG - Intronic
1142119708 16:88379886-88379908 ACACAGTGACTGGCCCGGAGTGG + Intergenic
1142393835 16:89819863-89819885 ACACAAAAATTGGCCAGGTGTGG + Intronic
1142707320 17:1704067-1704089 ACACAAAAATTAGCCGAGTGTGG + Exonic
1142868157 17:2803721-2803743 ATACAAAAATTAGCCCAGTGTGG + Intronic
1142989546 17:3721082-3721104 ATACAAAAATTAGCCCAGTGTGG - Intronic
1142992734 17:3742608-3742630 ATACAAAGATTAGCCCAGTGTGG - Intronic
1143018328 17:3903688-3903710 ACACAGAGCTTGGCACAGCAGGG + Intronic
1143369606 17:6430298-6430320 ATACAAAAATTGGCCCGGTGTGG + Intronic
1143579125 17:7814692-7814714 ACACAAAAATTGGCCGGGTGTGG + Intronic
1143590436 17:7883085-7883107 ATACAGAGATTTGCCCAGAGAGG - Intronic
1143946577 17:10597810-10597832 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1144010409 17:11143027-11143049 ACGGAGAGATTGGGCCAGTTTGG - Intergenic
1144210147 17:13007720-13007742 ACACAAAAATTAGCCAAGTGTGG + Intronic
1145078590 17:19875728-19875750 AAACAGAAATTGGCCAGGTGTGG - Intergenic
1145839159 17:27979341-27979363 ACAAAAAGATTGGCCGAGTGTGG + Intergenic
1145968092 17:28935425-28935447 AGACAAAAATTAGCCCAGTGTGG - Intronic
1146049219 17:29535696-29535718 ATACAAAAATTGGCCAAGTGTGG + Intronic
1146175091 17:30660964-30660986 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1146345204 17:32055947-32055969 ATACAAAGATTAGCCGAGTGTGG - Intergenic
1146721399 17:35126656-35126678 ACACAAAAATTGGCTGAGTGCGG - Intronic
1146899821 17:36576181-36576203 ACACAAAAATCAGCCCAGTGTGG + Intronic
1147138862 17:38450561-38450583 ATACAGAAATTAGCCAAGTGTGG - Intronic
1147227437 17:38990385-38990407 ACACAAAAATTGCCCGAGTGTGG - Intergenic
1147252123 17:39158966-39158988 AAACAGAGATTGGGCCAGCATGG - Intronic
1147278212 17:39336666-39336688 ATACAAAAATTAGCCCAGTGTGG + Intronic
1147975550 17:44246325-44246347 ACCCAGAGACTGGCCAGGTGCGG + Intergenic
1148397543 17:47322062-47322084 ATACAGAAATTAGCCAAGTGTGG + Intronic
1148873139 17:50670236-50670258 ACACAAAAATTAGCCAAGTGTGG - Intronic
1149601291 17:57894513-57894535 ATACAAAAATTAGCCCAGTGTGG + Intronic
1149767092 17:59288490-59288512 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1149936137 17:60809126-60809148 ATACAAAAATTAGCCCAGTGTGG + Intronic
1150162037 17:62906609-62906631 ACACAGAGAGAGGCCAGGTGCGG - Intergenic
1150471316 17:65439773-65439795 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1150625753 17:66840149-66840171 GCACAGAGAGGGGGCCAGTGAGG - Intronic
1150773284 17:68059750-68059772 ATACAAAAATTGGCCCCGTGTGG - Intergenic
1151101937 17:71565854-71565876 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1151172501 17:72259061-72259083 ATACAGAAATTAGCCCGGTGTGG - Intergenic
1151265143 17:72949314-72949336 ACACAAAGATTAGCCCGGCGTGG - Intronic
1151270211 17:72988303-72988325 ACACACAAATTGGCCGGGTGCGG + Intronic
1151342968 17:73483462-73483484 ACACAAAGATTAGCCAGGTGTGG - Intronic
1151740914 17:75981340-75981362 ACACAAAAATTAGCCAAGTGTGG - Intronic
1151871629 17:76840728-76840750 ACAGAGAGCTTGGCTCAGGGAGG - Intergenic
1152713131 17:81884854-81884876 GCACAGGGATTGGCCCAGGTTGG - Intergenic
1152860559 17:82694374-82694396 AAAAACAAATTGGCCCAGTGTGG + Intronic
1153164063 18:2241952-2241974 ATAAAAAAATTGGCCCAGTGTGG - Intergenic
1153841903 18:9015124-9015146 ACACACAGACTGGCCCAGGGAGG - Intergenic
1154938954 18:21091812-21091834 ACACAAAAATTAGCCCAGCGTGG + Intronic
1154950494 18:21204874-21204896 ATACAGAAATTAGCCCAGCGTGG + Intergenic
1154956861 18:21267087-21267109 ATACAAAGATGAGCCCAGTGTGG - Intronic
1155695179 18:28676618-28676640 ATACAAAAATTGGCCAAGTGTGG + Intergenic
1155887409 18:31224921-31224943 ATACTAAAATTGGCCCAGTGTGG - Intergenic
1156076564 18:33286127-33286149 ATACAAAAATTAGCCCAGTGTGG - Intronic
1156332106 18:36132064-36132086 ACACAAAAATTGGCCAGGTGTGG - Intronic
1156363729 18:36406814-36406836 ACACAGAGAGTACCCTAGTGGGG - Intronic
1156707151 18:39897189-39897211 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1157138493 18:45082291-45082313 ACACAGAAATTAGCCGGGTGTGG + Intergenic
1157216046 18:45784376-45784398 ATACAGAAATTAGCCCGGTGTGG - Intergenic
1157236769 18:45971852-45971874 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1157334325 18:46726761-46726783 ACAAAAAAATTAGCCCAGTGTGG + Intronic
1157381736 18:47224768-47224790 ACACACAAATTAGCCAAGTGTGG - Intronic
1158538263 18:58328118-58328140 ACACAAAAATTAGCCGAGTGTGG - Intronic
1158710157 18:59830341-59830363 ATACAAAGATTAGCCCAGCGTGG - Intergenic
1158779221 18:60626430-60626452 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1159244772 18:65791566-65791588 AAATAGAGAATGGCCCAGAGTGG - Intronic
1159831110 18:73279216-73279238 ATACAAACATTAGCCCAGTGTGG + Intergenic
1159880939 18:73857940-73857962 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1160919325 19:1512522-1512544 ACACAAAAATTAGCCCGGTGTGG + Intronic
1161564513 19:4993252-4993274 ACACAAAAATTAGCCGAGTGTGG + Intronic
1161915189 19:7223025-7223047 ATACAAAAATTAGCCCAGTGTGG + Intronic
1161996231 19:7713475-7713497 ACACGAAAATTAGCCCAGTGTGG + Intergenic
1162669821 19:12246874-12246896 ACAAAAAAACTGGCCCAGTGTGG + Intronic
1162764136 19:12907954-12907976 ACACAAAAATTAGCCGAGTGTGG + Intronic
1162905444 19:13820389-13820411 ATACAAAAATTAGCCCAGTGCGG - Intronic
1163032843 19:14555599-14555621 ACACAAAAATTAGCCAAGTGTGG - Intronic
1163139701 19:15338782-15338804 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1163298842 19:16430247-16430269 AATCACAGTTTGGCCCAGTGAGG - Intronic
1163344224 19:16729711-16729733 ATACAAAAATTAGCCCAGTGTGG + Intronic
1163565217 19:18047092-18047114 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1163581715 19:18143418-18143440 ATACAAAAATTAGCCCAGTGTGG + Intronic
1163684802 19:18705471-18705493 ACACAAAGATTAGCCAGGTGTGG - Intronic
1163929767 19:20377789-20377811 CTACAGATAGTGGCCCAGTGGGG - Intergenic
1164280004 19:23760818-23760840 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1164294896 19:23901248-23901270 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1164602257 19:29570106-29570128 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1165386928 19:35515389-35515411 ACACAAAAATTAGCCCAGCGTGG - Intergenic
1165743998 19:38219641-38219663 ATACAAAAATTAGCCCAGTGTGG - Intronic
1165805634 19:38579128-38579150 AAACAGAGAGTGGCCAGGTGCGG + Intronic
1166985263 19:46656203-46656225 ACACAAAAATTAGCCAAGTGTGG - Intronic
1167128542 19:47568825-47568847 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1167319342 19:48786490-48786512 ATACAAAAATTGGCCCAGTGTGG - Intergenic
1167679981 19:50913127-50913149 AGACAGAGATGGGACCAGAGAGG - Intergenic
1167805271 19:51778809-51778831 ACACAGAAATAAGCCCCGTGTGG - Intronic
1167896513 19:52586195-52586217 ACACAAAAATTGGCGCGGTGTGG - Exonic
1167932406 19:52876949-52876971 ACACAAAAATTTGCCCGGTGCGG + Exonic
1168068025 19:53930661-53930683 ATACAAAAATTGGCCCAGTGCGG - Intronic
1168122846 19:54263563-54263585 ATACAAAAATTAGCCCAGTGTGG + Intronic
1168674964 19:58271054-58271076 ATACAAAGATTAGCCCAGCGTGG + Intronic
1168675629 19:58276019-58276041 CTACAAAAATTGGCCCAGTGTGG + Intronic
925374772 2:3376400-3376422 AAACAGACATTGGCCAGGTGCGG + Intronic
925761665 2:7190780-7190802 ACACGGAGTTTGTCCCAGGGAGG + Intergenic
925964602 2:9052328-9052350 ACACAGAAATTAGCTGAGTGTGG - Intergenic
926032754 2:9606683-9606705 ATACAGAAATTAGCCCAGTGTGG - Intronic
926693799 2:15756259-15756281 GCACAGTGACTGTCCCAGTGAGG + Intergenic
926820340 2:16844946-16844968 ATACAAAAATTAGCCCAGTGTGG + Intergenic
927148081 2:20179934-20179956 ACTCAGGGGCTGGCCCAGTGGGG + Intergenic
927725170 2:25416514-25416536 ATACAAAAATTAGCCCAGTGTGG + Intronic
928235423 2:29535188-29535210 ACACAGACCTTCACCCAGTGTGG + Intronic
928338166 2:30416892-30416914 AGACAGAGATGGGCGAAGTGGGG - Intergenic
928655618 2:33447713-33447735 ACACAGACATGGGCCGGGTGCGG - Intronic
928735017 2:34278325-34278347 ACACACAGAGGGGGCCAGTGTGG - Intergenic
928766082 2:34647420-34647442 ACAAAGTGATTGGCCTAGTTTGG + Intergenic
928960488 2:36920917-36920939 ATACAAAAATTAGCCCAGTGTGG + Intronic
929183591 2:39069701-39069723 ATACAGAAATTGGCCGGGTGTGG - Intronic
929300830 2:40302016-40302038 ACACACAGATTAGCCCGGTGTGG - Intronic
929740844 2:44597890-44597912 ACACAAAAATTAGCCCAGGGTGG - Intronic
929943061 2:46349425-46349447 CCACAGAGATAGGACCAGAGTGG + Intronic
931412590 2:62047608-62047630 ATACAAAAATTAGCCCAGTGTGG - Intronic
932041200 2:68301734-68301756 ACAAAAAAATTGGCCCAGCGTGG + Intronic
932320950 2:70821580-70821602 ACACAGGGCAAGGCCCAGTGGGG - Intergenic
932522302 2:72427231-72427253 GGACAGAGAGGGGCCCAGTGAGG + Intronic
932536286 2:72600283-72600305 ATACAAAAATTAGCCCAGTGTGG + Intronic
932794863 2:74685577-74685599 ACACAGTCATTGGTTCAGTGTGG - Intergenic
933208974 2:79544091-79544113 ATACAAAAATTAGCCCAGTGTGG - Intronic
933877693 2:86635105-86635127 ACACAAAAATTAGCCCGGTGTGG + Intronic
935294402 2:101636259-101636281 ACACACAGATTAGCCAGGTGTGG + Intergenic
935311457 2:101787957-101787979 ATACAAAAATTAGCCCAGTGTGG - Intronic
935340582 2:102056453-102056475 ACACAGTGACAGGCCCAGGGAGG - Intergenic
935893061 2:107701045-107701067 ATACAAAGATTGGCCCAGTGTGG - Intergenic
936102159 2:109591740-109591762 ATACAAAAATTGGCCGAGTGTGG + Intronic
936912649 2:117608727-117608749 ATACAAAAATTAGCCCAGTGTGG - Intergenic
936913093 2:117613054-117613076 TCACAGAGAATGGCATAGTGTGG + Intergenic
937357035 2:121204242-121204264 ATACAAAAATTAGCCCAGTGTGG + Intergenic
937372580 2:121310985-121311007 ATACAAAGATTAGCCCGGTGTGG + Intergenic
937412483 2:121688581-121688603 ATACAAAAATTAGCCCAGTGTGG + Intergenic
937461862 2:122096179-122096201 ATACAGAGATCAGCACAGTGTGG + Intergenic
937521067 2:122712607-122712629 ACACTGAGATTGCCACAGAGTGG + Intergenic
937864480 2:126738628-126738650 ATTCAGAGATTGGCCCTCTGAGG + Intergenic
939285564 2:140124610-140124632 ATACAGAAATTAGCCAAGTGTGG - Intergenic
940890239 2:159028274-159028296 ACACAAAAATTAGCCAAGTGTGG - Intronic
940917781 2:159276215-159276237 ACACAGAAATTAGCCGGGTGTGG - Intronic
941479032 2:165983284-165983306 ACACAAAAATTGGCCAGGTGTGG + Intergenic
941752685 2:169149679-169149701 ATACAAAAATTAGCCCAGTGTGG + Intronic
942377658 2:175353841-175353863 ATACAAAAATTAGCCCAGTGTGG - Intergenic
942485363 2:176433972-176433994 ACACAAAGATTAGCCAGGTGTGG + Intergenic
942531140 2:176911676-176911698 ATACAAAAATTAGCCCAGTGTGG - Intergenic
943208592 2:184932168-184932190 AGACAGAGGTTGGAACAGTGTGG - Intronic
943424916 2:187719350-187719372 ATACAAAAATTAGCCCAGTGCGG + Intergenic
944745292 2:202649705-202649727 ACACAAAAATTAGCCCAGTGTGG - Intronic
944927373 2:204479052-204479074 ATTCAGAGATGGGCCAAGTGGGG - Intergenic
945095026 2:206210612-206210634 ACAAAAAAATTAGCCCAGTGTGG - Intronic
945981919 2:216319150-216319172 ATACAAAAATTAGCCCAGTGTGG + Intronic
945994099 2:216421451-216421473 ATACAAAAATTAGCCCAGTGTGG - Intronic
946639587 2:221769195-221769217 ACACAAAAATTAGCCAAGTGTGG - Intergenic
946741695 2:222808694-222808716 ATACAGAAATTGGCCTGGTGTGG - Intergenic
947247237 2:228062278-228062300 ACACAAAAATTAGCCAAGTGTGG - Intronic
947445613 2:230160551-230160573 ATACAGAAATTAGCCCAGTGTGG - Intergenic
947752126 2:232538704-232538726 ACACAGAGAGAAGCTCAGTGGGG + Intergenic
948446512 2:238037759-238037781 ATACAAAAATTAGCCCAGTGTGG - Intronic
948827176 2:240578394-240578416 ACACAGACATTCCCTCAGTGTGG + Exonic
948995239 2:241574864-241574886 ATACAGAAATTAGCCAAGTGTGG + Intergenic
1169363446 20:4971328-4971350 ACACACAAATTAGCCAAGTGTGG + Intronic
1169491177 20:6072570-6072592 ACTCAGTGATTGGCCGGGTGTGG - Intergenic
1169793043 20:9431619-9431641 ACACACAAATTGGCCCCGTGTGG - Intronic
1172366366 20:34352985-34353007 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1172549481 20:35787931-35787953 ACACAGAAATTAGCCGGGTGTGG - Intronic
1172563324 20:35908293-35908315 ACACAGAGAATTGCCCAGCAAGG - Intronic
1172630287 20:36373879-36373901 ATACAAAAATTAGCCCAGTGTGG + Intronic
1172750082 20:37244648-37244670 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1173047342 20:39525399-39525421 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1173164161 20:40674541-40674563 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1173295113 20:41748990-41749012 ACACAGTGATAGGGCCAGTGGGG + Intergenic
1173310460 20:41892248-41892270 ACACTGAGAATGACCCTGTGTGG + Intergenic
1173607457 20:44341727-44341749 ATACAAAAATTAGCCCAGTGTGG + Intronic
1173982172 20:47233060-47233082 ATACAAAAATTGGCCCGGTGTGG - Intronic
1174261956 20:49302656-49302678 ACACAGAAATTAGCCAGGTGTGG + Intergenic
1175120492 20:56712675-56712697 ATACAGAGATTAGCCAGGTGTGG + Intergenic
1175303314 20:57958521-57958543 ACACAGCATTTGGCCAAGTGTGG + Intergenic
1176225504 20:63996181-63996203 ATACAGAAATTGGCCAGGTGTGG + Intronic
1177264722 21:18767351-18767373 ACACAGAGAAAGACCAAGTGAGG - Intergenic
1177285269 21:19041102-19041124 ACACAGAAATTGGAACAGTTTGG - Intergenic
1177734326 21:25070081-25070103 TCACAGAGAAAGGCCCTGTGAGG + Intergenic
1178289610 21:31355705-31355727 ATACAAAAATTAGCCCAGTGTGG - Intronic
1179021651 21:37646499-37646521 TGACAGAGATTAGCCCAGAGAGG - Intronic
1179132965 21:38655332-38655354 ACACAGAGGTGGGTCCAGGGAGG + Intronic
1179781886 21:43706434-43706456 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1179862036 21:44194963-44194985 AGCCAGACACTGGCCCAGTGGGG - Intergenic
1179991577 21:44950910-44950932 GCACAGAGACTGGCCCAGGCGGG + Intronic
1179991749 21:44951903-44951925 GCACAGAGACTGGCCCAGGCGGG + Intronic
1180758405 22:18179938-18179960 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1180768693 22:18363726-18363748 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1180777619 22:18498665-18498687 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1180810344 22:18755975-18755997 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1180826567 22:18866950-18866972 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1181196484 22:21190231-21190253 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1181213043 22:21302893-21302915 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1181971666 22:26695327-26695349 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1182201315 22:28573297-28573319 ATACAAAAATTAGCCCAGTGTGG + Intronic
1182328541 22:29532820-29532842 ATACAAAAATTGGCCAAGTGTGG + Intronic
1182509906 22:30811708-30811730 ACACAAAAATTGGCCGGGTGTGG - Intronic
1182624412 22:31635456-31635478 ATACAAAAATTAGCCCAGTGTGG - Intronic
1183236314 22:36621215-36621237 AAACAAAGATTGGCCGGGTGCGG + Intronic
1183342292 22:37288122-37288144 ATACAGAAATTGGCCCAGTGCGG + Intronic
1183557078 22:38537367-38537389 ATACAGAGATTAGCCGGGTGTGG - Intronic
1184163006 22:42709632-42709654 ATACAAAAATTAGCCCAGTGTGG + Intronic
1184425186 22:44405106-44405128 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1184558678 22:45248389-45248411 ACACACAAATTAGCCGAGTGTGG - Intergenic
1185174276 22:49312032-49312054 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1203230312 22_KI270731v1_random:104614-104636 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1203276711 22_KI270734v1_random:92856-92878 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
949324999 3:2853824-2853846 ACACAGTGATTGGTTCAGTGAGG - Intronic
949465105 3:4335802-4335824 ATACAAAAATTAGCCCAGTGTGG + Intronic
949553818 3:5135002-5135024 ACACAAAGATTAGCCAAGCGTGG - Intronic
950135698 3:10579380-10579402 AGACTGAGAAGGGCCCAGTGCGG + Intronic
950221875 3:11202246-11202268 ATACAAAAATTGGCCCGGTGTGG + Intronic
950659074 3:14455523-14455545 ACACAGACATTTCCCCAGCGTGG + Intronic
950781744 3:15398347-15398369 AAACAAAAATTAGCCCAGTGTGG - Intronic
951146438 3:19233623-19233645 ACACAGACAGTGGCCCAGGCTGG - Intronic
951431127 3:22608312-22608334 ATACAGTGATATGCCCAGTGAGG + Intergenic
951868404 3:27333388-27333410 ATACAAAAATTAGCCCAGTGTGG + Intronic
951905609 3:27704025-27704047 ACACAGAAATTAGCCAGGTGTGG - Intergenic
952066338 3:29576368-29576390 GCACTGGGATTGACCCAGTGTGG + Intronic
952295147 3:32055357-32055379 ATACAAAAATTAGCCCAGTGTGG - Intronic
952366435 3:32678853-32678875 ATACAAAAATTAGCCCAGTGTGG + Intergenic
952407159 3:33014998-33015020 ATACAGAAATTGGCCTAGTGTGG + Intronic
952496122 3:33917182-33917204 GCACAGGGATTGGCCCAGAGTGG - Intergenic
952678563 3:36063729-36063751 ACAATGAGCTTGTCCCAGTGGGG - Intergenic
952926448 3:38323726-38323748 ACACAAAAATTAGCCAAGTGTGG - Intergenic
953471677 3:43172410-43172432 ATACAAAAATTAGCCCAGTGTGG + Intergenic
953570853 3:44070531-44070553 ACAAAGAGCTTGGCCCACTCAGG - Intergenic
953973420 3:47364614-47364636 ATACAAAAATTAGCCCAGTGTGG - Intergenic
954463259 3:50639653-50639675 ACAAAGAAACTGGCCCAGAGTGG - Intronic
954612063 3:51949819-51949841 ACACAAAAATTAGCCAAGTGTGG - Intergenic
954709350 3:52497566-52497588 ACACAAAAATTAGCCAAGTGTGG - Intronic
954854131 3:53627855-53627877 ATACAAAAATTAGCCCAGTGTGG + Intronic
955335362 3:58080947-58080969 ATACAAAAATTAGCCCAGTGTGG - Intronic
956449402 3:69358578-69358600 ACACAAAAATTAGCCAAGTGTGG + Intronic
958680561 3:97325359-97325381 ACACAGAGAAAAGACCAGTGAGG - Intronic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
959697251 3:109261707-109261729 ATACAAAAATTAGCCCAGTGTGG + Intergenic
960407298 3:117277292-117277314 AAACAAAAATTAGCCCAGTGTGG - Intergenic
960645239 3:119873217-119873239 ACACTGAGATGATCCCAGTGTGG - Intronic
961184599 3:124903583-124903605 ACACAGAAATTAGCCAGGTGTGG + Intergenic
961244982 3:125443313-125443335 ATACAAAAATTAGCCCAGTGTGG - Intergenic
961687504 3:128644502-128644524 ACACACATATTAGCCAAGTGTGG + Intronic
961740630 3:129031273-129031295 ACAAACAAATTAGCCCAGTGTGG + Intronic
961763221 3:129187157-129187179 ACACAAAAATTAGCCGAGTGTGG + Intergenic
961975413 3:131019319-131019341 ACACAGGGATTGTCCCAGGGTGG + Intronic
962259109 3:133892008-133892030 ACACTGAGATGTGCCAAGTGAGG + Intronic
962398560 3:135038460-135038482 AGAGAGAGATAGGCCCAGTCTGG + Intronic
962571556 3:136718769-136718791 ACAAAAAAATTGGCCAAGTGTGG + Intronic
962601171 3:136991898-136991920 ACACAGTTATTGGCCAAGTGCGG - Intronic
963072932 3:141319810-141319832 ATACAGAGATTGGAACAGTTTGG - Intergenic
963268143 3:143259477-143259499 ATACAAAGATTAGCCAAGTGTGG + Intergenic
963381908 3:144541095-144541117 ATACAAAAATTAGCCCAGTGAGG + Intergenic
963679434 3:148355257-148355279 GCATAGTGTTTGGCCCAGTGCGG - Intergenic
963730216 3:148963896-148963918 ACACAGAGTATGGCACAATGCGG - Intergenic
963747181 3:149136224-149136246 ACACACAAATTAGCCAAGTGTGG + Intronic
963801496 3:149680386-149680408 ATACAAAAATTAGCCCAGTGTGG + Intronic
963813798 3:149807789-149807811 ATACAAAAATTAGCCCAGTGAGG - Intronic
964090960 3:152874835-152874857 AGACAGAGATTGGAACAGTTTGG - Intergenic
964254829 3:154764757-154764779 ATACAGAAATTAGCCAAGTGTGG - Intergenic
964281747 3:155074720-155074742 ACACATAAATTGGCCAGGTGTGG - Intronic
964289618 3:155162855-155162877 ATACAAAAATTAGCCCAGTGTGG + Intronic
964793711 3:160475845-160475867 ATACAAAAATTAGCCCAGTGTGG + Intronic
964893241 3:161561830-161561852 ACACAGAGCCAGGCCCACTGTGG - Intergenic
964973028 3:162584448-162584470 ATACAAAAATTAGCCCAGTGTGG + Intergenic
965225279 3:165980636-165980658 ACATAGAGATTGGCCTGGCGCGG + Intergenic
965740367 3:171867774-171867796 ACACAAAAATTAGCCAAGTGTGG - Intronic
965809586 3:172578087-172578109 ACACATAGCTTTGCCCAGTGTGG - Intergenic
965815570 3:172633242-172633264 ACAGAGAGATTGGCCCACTCTGG + Exonic
966145402 3:176806000-176806022 ATACAAAAATTAGCCCAGTGTGG + Intergenic
966889599 3:184397343-184397365 AGTCAGAGAATGCCCCAGTGAGG + Intronic
966973967 3:185069248-185069270 ACACACAGATAGGCCGGGTGGGG - Intergenic
967365205 3:188678694-188678716 ACACAGCGAATGGGCCATTGAGG - Intronic
967601061 3:191390014-191390036 ATACAGAAATTAGCCAAGTGTGG - Intronic
967934712 3:194717664-194717686 ACACAGAGAATGGCTCTGTATGG - Intergenic
968119120 3:196111947-196111969 ACACAGACATTAGCCTGGTGTGG + Intergenic
968164218 3:196451541-196451563 ACACAAAAATTAGCCCAGTATGG + Intergenic
968384460 4:124143-124165 ATACAGAAATTGGCCGGGTGTGG + Intergenic
968864359 4:3198378-3198400 ATACAAAAATTGGCCGAGTGTGG - Intronic
969137188 4:5039287-5039309 AGACAGAAAGTGGCCAAGTGTGG - Intergenic
969365817 4:6693811-6693833 ACACAGAGGGTGGGACAGTGGGG - Exonic
969761240 4:9184228-9184250 ATACAAAAATTAGCCCAGTGTGG + Intergenic
970135065 4:12913247-12913269 ACACAGAGGCTGGCCAAGAGGGG - Intergenic
971978288 4:33719611-33719633 ATACAAAGATTAGCCGAGTGTGG + Intergenic
972615547 4:40694691-40694713 ATACAAACATTGGCCAAGTGTGG - Intergenic
973145623 4:46822065-46822087 ATACAAAAATTAGCCCAGTGTGG - Intronic
973874329 4:55200855-55200877 ATACAAAAATTAGCCCAGTGTGG - Intergenic
973882011 4:55282266-55282288 ACACAAAAATTAGCCTAGTGTGG - Intergenic
976279007 4:83308250-83308272 ATACAAAAATTAGCCCAGTGCGG + Intronic
976467637 4:85388992-85389014 ACACAGAGAGTGGCCCTGGCTGG - Intergenic
976773345 4:88679275-88679297 ACACAGACATGGGCTCTGTGAGG - Intronic
976914352 4:90352371-90352393 ATACAGAGATTGGCCAGGCGCGG + Intronic
977251793 4:94696601-94696623 ATACAGAAATTAGCCGAGTGTGG - Intergenic
977305669 4:95320264-95320286 ATACAAAAATTAGCCCAGTGTGG + Intronic
977588606 4:98802328-98802350 ACACAAAAATTAGCCCGGTGTGG - Intergenic
977943124 4:102879490-102879512 ACACAAAGCTTGGCCAGGTGCGG + Intronic
978865692 4:113507403-113507425 AAACAGAAATTAGCCAAGTGTGG - Intronic
978871049 4:113578416-113578438 ACAGAGTGAGTGGCACAGTGTGG - Intronic
979215199 4:118155286-118155308 ACACACAGATTGGCCCTGGATGG - Intronic
980787652 4:137575432-137575454 ATACAAAAATTAGCCCAGTGTGG - Intergenic
980791697 4:137629158-137629180 ACTAAGAGATTGGGCCAGAGTGG + Intergenic
980953080 4:139400878-139400900 ACACAAAAATTTGCCAAGTGTGG + Intronic
982249004 4:153385558-153385580 ATACAAAAATTAGCCCAGTGTGG + Intronic
982292450 4:153792553-153792575 AAACAGAGATTGTCCCTTTGAGG + Intergenic
983186939 4:164711059-164711081 ATACAAAAATTAGCCCAGTGTGG - Intergenic
983227554 4:165099240-165099262 ACACAAAAATTAGCCAAGTGTGG - Intronic
983483427 4:168303824-168303846 ACACAAAAATTGGCCCAGCATGG + Intronic
984102253 4:175499881-175499903 ATGCAGAGAAGGGCCCAGTGTGG - Intergenic
984164530 4:176290950-176290972 ACACACAGGTTGGACCAGTGGGG - Intergenic
984255187 4:177382052-177382074 AGACAGAGAGGGGCCCAGTGAGG - Intergenic
985381762 4:189402663-189402685 ACCCAGAGATTGGAACAGTTTGG + Intergenic
987334589 5:16887644-16887666 ATACAAAAATTAGCCCAGTGTGG - Intronic
987655367 5:20799619-20799641 ACACAGAGGTTGGGACAGTTTGG + Intergenic
988426506 5:31071644-31071666 ATACAAAAATTAGCCCAGTGTGG + Intergenic
988462536 5:31453354-31453376 ACACAGATATTAGCAGAGTGTGG - Intronic
988537523 5:32082175-32082197 ACACAAAAATTGGCCGAGCGTGG - Intronic
988761582 5:34315782-34315804 ATACAAAAATTAGCCCAGTGTGG - Intergenic
988768191 5:34404283-34404305 ACACAGAGGTTGGGACAGTTTGG - Intergenic
988985512 5:36614692-36614714 ACACTCAGATTGGCCCTGAGAGG - Intronic
989047084 5:37283847-37283869 ACACAGAGTTTGGGACAGTTTGG - Intergenic
989656873 5:43754214-43754236 AGACAGAGGTTGGAGCAGTGTGG - Intergenic
989678039 5:43995814-43995836 ACACAGTGCTTGGCCCATAGTGG + Intergenic
990379806 5:55211964-55211986 ATACAAAAATTAGCCCAGTGTGG + Intergenic
990622077 5:57570778-57570800 ATACAAAAATTGGCCGAGTGTGG + Intergenic
990657885 5:57977754-57977776 ACTCTGGGATTGGCCCAGTAAGG + Intergenic
991556067 5:67896198-67896220 ACACAGAGATTGGAACAGTTTGG - Intergenic
991982717 5:72249826-72249848 ACAAAGAAATTAGCCGAGTGTGG + Intronic
992071799 5:73155493-73155515 CCACAGAGATTGGCCCCCCGGGG - Intergenic
992133377 5:73718160-73718182 AAACAAATTTTGGCCCAGTGTGG - Intronic
992544015 5:77793262-77793284 ATACAAAAATTAGCCCAGTGGGG - Intronic
992658020 5:78929635-78929657 ACAAAAAAATTTGCCCAGTGTGG + Intronic
993351197 5:86852907-86852929 ACACTGAGATTGCCCCAGAGTGG - Intergenic
993997924 5:94744657-94744679 ATACAAAAATTAGCCCAGTGTGG - Intronic
995222384 5:109664548-109664570 AGACACAGTTTGGCCCAGTGCGG + Intergenic
995513965 5:112936136-112936158 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
996206902 5:120750509-120750531 AAACAAAAATTAGCCCAGTGTGG + Intergenic
996399198 5:123042575-123042597 ATACAAAAATTAGCCCAGTGTGG - Intergenic
996631727 5:125640877-125640899 TCAAAGAGATTGGCCTGGTGTGG + Intergenic
996711061 5:126544111-126544133 ATACAAAAATTAGCCCAGTGTGG - Exonic
997279081 5:132627034-132627056 ATACAAAAATTAGCCCAGTGTGG - Intronic
997291374 5:132737981-132738003 ACACAGAGCCTGGCACAGAGTGG + Intergenic
997440961 5:133908286-133908308 ACACAGGCTTTGGCCGAGTGCGG + Intergenic
997564401 5:134875823-134875845 ATACAAAAATTAGCCCAGTGTGG - Intronic
997982505 5:138477688-138477710 ATACAAAAATTAGCCCAGTGTGG - Intergenic
998034314 5:138901311-138901333 ATACAAAAATTGGCCCAGCGTGG - Intronic
998113842 5:139521841-139521863 ACACAAAAATTAGCCCGGTGTGG - Intergenic
998216851 5:140244081-140244103 ACTCAGAGATAGGCTCAGGGAGG + Intronic
998277459 5:140770345-140770367 ATACAAAGATTAGCCCGGTGTGG - Intergenic
998636372 5:143959301-143959323 ATACAAAAATTAGCCCAGTGTGG + Intergenic
998937945 5:147250649-147250671 ATGCAGATATGGGCCCAGTGCGG + Intronic
998968909 5:147570086-147570108 AAACAAAAATTAGCCCAGTGTGG - Intergenic
999156264 5:149459585-149459607 ATACAAAGATTAGCCCAGCGTGG + Intergenic
999746832 5:154598836-154598858 ATACAGAGCTTGGCACAGAGAGG + Intergenic
1000235472 5:159355587-159355609 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1000692775 5:164343711-164343733 ATACAGAAATTGGCCAGGTGTGG - Intergenic
1000987493 5:167876550-167876572 ACACACAAATTGGGCCTGTGAGG - Intronic
1001145291 5:169178471-169178493 ACACAGAGCTTGGCACAGAATGG + Intronic
1001174115 5:169449175-169449197 AAAAAGATATTGGCCAAGTGCGG - Intergenic
1001408162 5:171491182-171491204 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1001737900 5:174021969-174021991 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1001785465 5:174408979-174409001 ACACAAAAATTAGCCAAGTGCGG - Intergenic
1001909030 5:175499097-175499119 ATACAGAAATTAGCCGAGTGTGG + Intronic
1002049679 5:176563190-176563212 ATACAAAAATTAGCCCAGTGTGG + Intronic
1002149526 5:177216014-177216036 ACACAAAAATTAGCCAAGTGTGG - Intronic
1002643601 5:180642049-180642071 ATACAAAAATTAGCCCAGTGTGG + Intronic
1002656927 5:180756544-180756566 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1002787526 6:414958-414980 AGACAGAGATTGGAAGAGTGTGG + Intergenic
1002835922 6:865280-865302 ATACAAAAATTCGCCCAGTGTGG + Intergenic
1002949001 6:1789689-1789711 ACACAAAAATTAGCCAAGTGTGG - Intronic
1003080659 6:3018347-3018369 ACACAAAAATTAGCCGAGTGTGG + Intronic
1003358161 6:5395204-5395226 ATACAAAAATTAGCCCAGTGTGG - Intronic
1003846088 6:10174715-10174737 ATACAAAAATTGGCCCAGTGTGG + Intronic
1003942286 6:11042155-11042177 ATACACAGATTGGCCTGGTGTGG + Intronic
1003997548 6:11558063-11558085 ACAAAGAGATTGGTCAGGTGTGG - Intronic
1004475788 6:15969918-15969940 ACAAAAACATTAGCCCAGTGTGG + Intergenic
1004996201 6:21195664-21195686 ATACAGAAATTAGCCGAGTGTGG - Intronic
1005643391 6:27817984-27818006 ATACAAAGATTAGCCCAGGGTGG - Intergenic
1005954195 6:30652085-30652107 ATACAAAAATTAGCCCAGTGTGG + Intronic
1006003014 6:30981139-30981161 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1006086276 6:31597921-31597943 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1006965411 6:37978818-37978840 ATACAAAAATTAGCCCAGTGTGG - Intronic
1007452965 6:41954093-41954115 ATACAAAAATTAGCCCAGTGTGG + Intronic
1007815990 6:44525996-44526018 ACACACAGATTGGCAGGGTGGGG - Intergenic
1008074754 6:47133993-47134015 ATACAAAAATTGCCCCAGTGTGG + Intergenic
1008324572 6:50162073-50162095 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1009719430 6:67447841-67447863 AAACAAAAATTAGCCCAGTGTGG + Intergenic
1010169399 6:72957324-72957346 ACACAAAAATTAGCCAAGTGTGG - Intronic
1010704932 6:79096518-79096540 ACACAGAAATTGGCCAGGTATGG + Intergenic
1010950336 6:82029626-82029648 AAACAGAGAATGGGCCATTGTGG + Intergenic
1011169541 6:84490324-84490346 AGGCAGAGATTGGAACAGTGTGG - Intergenic
1011199992 6:84825577-84825599 ACACAGAGATAGCACCAGAGAGG - Intergenic
1011334847 6:86249094-86249116 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1012111937 6:95245991-95246013 ACACAAAAATTAGCCCGGTGGGG - Intergenic
1013419186 6:109950652-109950674 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1013508385 6:110821456-110821478 ACACAAAAATTAGCCGAGTGTGG + Intronic
1013976983 6:116090469-116090491 ATACAGAGGTTGGCTGAGTGTGG + Intergenic
1014578671 6:123107339-123107361 AGACAGAGATTGGAACACTGGGG - Intergenic
1014601771 6:123421816-123421838 AAAAAAAAATTGGCCCAGTGTGG + Intronic
1014799089 6:125757792-125757814 TCACACAGATTAGCCAAGTGTGG + Intronic
1014915644 6:127144775-127144797 ATACAAAAATTAGCCCAGTGTGG - Intronic
1015259184 6:131215290-131215312 CCACATAGACTGGCCCAGAGCGG + Intronic
1015520151 6:134122025-134122047 ATACAGAAATTGGCCAGGTGCGG + Intergenic
1015911824 6:138176336-138176358 ACACAAAAATTGGCCGGGTGTGG - Intronic
1016404707 6:143717726-143717748 ACACAAAAATTAGCCGAGTGTGG - Intronic
1017083795 6:150694542-150694564 ATACAAAAATTAGCCCAGTGTGG + Intronic
1017371693 6:153717282-153717304 ACACAGAAAATAGCCCACTGGGG - Intergenic
1017473925 6:154768905-154768927 ATACAAAAATTAGCCCAGTGTGG + Intronic
1018278542 6:162159084-162159106 ACACAGAGCCTGGTCCAGAGGGG - Intronic
1019987007 7:4664521-4664543 ATACAAAAATTGGCCAAGTGTGG + Intergenic
1020192378 7:6009793-6009815 ATACAGAAATTGGCCGGGTGTGG + Intronic
1020415672 7:7942991-7943013 ACACAAAAATTAGCCGAGTGTGG - Intronic
1020843769 7:13256557-13256579 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1021234122 7:18121639-18121661 ACACAGAGATGTGCTCAGTGTGG + Intronic
1022324377 7:29317831-29317853 ATACAAACATTAGCCCAGTGTGG + Intronic
1022570149 7:31444737-31444759 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1023139463 7:37086585-37086607 ATACAAAAATTAGCCCAGTGTGG + Intronic
1023484983 7:40676656-40676678 ATACAAAAATTAGCCCAGTGTGG - Intronic
1023789642 7:43743385-43743407 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1023828547 7:44025812-44025834 ACACAGAAATTAGCCAGGTGCGG - Intergenic
1024218840 7:47271565-47271587 AGACAGAGATTGGCAAAGTGGGG - Intergenic
1025063641 7:55833550-55833572 ACACAAAAATTAGCCAAGTGTGG + Intronic
1025870886 7:65433254-65433276 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1026455173 7:70565522-70565544 ATACAAAAATTAGCCCAGTGTGG + Intronic
1026516918 7:71080857-71080879 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1026684839 7:72500434-72500456 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1028103038 7:86845043-86845065 ATACAAAAATTAGCCCAGTGTGG - Intronic
1028688588 7:93622537-93622559 ACACAGAGAAGGGCACAGAGGGG - Intronic
1028831901 7:95337594-95337616 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1029469253 7:100743719-100743741 ATACAAAAATTAGCCCAGTGTGG + Intronic
1029756844 7:102579250-102579272 ACACAGAAATTAGCCAGGTGCGG - Intronic
1029774783 7:102678311-102678333 ACACAGAAATTAGCCAGGTGCGG - Intergenic
1029910204 7:104137711-104137733 ACACAGAGTTTGGCCAAGAGCGG + Intronic
1030845100 7:114400010-114400032 ATACAGAGATTAGCCAGGTGCGG - Intronic
1032057979 7:128698737-128698759 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1032171666 7:129589636-129589658 ACACAAAGATTAGCCCGGCGTGG - Intergenic
1032400672 7:131622294-131622316 GCACAGAGATCGGCCAGGTGCGG - Intergenic
1033094068 7:138414380-138414402 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1033122730 7:138680302-138680324 ACACAAAAATTAGCCCAGTGTGG - Intronic
1033162611 7:139010842-139010864 ACACAAAAATTGGCCAGGTGCGG + Intergenic
1033241126 7:139680880-139680902 ACTCAGCCATGGGCCCAGTGAGG + Intronic
1033328049 7:140395550-140395572 ACACAAAAATTGGCCAGGTGTGG + Intronic
1033371662 7:140714521-140714543 ACACACACATTAGCCAAGTGTGG - Intronic
1034173628 7:149083049-149083071 ACAAAAAAATTAGCCCAGTGTGG - Intronic
1034566164 7:151917444-151917466 AAAGAGAGATTGGCCGAGTGTGG - Intergenic
1035186253 7:157128311-157128333 ACACAAAGATTAGCCAGGTGTGG - Intergenic
1036135936 8:6161716-6161738 ACACAGTTACTGGCACAGTGTGG + Intergenic
1036500020 8:9305182-9305204 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1036984897 8:13518262-13518284 ATACAGAAATTAGCCAAGTGTGG - Intergenic
1037509763 8:19570742-19570764 ACACAAAAATTAGCCAAGTGTGG + Intronic
1037957690 8:23071619-23071641 GCATAGAGATTGGACCAGTCCGG - Intergenic
1037983727 8:23273349-23273371 ACAAAAAAATTGGCCCAGCGCGG + Intronic
1037991491 8:23324389-23324411 ACAGAGAAAGAGGCCCAGTGTGG + Intronic
1038029767 8:23627661-23627683 ATACAGATATTGGCCTGGTGTGG + Intergenic
1038057075 8:23870158-23870180 ACACAAAAATTAGCCCGGTGTGG + Intergenic
1038112748 8:24517656-24517678 ATACAAAAATTTGCCCAGTGTGG - Intronic
1038550154 8:28460578-28460600 ATACAAAAATTAGCCCAGTGTGG - Intronic
1038569247 8:28646016-28646038 ATACAAAAATTAGCCCAGTGTGG - Intronic
1038961388 8:32524129-32524151 ACACAAAAATTAGCTCAGTGTGG + Intronic
1039327780 8:36503876-36503898 ACACAAAGAGTGGCCTTGTGAGG - Intergenic
1039457558 8:37717598-37717620 ACAGAGAGACTGGCCCAGCAGGG + Intergenic
1039981259 8:42411421-42411443 CCACTGAGAAAGGCCCAGTGAGG + Intergenic
1040341769 8:46444665-46444687 ACACAGAGAATGCCACAGGGTGG - Intergenic
1040398923 8:47028219-47028241 ACATAGAGAATGGCTCAGAGGGG + Intergenic
1041387303 8:57318200-57318222 ACACAGAGATTGGCTTTGTGTGG - Intergenic
1041442080 8:57907982-57908004 ACACAAAAATTAGCCCGGTGTGG - Intergenic
1041926060 8:63237519-63237541 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1042450754 8:68942680-68942702 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1042554600 8:70023370-70023392 ATACAGAAATTAGCCAAGTGTGG - Intergenic
1042927320 8:73979182-73979204 ATACAAAAATTGGCCAAGTGTGG - Intronic
1043062783 8:75526282-75526304 ACCCAGAACTTAGCCCAGTGTGG - Intronic
1043446376 8:80323478-80323500 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1043648712 8:82559593-82559615 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1043685139 8:83075027-83075049 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1043762473 8:84085173-84085195 ACACAAAAATTAGCCCAGTGTGG - Intergenic
1043890613 8:85648801-85648823 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043893877 8:85721706-85721728 ACACAAAAATTAGCCAAGTGTGG - Intergenic
1043898445 8:85757020-85757042 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043900057 8:85769215-85769237 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043902021 8:85784493-85784515 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043903629 8:85796683-85796705 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043905240 8:85808876-85808898 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1043906852 8:85821067-85821089 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1044983126 8:97735790-97735812 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1045289360 8:100819268-100819290 ACACACAAATTAGCCCGGTGCGG + Intergenic
1046737807 8:117795639-117795661 ATACAAAAATTAGCCCAGTGTGG + Exonic
1046946145 8:119976015-119976037 ATACAAAAATTAGCCCAGTGTGG - Intronic
1047867636 8:129044569-129044591 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1048490206 8:134885209-134885231 ATACAGAGCTTGGTCCAGAGCGG - Intergenic
1049111042 8:140643621-140643643 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1049525125 8:143121454-143121476 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1049710938 8:144063017-144063039 ACAGAGATAAAGGCCCAGTGGGG - Intronic
1050170825 9:2814499-2814521 ACACATAGATTGGCCTGGTGTGG - Intronic
1051133641 9:13892665-13892687 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1051583364 9:18701373-18701395 ATACAGAAATTGGCCAGGTGTGG - Intronic
1051755767 9:20398495-20398517 ACACAGAAATTGGGGGAGTGGGG + Intronic
1051858587 9:21598470-21598492 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1051924275 9:22304772-22304794 ACACAGAGATTTTGGCAGTGAGG - Intergenic
1052377277 9:27731705-27731727 AGACAGAGACTGGCTCACTGGGG - Intergenic
1052716670 9:32126416-32126438 ACACAGAGATTGGCTGGGCGCGG - Intergenic
1052919508 9:33953063-33953085 AGACAGAGTTTTGCCCAGTCTGG + Intronic
1053012910 9:34645336-34645358 ATACATAAATTAGCCCAGTGTGG + Intronic
1053324691 9:37132979-37133001 ATACAAAAATTAGCCCAGTGTGG + Intronic
1053796628 9:41732417-41732439 ACACAAAAATTGGCCAGGTGTGG + Intergenic
1054148553 9:61582408-61582430 ACACACAAATTGGCCAGGTGTGG - Intergenic
1054185037 9:61944477-61944499 ACACAAAAATTGGCCAGGTGTGG + Intergenic
1054653473 9:67644023-67644045 ACACAAAAATTGGCCAGGTGTGG - Intergenic
1054839645 9:69722781-69722803 ACACAAAAATTAGCCCGGTGTGG + Intronic
1056450876 9:86715722-86715744 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1056968692 9:91185127-91185149 ACACAAACACTGGCCGAGTGTGG + Intergenic
1057168060 9:92943804-92943826 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1058550202 9:106106660-106106682 ATACAGATATTAGCCAAGTGTGG + Intergenic
1058698620 9:107582314-107582336 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1058789637 9:108429943-108429965 ATACAGAAATTGGCCAGGTGCGG + Intergenic
1058826461 9:108779514-108779536 AGACAGAGATGGGCACAGTGAGG + Intergenic
1059219120 9:112595503-112595525 ACACAAAAATTAGCCGAGTGTGG + Intronic
1059643243 9:116237873-116237895 ACACAAAAATTAGCCCAGCGTGG - Intronic
1059687438 9:116651070-116651092 ACACAAAGATTCGCCAGGTGTGG - Intronic
1060165748 9:121413092-121413114 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1060578370 9:124719762-124719784 ACACAAAGATTAGCCCACCGCGG + Intronic
1060803392 9:126558616-126558638 TCACAGAGATTGCAGCAGTGGGG - Intergenic
1061122580 9:128653071-128653093 ACACAAAAATTAGCCCAATGTGG + Intronic
1061123396 9:128658319-128658341 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1061560103 9:131396479-131396501 ACACAAAAATTGGCCAGGTGTGG - Intronic
1061756498 9:132816196-132816218 ATACAAAAATTAGCCCAGTGTGG + Intronic
1061856954 9:133447143-133447165 ACACAGAAATAGGCCAGGTGTGG - Intronic
1062014755 9:134285437-134285459 ACACAGACACAGGTCCAGTGAGG - Intergenic
1062436846 9:136550177-136550199 ACACAGAGAGTGGGCCAGGAAGG - Intergenic
1062489000 9:136795450-136795472 ATACAAAAATTAGCCCAGTGTGG - Intronic
1185531274 X:820930-820952 ACACAAAAATTGGCCGGGTGTGG - Intergenic
1185654263 X:1671418-1671440 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1185728092 X:2438987-2439009 ACACAAAAATTAGCCCAGCGTGG + Intronic
1185788324 X:2909341-2909363 ATACAAAAATTGGCCGAGTGTGG - Intronic
1185827188 X:3263098-3263120 ACACAGAGATTTTCTCTGTGAGG + Intergenic
1186707841 X:12161312-12161334 ATACAAAAATTAGCCCAGTGTGG - Intronic
1186838142 X:13458101-13458123 ACACAGAAATTAGCCGGGTGTGG + Intergenic
1187174678 X:16885546-16885568 ATACAGAGATTTGCCGGGTGTGG + Intergenic
1187562029 X:20412275-20412297 ATACAAAAATTGGCCCAGTGTGG - Intergenic
1187684764 X:21805114-21805136 ACACAAAAATTAGCCAAGTGTGG + Intergenic
1188346902 X:29078114-29078136 ACAAAAAAATTAGCCCAGTGTGG + Intronic
1188525910 X:31087703-31087725 ACACTGAGATTGGTGCAGTGCGG - Intergenic
1188809144 X:34631013-34631035 ATACAAAAATTAGCCCAGTGTGG + Intronic
1188997897 X:36908157-36908179 ACACAAAAATTAGCCCAGTGTGG - Intergenic
1189177993 X:38977206-38977228 ACACAAAAATTGGCCAGGTGTGG - Intergenic
1189609401 X:42715633-42715655 ACAAAGAGATTGCCCGAGTTAGG - Intergenic
1189788620 X:44582624-44582646 ACACAGAGATTGGAACAGTTTGG + Intergenic
1189798973 X:44674511-44674533 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1190175945 X:48149540-48149562 ATACAAAAATTGGCCCAGTGCGG - Intergenic
1190186576 X:48239916-48239938 ATACAAAAATTAGCCCAGTGTGG - Intronic
1190292752 X:49003473-49003495 ACACAAAAATTGGCCGGGTGTGG + Intergenic
1190299034 X:49045409-49045431 ACAAAAACAATGGCCCAGTGCGG + Intergenic
1190668217 X:52715023-52715045 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1190671200 X:52743381-52743403 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1191143475 X:57139607-57139629 ACAAAAAAATTAGCCCAGTGTGG - Intergenic
1191716883 X:64199934-64199956 ACACAGGGGTTTGCCCAGTCTGG + Intronic
1192032186 X:67525506-67525528 ACAGAGTGATTGGCTCAGTAGGG - Intergenic
1192074741 X:67982145-67982167 ACACAGTGCTGGGCTCAGTGGGG + Intergenic
1192814976 X:74580806-74580828 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1192955413 X:76064734-76064756 AGACAGAGATTGGAACAGTTTGG - Intergenic
1193555075 X:82944148-82944170 ATGCAAAGATTAGCCCAGTGTGG - Intergenic
1193810989 X:86050552-86050574 ACATAGTCTTTGGCCCAGTGGGG - Intergenic
1194037048 X:88887519-88887541 AGGCAGAGATTGGCACAGTTTGG + Intergenic
1196090704 X:111738691-111738713 ACACAGTAATTAGCCGAGTGTGG - Intronic
1196397165 X:115276787-115276809 ATACAAAAATTGGCCAAGTGCGG + Intergenic
1196781092 X:119385155-119385177 AGACAGATTTTGGCCCAGAGTGG + Intergenic
1196921183 X:120586685-120586707 ACAAAAAAATTAGCCCAGTGTGG + Intergenic
1197171090 X:123435177-123435199 ACCCAGAGATTGGCCCATGCTGG - Intronic
1197253209 X:124235997-124236019 ACACAAAGATTAGCCAGGTGTGG - Intronic
1197310711 X:124901734-124901756 ACACAGAAATTGGCCGGGTATGG - Intronic
1197869225 X:131050023-131050045 CCCCAGAGCCTGGCCCAGTGAGG + Intergenic
1198231369 X:134692726-134692748 ACACAGAGTTTAGCACATTGTGG - Intronic
1198593481 X:138210509-138210531 ACGCAGAGATTGGAACAGTTTGG - Intergenic
1198689763 X:139268159-139268181 ACACACAAATTAGCCAAGTGTGG - Intergenic
1198745938 X:139890677-139890699 ACACAGAGCCTGGCCCAGAGTGG - Intronic
1198874333 X:141206667-141206689 ACACAAAAATTAGCCGAGTGTGG - Intergenic
1199286018 X:146055045-146055067 ACACAGAAACAGGCCCACTGTGG + Intergenic
1199562320 X:149177169-149177191 ACACAAAAATTAGCCGAGTGTGG + Intergenic
1199982777 X:152929863-152929885 GCACAGAGAAAGGCCCAGGGAGG - Intronic
1200140486 X:153899944-153899966 ACACAAAAATTGGCCGGGTGTGG + Intronic
1200227687 X:154428194-154428216 AAACAGGGATTGGCCGGGTGCGG + Intergenic
1200790696 Y:7296652-7296674 ACACAGAGGATGGCCTGGTGAGG + Intergenic
1201051354 Y:9939330-9939352 ACATAGAGATGGGTACAGTGAGG - Intergenic
1201060382 Y:10038756-10038778 ACAAAGAGATGGGCCTTGTGAGG - Intergenic
1201251631 Y:12064156-12064178 ATACAGAGATGGGGCCAGAGAGG + Intergenic
1201251695 Y:12065038-12065060 ACACAGAGATTTTCTCTGTGAGG - Intergenic
1201467306 Y:14297284-14297306 ATACAGAAATTGGCCAGGTGTGG - Intergenic
1201598047 Y:15694237-15694259 ACACAGAGGATGACCCTGTGAGG + Intergenic
1201699842 Y:16868787-16868809 ACACAAAAATTAGCCCAGTGTGG - Intergenic
1201762209 Y:17552981-17553003 ATACAAAAATTAGCCCAGTGTGG - Intergenic
1201839343 Y:18353007-18353029 ATACAAAAATTAGCCCAGTGTGG + Intergenic
1202050649 Y:20777061-20777083 ATACAAAAATTAGCCCAGTGTGG - Intronic
1202135192 Y:21654064-21654086 ACACAGGGCTGGGCCCAGAGTGG - Intergenic