ID: 1105940198

View in Genome Browser
Species Human (GRCh38)
Location 13:25141022-25141044
Sequence GAGGAGTGAGGGTCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105940198 Original CRISPR GAGGAGTGAGGGTCCTCACA GGG (reversed) Intergenic
900018613 1:171495-171517 GAGGACTGTGGGTCATCTCAGGG - Intergenic
900048871 1:530090-530112 GAGGACTGTGGGTCATCTCAGGG - Intergenic
900071101 1:771914-771936 GAGGACTGTGGGTCATCTCAGGG - Intergenic
900325024 1:2104492-2104514 GAGGAGTGAGGGGACAGACAGGG + Intronic
900547394 1:3236461-3236483 GAGGAAAGTGAGTCCTCACAGGG + Intronic
902005278 1:13226905-13226927 GAGTAATGAGGGGCCACACATGG + Intergenic
902024557 1:13373002-13373024 GAGTAATGAGGGGCCACACATGG + Intergenic
902273007 1:15318132-15318154 GAGTAGTGGGGTTACTCACAGGG - Intronic
905428925 1:37907593-37907615 GAGATGTGAGGGTCAGCACAAGG + Intronic
905497322 1:38403111-38403133 AGGGACTGAGGGTCCCCACAGGG - Intergenic
907389646 1:54150039-54150061 GAGGAGGGAGGGTTACCACATGG - Intronic
907872357 1:58454651-58454673 GAGGAGGGAGGGTCCCCAGGTGG - Intronic
910357781 1:86379080-86379102 GGGGAGTGAGGCATCTCACATGG - Intronic
911802965 1:102167287-102167309 GAGGAATGCTGTTCCTCACATGG - Intergenic
912230138 1:107783617-107783639 GAGGAGTGGGTGGCCTCACTGGG - Intronic
914045323 1:144086579-144086601 CAGGACTGAGGATCATCACACGG - Intergenic
914132787 1:144874107-144874129 CAGGACTGAGGATCATCACACGG + Intergenic
915028486 1:152855602-152855624 GAGGATTTATGGTCCTCCCAAGG - Intergenic
916320796 1:163501536-163501558 AAGGTGTTAGGGTCATCACAGGG - Intergenic
919460197 1:197867807-197867829 GAGAAGTGAGGGTGGTCACCAGG - Intergenic
920188200 1:204175446-204175468 GAGGGGTGGGAGTCCACACAGGG + Intergenic
922106462 1:222517363-222517385 GAGGACTGTGGGTCATCTCAGGG - Intergenic
922763864 1:228147807-228147829 GAGGTCTGAGGACCCTCACAGGG - Intronic
922942809 1:229482664-229482686 GGGGAGTGATTGTCCTCACTTGG - Intronic
923652136 1:235883882-235883904 GAGTAATGATGGTCCTCACAAGG - Intergenic
924348647 1:243094929-243094951 GAGGACTGTGGGTCATCTCAGGG - Intergenic
1062857782 10:788053-788075 GGAGAGTGAGGGGCCTCCCAGGG - Intergenic
1063101410 10:2952997-2953019 GAGGACTGAGGGCCATCACCTGG - Intergenic
1063878450 10:10506382-10506404 AATGAGTGAGGGTCCTAAAAAGG + Intergenic
1066727713 10:38409972-38409994 GAGGACTGTGGGTCATCTCAGGG + Intergenic
1067046762 10:42989585-42989607 GAGGAGTGAGTGTTCTCAAGGGG - Intergenic
1067541982 10:47161421-47161443 GAGGAGGGAAGGTCCCCACCGGG + Intergenic
1069648035 10:70019120-70019142 GAGGACTGAGAGTGCCCACAGGG - Intergenic
1070457786 10:76634007-76634029 AAGGAATGAGTCTCCTCACAAGG + Intergenic
1072787883 10:98296453-98296475 GAGTAGGCAGGGTCCCCACAGGG + Intergenic
1073682310 10:105717708-105717730 GAGGAGAGAGGGTCCACAAGAGG - Intergenic
1075679553 10:124322578-124322600 GAGGAGAGAGGCCTCTCACATGG + Intergenic
1075746508 10:124731863-124731885 GAGGTGTGGGGGCCTTCACATGG + Intronic
1076465724 10:130680359-130680381 GAGGAGGGAGGGTCTGCAAATGG + Intergenic
1076563646 10:131383403-131383425 CAGGCGTGAGAGTCCCCACACGG + Intergenic
1076975218 11:166691-166713 GAGGACTGTGGGTCATCTCAGGG - Intergenic
1077593248 11:3509161-3509183 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
1077921933 11:6647802-6647824 GAGGGGACAGAGTCCTCACAGGG + Intronic
1078703409 11:13713345-13713367 CAAGACTGAGGGTGCTCACAAGG - Intronic
1079264241 11:18914945-18914967 GGGGAGTGAGGCATCTCACACGG + Intergenic
1079301913 11:19285966-19285988 GAGGAGCCAGAGTCCTCAGAGGG + Intergenic
1079898512 11:26151322-26151344 GAGGAGTGAGTTTCCTGACATGG + Intergenic
1081238245 11:40672245-40672267 GAGGAGTGAGGGTTCTCTCTTGG + Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083941736 11:65899824-65899846 CTGGGGTGAGGGTCCCCACACGG - Intronic
1084249082 11:67881879-67881901 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
1084438103 11:69155746-69155768 GTGGGGTGAGGGTCCCCAGATGG - Intergenic
1085271795 11:75274055-75274077 TAGGAGGGCAGGTCCTCACAGGG + Exonic
1085389396 11:76174908-76174930 GAGGAGAGTGGGACCTCACAGGG + Intergenic
1086737793 11:90328577-90328599 GAAGAGTGAGGGAGATCACAGGG - Intergenic
1086911139 11:92474137-92474159 GAGGAGTGAGCCTCAGCACAGGG - Intronic
1088989314 11:114938047-114938069 GGGGAGTGAGGCTTCTCACATGG - Intergenic
1089977474 11:122745017-122745039 GAGGAGCGGTGGTCCTCCCAGGG + Intronic
1091372302 11:135070968-135070990 CAGCAGTGTGTGTCCTCACAAGG + Intergenic
1091805348 12:3352160-3352182 GTGGAGAGAGGGTCTTCAAAAGG - Intergenic
1091882833 12:3993384-3993406 AAGAAGTGAGGGTCTCCACAGGG - Intergenic
1092805131 12:12215242-12215264 GAGGAGGGAAGGACATCACAGGG + Intronic
1093546981 12:20360071-20360093 GGGGAGTGAGGCATCTCACACGG + Intergenic
1100299777 12:93296275-93296297 GAAACATGAGGGTCCTCACAGGG + Intergenic
1100456183 12:94753855-94753877 AAGCTGTGACGGTCCTCACACGG + Intergenic
1102079402 12:110085889-110085911 GAGGAAGGAGGGTCCTGAGAGGG + Intergenic
1102180445 12:110908886-110908908 GAGGGGCGAGGGTCACCACAGGG + Intergenic
1103027385 12:117584424-117584446 GAAGGGTTAGCGTCCTCACAAGG + Intronic
1103463495 12:121123536-121123558 GAGGAAGGAGGGTCCTGAGAGGG - Intergenic
1105021424 12:132819088-132819110 GGGGAGGGAGGGTCCTCAGGGGG + Intronic
1105940198 13:25141022-25141044 GAGGAGTGAGGGTCCTCACAGGG - Intergenic
1110242508 13:73284615-73284637 AAGGAGTCAGGGTATTCACAGGG + Intergenic
1110625810 13:77654327-77654349 GGGGAGTGAGGCAGCTCACATGG + Intergenic
1113729206 13:112627479-112627501 GAGGCATGAGGCTCCTCAGAGGG + Intergenic
1113777306 13:112955143-112955165 GAGGAGTGAGGGGCTTCATGAGG + Intronic
1113843109 13:113371470-113371492 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843209 13:113371709-113371731 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843247 13:113371806-113371828 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843279 13:113371886-113371908 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1114563030 14:23607143-23607165 GAGGATTGACAGTCCTGACACGG + Intergenic
1114578439 14:23734672-23734694 GTAGAGAGAGGGTGCTCACAGGG + Intergenic
1116637451 14:47415837-47415859 GAGGATTGAGGGACCTCTCTGGG + Intronic
1117084446 14:52185011-52185033 GGGGAGTGAGGTACTTCACATGG + Intergenic
1117279098 14:54220089-54220111 GAGGAGTGAGGGTGGTGACAGGG - Intergenic
1117865517 14:60144484-60144506 GAGGAATGTATGTCCTCACATGG - Exonic
1120969011 14:90191981-90192003 AAGGAGTGATGGGCCTCACTGGG + Intergenic
1202935671 14_KI270725v1_random:85508-85530 CAGGACTGAGGATCATCACACGG + Intergenic
1124464671 15:29926051-29926073 GGGGAGTGTGGGTCCTGGCATGG - Intronic
1125002437 15:34785467-34785489 GGGGAGTGAGGCATCTCACATGG - Intergenic
1125606846 15:40944315-40944337 GAGAAGTCAAGGTGCTCACAAGG - Intergenic
1125722255 15:41850974-41850996 GAGGCGTGGGGGTCCCCAAAGGG - Intronic
1127327689 15:57911621-57911643 GATGAGTGAGGGGCAGCACAAGG + Intergenic
1127721792 15:61709139-61709161 GGGGAGTGAGGCATCTCACATGG + Intergenic
1132658848 16:1052745-1052767 GAGGAGGGAGGGTGTCCACAAGG + Intergenic
1132879817 16:2157130-2157152 GAAGAGGGAGGCTCCTCACTTGG - Intronic
1133358885 16:5157771-5157793 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
1133416121 16:5608367-5608389 GAGGTGTGAGGGTCCACACGTGG + Intergenic
1135474635 16:22763338-22763360 TCAGAGTGAGGGTCCTCAAATGG + Intergenic
1137748643 16:50842019-50842041 GAGGAGAGAAGGACCGCACACGG + Intergenic
1139019753 16:62733213-62733235 GAGTAGTGAGTGTCCTGACATGG + Intergenic
1139651448 16:68364137-68364159 GAGGAAGGAAGGTCCCCACAAGG + Intronic
1140241864 16:73209478-73209500 GAGGAATGCTGTTCCTCACATGG + Intergenic
1141170083 16:81685430-81685452 GAGGAATCAGGGTCCCCACGGGG - Intronic
1141364649 16:83431644-83431666 GAGGAATGAGGTATCTCACATGG + Intronic
1141759649 16:86019531-86019553 GTGGAGGGAGGGTCCTAAAATGG + Intergenic
1142182569 16:88678404-88678426 TAGGAGGGATGGTCCTCACCGGG - Exonic
1142280918 16:89147160-89147182 GAGGAGGGAGGGTCCACAGAGGG + Intronic
1142445045 16:90130968-90130990 GAGGACTGTGGGTCATCTCAGGG + Intergenic
1142462465 17:104498-104520 GAGGACTGTGGGTCATCTCAGGG - Intergenic
1143780225 17:9225434-9225456 GAGGAGTGAGTGCCCCCACAGGG + Intronic
1144124440 17:12189546-12189568 GAGGAGTGCTGTTCCTCACATGG + Intergenic
1144790088 17:17852952-17852974 GAGGCATGTGGGTCCTCACTGGG + Intronic
1145073138 17:19828830-19828852 GAGGCGTGAGCCACCTCACATGG - Intronic
1145944963 17:28767009-28767031 GAGGAGAGTGGGCCCTCATAGGG + Intronic
1146501536 17:33368921-33368943 GAGAAGTGAGGTTCCCAACAAGG - Intronic
1151989664 17:77566257-77566279 GAGGAGCAGGCGTCCTCACATGG + Intergenic
1152264433 17:79286159-79286181 GACGTCAGAGGGTCCTCACAAGG - Intronic
1152783001 17:82234669-82234691 GAGGAGTGAGGAGCCACGCACGG + Exonic
1154309175 18:13254269-13254291 GAGGAGTGAGGGGCCCCAGGTGG + Intronic
1155078228 18:22381785-22381807 GAGGAGGGAGGGTTCTCAACAGG + Intergenic
1155893954 18:31300299-31300321 GAGGAGTGAAGATACTCATAAGG - Intergenic
1156004902 18:32428531-32428553 GGGTAGTGAGGTACCTCACATGG - Intronic
1158560961 18:58513341-58513363 GAGGAGTAAGGGGCCTCAGAAGG - Intronic
1160013532 18:75124443-75124465 GATGAGTGAGGGTCATTAAAGGG + Intergenic
1160557682 18:79736537-79736559 GAGGTGGGAGGGGCCTGACACGG + Intronic
1160652171 19:236874-236896 GAGGACTGTGGGTCATCTCAGGG - Intergenic
1161837957 19:6660469-6660491 GAGGAGCCTGAGTCCTCACAAGG - Intergenic
1163408751 19:17140363-17140385 AAGGAGTGAGGGTGCTCTCTGGG + Intronic
1163664332 19:18595993-18596015 GGAGAGTGAGGGTCCTGAGAAGG + Intronic
1163827079 19:19529780-19529802 GGGGAGTGAGGGGGCTCTCAGGG + Intronic
1164754766 19:30681385-30681407 GTGGACTGAGGGGCATCACAGGG + Intronic
1165100572 19:33436303-33436325 AAGGAATGAGGGTACTCACCAGG + Intronic
1165159348 19:33806743-33806765 GAGGGGCGAGGGACCTGACATGG - Intronic
1166147012 19:40844886-40844908 GAGGAGTTGGGGTCCTCTGATGG + Intronic
1167250645 19:48396859-48396881 AAGGGGTGAGGGTCCAGACAAGG - Intronic
1167921542 19:52786734-52786756 GTGGAGTGAAGGTCCTACCACGG - Exonic
1168097064 19:54121974-54121996 GGGGCGTGAGGGACGTCACACGG - Intronic
1168282772 19:55314404-55314426 GAGGAGTGAGGCTGCTGGCAGGG - Intronic
1202684881 1_KI270712v1_random:39983-40005 CAGGACTGAGGATCATCACACGG - Intergenic
925196523 2:1930348-1930370 GAGAAGAGAGGGCCCCCACAGGG - Intronic
925684692 2:6458868-6458890 GCGGGGTGTGGGGCCTCACAGGG + Intergenic
926308752 2:11659371-11659393 AAGGAGTGCGGCTCCTCAGACGG - Intronic
926839439 2:17062804-17062826 GAGGCAGGAGGGTCCTCAGAGGG - Intergenic
927489460 2:23511108-23511130 GAGGTCTGAGGGCCCTCAGAAGG - Intronic
931550918 2:63445301-63445323 GAGAAGTGAGGTTCCTCACTGGG + Intronic
932640119 2:73437353-73437375 GTGGAGTGAGGGTCCACTCCAGG - Intronic
933628976 2:84635027-84635049 GAGTAGTGGGGGCCCTCACAGGG - Intronic
934466107 2:94264549-94264571 CAGGACTGAGGATCATCACACGG + Intergenic
934988566 2:98904677-98904699 GAGCAGTGAGGGGGCCCACATGG - Intronic
935167867 2:100585411-100585433 GGGGAGTGAGGTGCCTCACGTGG - Intergenic
935913852 2:107927339-107927361 CAGGTGTGAAGGTCTTCACATGG + Intergenic
936018775 2:108979305-108979327 GAGGAGTGAGGTTCGCCAAATGG - Intronic
937326323 2:120991555-120991577 GAGGAGTGAGGGTGCACCCGGGG + Exonic
937870856 2:126785057-126785079 AAGGAGTGAGTGTCCAGACAGGG - Intergenic
941550013 2:166903548-166903570 GAGAAGTGAGTGTCATCCCAGGG + Exonic
942952713 2:181739009-181739031 GAGGAGTGAGACATCTCACAAGG - Intergenic
943485130 2:188469551-188469573 GGGGAGTGAGGCATCTCACATGG + Intronic
946292090 2:218753214-218753236 GAGGAGGGAGGGGCCTGAGAAGG - Intronic
947965922 2:234281554-234281576 GAAGAGTAGGGGGCCTCACATGG - Intergenic
948658724 2:239493318-239493340 GGGGAGTGAGGTGTCTCACATGG + Intergenic
1168847736 20:956969-956991 GAGGATTGAGGGGCCTCTCTGGG - Intergenic
1169488793 20:6054379-6054401 CAGGAGAGAGGATCCTCAGAAGG + Intergenic
1169846188 20:9994450-9994472 GGGGAATGATGGTCTTCACAGGG + Intronic
1171892011 20:30725265-30725287 CAGGCCTGAGGGTCCTCTCAGGG + Intergenic
1172490185 20:35330325-35330347 CAGGACTGAGTGTCCTCACTTGG + Intronic
1174226888 20:49007848-49007870 GAGGAGACTGAGTCCTCACATGG + Intronic
1175124465 20:56741058-56741080 GAGGAGCCAGTGTCATCACAAGG - Intergenic
1176081138 20:63273406-63273428 AAGAAGTGAGGGTCCTAAGAAGG + Intronic
1176230564 20:64030542-64030564 GATGAGAGAGGCTCCCCACAGGG + Intronic
1179707179 21:43188322-43188344 GAGGAGTGAGGGTGCCCAGCCGG - Intergenic
1180280019 22:10685184-10685206 CAGGACTGAGGATCATCACACGG + Intergenic
1180587235 22:16903716-16903738 CAGGACTGAGGATCATCACATGG + Intergenic
1181695297 22:24589919-24589941 CAGGAAGGAGGGTCCTCTCAAGG + Exonic
1182463015 22:30495534-30495556 CAGGGGTGAGGGGCCTCAGATGG + Intronic
1182998324 22:34834811-34834833 CAGGAGTGGGGGGCGTCACAAGG - Intergenic
1183396549 22:37574744-37574766 GGGCACTGAGGGTCCTCCCATGG - Intronic
1183544903 22:38450252-38450274 GAGGACTGTGGGTCCTGGCAAGG - Intronic
1183743185 22:39679462-39679484 GAGGTGTGAGGGTCGCCAGAGGG + Intronic
1184837569 22:47032923-47032945 GAGGAAGGAGGGGCCACACAGGG - Intronic
1185290252 22:50021455-50021477 GAGGAGTGCACGTCGTCACATGG - Intronic
950186352 3:10948025-10948047 GATGAGTGAGGGTTCTCAGCAGG + Intergenic
951457709 3:22911105-22911127 GAGGAGCGAGGCATCTCACATGG - Intergenic
951555284 3:23915634-23915656 GAGAGGTGAAGGTTCTCACATGG - Intronic
954109408 3:48425634-48425656 GCAGAGAGAGGGACCTCACAGGG - Intronic
954234353 3:49244814-49244836 CAGTGGTGAGGTTCCTCACAGGG + Intronic
955479997 3:59380162-59380184 GAGGAGGGTGGGTCCCTACAAGG + Intergenic
957063350 3:75500050-75500072 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
957631006 3:82715701-82715723 GAGGAGTGCGGGCTCACACAGGG + Intergenic
961290045 3:125839520-125839542 GCAGAGTGAGGTTCCTCAGAAGG + Intergenic
961897052 3:130176497-130176519 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
962014110 3:131422917-131422939 GAGGAGTGTGGCTCCTTACTTGG + Intergenic
963469695 3:145724704-145724726 GGGGAGCGAGGTTTCTCACAAGG - Intergenic
963869107 3:150395143-150395165 CAGGTGTGAGGTTCTTCACAGGG - Intergenic
963900575 3:150728947-150728969 GAGGAGAGAGAGGCCTCTCAAGG - Intergenic
963903442 3:150754311-150754333 GGGGAGTGAGGCATCTCACATGG + Intronic
964835157 3:160929972-160929994 CAGGAGAGAGGGGCCTCAAAAGG - Intronic
967759364 3:193206164-193206186 AAGCACTGAGGTTCCTCACATGG + Intergenic
968365661 3:198183098-198183120 GAGGACTGTGGGTCATCTCAGGG + Intergenic
968941194 4:3639582-3639604 GGGGAGTCAGGATGCTCACACGG + Intergenic
969007232 4:4030054-4030076 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
969060654 4:4431718-4431740 GAGGAGGGAGGGTGCACAGAAGG - Intronic
969344987 4:6564525-6564547 GAGGAGAGAGCGTGCTCCCACGG + Intergenic
969458675 4:7315709-7315731 GAGGTGAGAGAGTCCTCACAGGG - Intronic
969746379 4:9076003-9076025 GCAGAGTGAGGTTCCTCAGAAGG + Intergenic
969805729 4:9607407-9607429 GCAGAGTGAGGTTCCTCAGAAGG + Intergenic
974703903 4:65487020-65487042 AAGGAGTGAGGCATCTCACATGG - Intronic
975775901 4:77786805-77786827 GAGGAGAGAGGCTGTTCACAGGG + Intronic
975975958 4:80097132-80097154 GAGGAGTGAGGGAGCTCTCTGGG + Intronic
976425729 4:84901063-84901085 GAGGAGCGTGTGTCCTCACATGG + Intronic
976498473 4:85758266-85758288 CAAGAGTGAGGGTCCTCAAAGGG + Intronic
977021130 4:91761541-91761563 GAGGAGTGAGGTGTCTCACATGG + Intergenic
978480511 4:109184844-109184866 AAGGAATGAGTTTCCTCACAAGG - Intronic
979254698 4:118598265-118598287 GAGGACTGTGGGTCATCTCAGGG + Intergenic
979334264 4:119447766-119447788 GAGGACTGTGGGTCATCTCAGGG - Intergenic
983631459 4:169853506-169853528 GGGGAGTGAGGCACTTCACATGG - Intergenic
984203875 4:176762378-176762400 GAGGAATGTTGCTCCTCACATGG - Intronic
984607976 4:181806581-181806603 GAGGAATGCTGTTCCTCACAGGG - Intergenic
985553939 5:547009-547031 GAGGGGTGAGGGTCCCTGCAGGG - Intergenic
985570621 5:642861-642883 GAGGGATGAGCGTCCTCACGTGG - Intronic
996854827 5:127993825-127993847 GAGGAGTTTGGGACCTCAAAGGG + Intergenic
997541528 5:134666914-134666936 GGGGCGTGAGGGCCCTCACTGGG - Exonic
997710024 5:135996380-135996402 GGGCAGAGAGGGTGCTCACAAGG - Intergenic
997976366 5:138443957-138443979 GAGAAGTGAGGGTCGTGTCACGG + Intronic
998914020 5:146994751-146994773 GAGGAGTGAGGCTCTGCACAGGG + Intronic
999102226 5:149036229-149036251 GTGGAGTCAGGGTCCCCAAAAGG - Intronic
1000285886 5:159825917-159825939 GAGGTGGGAGGGGCCTGACAGGG - Intergenic
1000870548 5:166571948-166571970 GTAGAATGAGGGTCATCACATGG + Intergenic
1001437438 5:171710997-171711019 GAAGAATAAGGGTCCTCACTGGG + Intergenic
1002002552 5:176206252-176206274 GAGAAGTGAGGTATCTCACATGG + Intergenic
1002224048 5:177705360-177705382 GAGAAGTGAGGTATCTCACATGG - Intergenic
1006308059 6:33236864-33236886 GAGGAGCGAGCCTTCTCACATGG - Intergenic
1006416035 6:33904447-33904469 GAGCAGTTAGGGTTCTCAGAAGG + Intergenic
1007100544 6:39243294-39243316 GAGGAGTTAGGGTCCTTTTAGGG + Intergenic
1007628677 6:43260513-43260535 AAGGACTGAGGTTGCTCACAAGG - Intronic
1012352389 6:98268614-98268636 GAGGAACAAGGTTCCTCACATGG + Intergenic
1012383570 6:98650400-98650422 TAGGAATTAGAGTCCTCACAGGG + Intergenic
1013295617 6:108755993-108756015 GAGGTGGGAGTGTCCTCAAAAGG + Intergenic
1017868010 6:158461532-158461554 GAGGAGAGAGGGTCAGCACAAGG - Intronic
1018717597 6:166545637-166545659 GAGGAGAGAGGAACCTCCCAAGG + Intronic
1018980482 6:168598327-168598349 GAGGAGAGAGGGGTCACACAGGG + Intronic
1019758573 7:2791437-2791459 GAGGAGAAAGGGTCGTCACAAGG + Intronic
1019842640 7:3463696-3463718 AATGAATGAGGCTCCTCACAAGG - Intronic
1020327737 7:6988172-6988194 GCAGAGTGAGGTTCCTCAGAAGG - Intergenic
1020748644 7:12111672-12111694 GAGGAGGGAGACTGCTCACATGG + Intergenic
1021874721 7:25037657-25037679 CAGGAGTGAGGGGCATCACTGGG + Intergenic
1021875001 7:25040436-25040458 CAGGAGTGAGGGGCATCACTGGG + Intergenic
1023355404 7:39362376-39362398 CAGAAGGGAGGGTCCTAACAAGG - Intronic
1024069791 7:45775931-45775953 GAGGACTGTGGGTCATCTCAGGG + Intergenic
1025099595 7:56123721-56123743 GAGGAGTGTGGGTCATCTCAGGG - Intergenic
1029097829 7:98103285-98103307 GAGGAGCGAGGCATCTCACACGG + Intergenic
1029477298 7:100792561-100792583 GAGGGGTCAGGGTCGGCACAGGG - Intronic
1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG + Intronic
1030889593 7:114982874-114982896 GAGGAGCGTGTGTTCTCACATGG + Intronic
1032047181 7:128620217-128620239 GAGGACTGTGGGTCATCTCAGGG + Intergenic
1032096869 7:128942657-128942679 GGGGACTGAGGGTCCCCAGAAGG + Intronic
1033107247 7:138538453-138538475 GAGGAGTGAGGGGCCACATTGGG + Intronic
1035143401 7:156787236-156787258 GGGGAGAGAGGGTGGTCACAAGG - Intronic
1035496532 7:159332464-159332486 GAGGTTTGAGGGTCTTCACTCGG - Intergenic
1036500266 8:9307844-9307866 TGGGAGTGAGGGTGCTAACAAGG + Intergenic
1036848538 8:12185967-12185989 GGGGACTGAGTGTGCTCACAGGG + Intronic
1036869898 8:12428248-12428270 GGGGACTGAGTGTGCTCACAGGG + Intronic
1037294954 8:17390266-17390288 GGGGAGTGAAGCTTCTCACATGG + Intronic
1038966135 8:32574634-32574656 GAGTAGTGGGGGACATCACATGG - Intronic
1041118867 8:54566468-54566490 GAAGAGTGAAGGACCTCACAGGG + Intergenic
1043392069 8:79801424-79801446 CAGGAAGGAGGGTCCTCACCAGG + Intergenic
1046046097 8:108966677-108966699 GGGGAGTGAGGCACTTCACATGG - Intergenic
1047725972 8:127684250-127684272 GAGGAGTAGGGGGCCCCACAGGG + Intergenic
1047779429 8:128099316-128099338 CAGGCGGGAGGGTCCTCTCAGGG + Intergenic
1048150395 8:131888087-131888109 GAGTAGTCAGGCTCCTCTCAGGG - Intergenic
1048637214 8:136310152-136310174 GATGAGTGAGGCTTCTCACATGG - Intergenic
1051274658 9:15387195-15387217 GGGGAGTGAGGAACTTCACATGG - Intergenic
1052358162 9:27527803-27527825 GAGAAGTCAGGGTCCCCAGATGG - Intronic
1052829493 9:33203243-33203265 AAGAAGTGAGGGTCCTCACGAGG + Intergenic
1052895331 9:33742276-33742298 GTGGAGTGAAGTTCCTCAGAAGG - Intergenic
1053281560 9:36823459-36823481 GAGGGATGAGGGTCACCACAGGG + Intergenic
1053414329 9:37937520-37937542 GAGGATGGAGGCTGCTCACAGGG + Intronic
1053696160 9:40641321-40641343 CAGGACTGAGGATCATCACACGG + Intergenic
1054307407 9:63440540-63440562 CAGGACTGAGGATCATCACACGG + Intergenic
1054406139 9:64764551-64764573 CAGGACTGAGGATCATCACACGG + Intergenic
1054439765 9:65250024-65250046 CAGGACTGAGGATCATCACACGG + Intergenic
1054490642 9:65771915-65771937 CAGGACTGAGGATCATCACACGG - Intergenic
1057725482 9:97565164-97565186 GAGGAGGCTGGGGCCTCACAGGG - Intronic
1057802401 9:98198309-98198331 AAGGACTGGGGGTTCTCACATGG - Intergenic
1057971237 9:99560153-99560175 GAGGAATCAGGCCCCTCACAGGG + Intergenic
1061245767 9:129400746-129400768 GAGGGGTGAAGGTCATCCCAGGG + Intergenic
1062136644 9:134932320-134932342 GAGGAGTTAAGGTCCTCAGATGG - Intergenic
1062379154 9:136278471-136278493 GAGGAGTCAGGGCACTCACTGGG - Intergenic
1062750030 9:138245965-138245987 GAGGACTGTGGGTCATCTCAGGG + Intergenic
1202778609 9_KI270717v1_random:14982-15004 CAGGACTGAGGATCATCACACGG + Intergenic
1203585682 Un_KI270747v1:1393-1415 CAGGACTGAGGATCATCACACGG + Intergenic
1187855411 X:23632181-23632203 CAGGAGTGAGGCATCTCACATGG + Intergenic
1188519518 X:31022079-31022101 AAGGAGTGGGTGTCCTCACAAGG + Intergenic
1189213515 X:39304139-39304161 GGGGAGTGAGGCATCTCACATGG - Intergenic
1189294280 X:39908020-39908042 GAGGAGGGAGGGTGGGCACAGGG - Intergenic
1189758102 X:44292809-44292831 GGGGAGTGAGGCACTTCACATGG - Intronic
1190221380 X:48514422-48514444 GAGGAGGGCGGGTGCTCCCAGGG + Intronic
1191736936 X:64397017-64397039 GGGGAGTGAGGCACTTCACATGG - Intergenic
1193102936 X:77636404-77636426 GGGGAGTGAGGCACCTCACATGG - Intronic
1201193914 Y:11473259-11473281 CAGGACTGAGGATCATCACACGG + Intergenic