ID: 1105939943

View in Genome Browser
Species Human (GRCh38)
Location 13:25138877-25138899
Sequence CTCTGTGTTTTTAGTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368566
Summary {0: 1, 1: 190, 2: 12563, 3: 210854, 4: 144958}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105939939_1105939943 -2 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939935_1105939943 22 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939934_1105939943 23 Left 1105939934 13:25138831-25138853 CCCGGGCAGCTGGGATTACAGGC 0: 32
1: 3376
2: 85653
3: 222098
4: 251147
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939932_1105939943 26 Left 1105939932 13:25138828-25138850 CCTCCCGGGCAGCTGGGATTACA 0: 12
1: 1993
2: 56816
3: 227259
4: 281254
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939938_1105939943 -1 Left 1105939938 13:25138855-25138877 CCCACCACCACACTGGGCCAATC 0: 2
1: 1
2: 42
3: 663
4: 8214
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939940_1105939943 -5 Left 1105939940 13:25138859-25138881 CCACCACACTGGGCCAATCTCTG 0: 1
1: 1
2: 18
3: 615
4: 5942
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939941_1105939943 -8 Left 1105939941 13:25138862-25138884 CCACACTGGGCCAATCTCTGTGT 0: 1
1: 0
2: 3
3: 58
4: 866
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105939943 Original CRISPR CTCTGTGTTTTTAGTAGAGA TGG Intergenic
Too many off-targets to display for this crispr