ID: 1105940970

View in Genome Browser
Species Human (GRCh38)
Location 13:25147692-25147714
Sequence CTGGGGGTAGGGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1059
Summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 955}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105940970 Original CRISPR CTGGGGGTAGGGAGGGAATC AGG Intergenic
900122769 1:1055968-1055990 CTGGGGGTGGGGATGGGATGGGG - Exonic
900559680 1:3297748-3297770 CAGGGGACAGGGAGGGAGTCAGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901117872 1:6863318-6863340 CAGGGGTTGGGGAGGGAATGGGG - Intronic
901511418 1:9719849-9719871 CTGGGGGAGGGCAGGGAAGCTGG + Intronic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
902138600 1:14333018-14333040 ATGGGGGTAGGGAGAGCATAAGG - Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902796058 1:18800939-18800961 GTGGGGTTAGGGAGGGGATCAGG - Intergenic
902909615 1:19585818-19585840 GTGGGGCTAGGGAGGGAATGGGG + Intergenic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903178756 1:21595129-21595151 GTGGGGCTAAGGGGGGAATCGGG - Intergenic
903253256 1:22072475-22072497 TTGTGGGTGGGGAGGGATTCAGG + Intronic
903255158 1:22092593-22092615 CTGGGGGTAGGGTGGGGGTGGGG + Exonic
903290331 1:22309272-22309294 CTGGGGGAAGTGAGAGCATCAGG + Intergenic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
904378733 1:30097285-30097307 CTGGGAGCAGGCAGGGATTCTGG + Intergenic
904480291 1:30789103-30789125 CTGGGGGTAGGGGAGGATCCGGG - Intergenic
904551221 1:31320472-31320494 CTGGGGGCATAGAGAGAATCTGG - Intronic
904851763 1:33464844-33464866 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
904957050 1:34293458-34293480 GTGGGGGGAGGGAGAGGATCAGG - Intergenic
904989752 1:34582602-34582624 CTGAGGGAAGGGAGGGATTTAGG + Intergenic
905203222 1:36327853-36327875 CAGGGGGTGGGGAGGGCATGTGG - Exonic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905737171 1:40337561-40337583 GTGGGGTTGGGGAGGGAAACCGG - Intergenic
905797507 1:40823907-40823929 CTGGGGGTAGAAAGGGAGTGGGG + Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905947593 1:41917085-41917107 CTGGGGGCAGGGAGAGAGTGGGG - Intronic
905986186 1:42285251-42285273 GTAGGGGGAGGGAGGGCATCAGG - Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906366330 1:45213129-45213151 ATTGGGGCAGGGAGGCAATCAGG + Intronic
906479926 1:46193216-46193238 CTGGGAGTGGGGTGGGAATAGGG + Intronic
906527073 1:46500170-46500192 CTGGGGAGGGGGAGGGCATCAGG + Intergenic
906569497 1:46824426-46824448 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
907240476 1:53078343-53078365 CCTGGGGCAGGGAGGGAATTAGG - Exonic
907524382 1:55045664-55045686 CAGGAGGTAGGGAGGGAGTGGGG + Intronic
907854346 1:58287167-58287189 CTGGAGGGAGGGAGAGCATCAGG + Intronic
908079121 1:60556378-60556400 CTGGGAGGAGGGAGAGCATCAGG - Intergenic
908440953 1:64153740-64153762 CTGGGGGAAGGGGGGAAATGGGG + Intronic
908463321 1:64367225-64367247 CTGGGGGAAAGGAGGCAATGGGG + Intergenic
908914449 1:69109654-69109676 GTGGGGGTAGAGAGGGAAAGAGG - Intergenic
909012910 1:70354418-70354440 CAGGGGCAAGGGGGGGAATCGGG + Exonic
909049029 1:70746024-70746046 ATGGGAGTAGGGAGAGAATCAGG - Intergenic
909268108 1:73588400-73588422 GTGGAGGGAGGGAGGGCATCAGG - Intergenic
910136143 1:83972267-83972289 CCAGGGGTTGGGAGGGAATGGGG - Intronic
910158102 1:84243261-84243283 GTGGGGGTGGGGAGGGAACCAGG + Intergenic
910317016 1:85897257-85897279 CTCGGGGGAGGGAGTGTATCAGG + Intronic
910937718 1:92499211-92499233 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
911467480 1:98273673-98273695 TTAGGGGGAGGGAGGGCATCAGG + Intergenic
911843005 1:102708340-102708362 GTCGGGGGAGGGAGAGAATCCGG + Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912082341 1:105952146-105952168 CTATGGGGAGGGAGTGAATCTGG - Intergenic
912502013 1:110128997-110129019 CTGGGGGTGGGGAGTGAGTGGGG + Intergenic
912630873 1:111245778-111245800 CTGGGGTTGGGGATGGATTCTGG + Intergenic
912635847 1:111291839-111291861 GTGGGGGTAGGGAAAGCATCAGG + Intronic
912948992 1:114107471-114107493 CTGGAGGCAGGGAGGAAACCAGG + Intronic
913313736 1:117532269-117532291 CTGGGGGTAGGGGGTGATTCTGG + Intergenic
913471346 1:119190450-119190472 GTGGGGGAAGGGAGGGAGTAGGG - Intergenic
914443926 1:147733355-147733377 ATGGGAGTAGGGAGGGGATCAGG + Intergenic
914455609 1:147833630-147833652 CTCAGGGGAGGGTGGGAATCTGG - Intergenic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
914902246 1:151716951-151716973 CTGGGGGCGGGAAGGGAGTCAGG - Intronic
914946757 1:152073548-152073570 AGGAGGGTAGGGAGGGAGTCAGG - Intergenic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915311391 1:155007474-155007496 CTGGTGGTAGGGAGAGACACTGG + Intronic
915436561 1:155911185-155911207 CTGGGGGTGGGGAGGGGGTTCGG - Intronic
915518706 1:156429050-156429072 CTGGGGGAAGGAGGGGAACCAGG + Intronic
915870179 1:159550919-159550941 ATGGGGGTAGGAAGAGCATCAGG + Intergenic
916205876 1:162315818-162315840 GTGGGGGTAGGGATGAAATCAGG - Intronic
916463915 1:165054153-165054175 GTGAGGGTAGGGAGGGAGTTGGG - Intergenic
916648253 1:166810644-166810666 GTGGGGGTAGGGAGAGCATCAGG - Intergenic
916756307 1:167773394-167773416 AGGGGTGGAGGGAGGGAATCAGG + Intronic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918483009 1:184999970-184999992 CTGGGAGGAGGGAGAGGATCGGG - Intergenic
919045622 1:192448133-192448155 CTGGGGGTAGGGAGTGATAAAGG - Intergenic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920167998 1:204049717-204049739 ATGGGGGGAGGGAGAGCATCAGG - Intergenic
920335882 1:205244837-205244859 ATGGGGGTACTGAGGGAATGAGG + Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920951822 1:210579147-210579169 GTGGGAGGAGGGAGAGAATCAGG + Intronic
921151890 1:212409301-212409323 CTGGAGGGTGGGAGGTAATCTGG + Intronic
921986188 1:221315533-221315555 CTGGGGGAAGGGAAGGACACTGG + Intergenic
922387270 1:225099526-225099548 CTGGGGGTAGGGAGAAGTTCTGG - Intronic
922404068 1:225293674-225293696 GTGGGAGGAGGGAGAGAATCAGG + Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923697004 1:236263093-236263115 TTTGGGGAAGGCAGGGAATCAGG - Intronic
924141374 1:241027261-241027283 CAGGGAGTGGGGAGGGAAACTGG + Intronic
924707489 1:246511588-246511610 CTAGGGATAGGGTGGGCATCAGG + Intergenic
924743603 1:246812695-246812717 CTGAGGGTAGGGGGAGCATCGGG - Intergenic
1063366772 10:5495579-5495601 TTGGGGGTTGGGACAGAATCTGG - Intergenic
1063557293 10:7092918-7092940 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064332988 10:14411146-14411168 CTGGGGGCAGAGATGCAATCAGG - Intronic
1064377982 10:14814409-14814431 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065000968 10:21337282-21337304 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1065067177 10:21981945-21981967 CTGGGGGTTGGTGGGGAATGAGG - Intronic
1065243653 10:23734936-23734958 GTGGGAGGAGGGAGAGAATCAGG - Intronic
1065540020 10:26754579-26754601 CTGGCAGGAGGGAGGGAATGGGG + Intronic
1065758411 10:28957304-28957326 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1065968357 10:30786363-30786385 CTGTGGGTAGGGGATGAATCAGG + Intergenic
1067144988 10:43688401-43688423 ATGGGGGGGGGGGGGGAATCAGG + Intergenic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067795228 10:49316325-49316347 CTGGGGGTGGGGGGAGAATGAGG + Intronic
1067821648 10:49536296-49536318 TTGGGGGTAGGGAGAGAACTAGG + Intronic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068875732 10:61994607-61994629 CTGGGGGTGGGGAAGGAGTCGGG - Intronic
1069194915 10:65539166-65539188 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
1069874812 10:71555283-71555305 CTGGGGCCAGGGTGGGTATCAGG + Intronic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1071784266 10:88880920-88880942 CTGGTGGCAGGGCGGGACTCTGG + Intronic
1071913760 10:90266748-90266770 CTGGGGGGAGGGAGAGTATTAGG + Intergenic
1072726964 10:97820324-97820346 CTGGGGGGAGGGAGAGAATGAGG - Intergenic
1073143941 10:101266863-101266885 CTGGGGTGAGAGAGGGAATGGGG - Intergenic
1073464721 10:103687781-103687803 CTGGCAGTGGGGAGGGAATAGGG - Intronic
1074026388 10:109640450-109640472 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1074111279 10:110424219-110424241 GTGGGGGTAGTTAGGGAAGCTGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074812402 10:117118787-117118809 CTGGGAGGAGGGAGAGCATCAGG + Intronic
1074840711 10:117347937-117347959 CTGGGGGTAGGTAAGGGATTAGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075304897 10:121359138-121359160 GTGGGGAGAGGGAGGGCATCAGG - Intergenic
1076527301 10:131120098-131120120 CTGGGGGAAGGGACAGAACCGGG - Intronic
1076556725 10:131328025-131328047 CTGGGGTTAAGGAGGGCATGGGG - Intergenic
1076760897 10:132605316-132605338 CTGGGGATGGGGAGGGGATGGGG + Intronic
1076760946 10:132605432-132605454 CTGGGGATGGGGAGGGGATGGGG + Intronic
1076833242 10:133007405-133007427 CTGGGGGCTGGGAGGGGAACAGG - Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077179865 11:1207435-1207457 CTGGGGGCAGGGAGGTCACCAGG + Intergenic
1077462645 11:2718304-2718326 CTGGGGCTAGGGATGGAGTGTGG - Intronic
1079241312 11:18724096-18724118 ATGGGGGCAGGGAAGGGATCGGG - Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080563452 11:33485774-33485796 CTGGGGTTGGGGTGGGAATGGGG - Intergenic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081009149 11:37786094-37786116 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1081213404 11:40363418-40363440 CTGGGAGGAGGGAGAGGATCAGG + Intronic
1081306117 11:41514209-41514231 TTGGGAGGAGGGAGAGAATCAGG + Intergenic
1081410430 11:42751547-42751569 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
1081526307 11:43930110-43930132 CTGGGGGCCAGGTGGGAATCCGG - Intronic
1081739831 11:45430963-45430985 GTGGGAGGAGGGAGGCAATCGGG + Intergenic
1082021680 11:47539327-47539349 CTGGGGCTAAGGAGGGTATGGGG + Intronic
1082114533 11:48313975-48313997 CTGGTGGGAGGGAGAGCATCAGG + Intergenic
1082696861 11:56377946-56377968 CTGGGAGGAGGGAGCCAATCAGG - Intergenic
1082779350 11:57274430-57274452 CTGGGGGCAGGGCAGGAATATGG - Intergenic
1083171562 11:60926582-60926604 CTGGGGGTGGGGTGGGGACCAGG - Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083318064 11:61828390-61828412 CATGGGGAAGGGAGGGAACCAGG + Exonic
1083463688 11:62831860-62831882 CTGGCGGGGGGAAGGGAATCAGG - Intronic
1083594857 11:63914340-63914362 CAGGGGCCAGGGAGGGAATGAGG + Intronic
1083714509 11:64567885-64567907 CTGGGGCCAGGGAGGGGATGTGG - Intronic
1084967360 11:72751705-72751727 CGGCGGGGAGGGGGGGAATCTGG - Intronic
1084990249 11:72916072-72916094 GTGGGAGGAGGGAGAGAATCAGG + Intronic
1085282047 11:75337504-75337526 CTTGGGTTAGGGAGTGAGTCAGG - Intronic
1086129598 11:83387070-83387092 GTGGGGGTAATGAGGGAAACTGG - Intergenic
1086199928 11:84189831-84189853 ATGGGGGGAAGGAGGGCATCAGG + Intronic
1086510308 11:87550160-87550182 GTGGGAGAAGGGAGAGAATCAGG - Intergenic
1086902426 11:92382972-92382994 CTGGGGGTAGGGAGAGCATCGGG - Intronic
1087151647 11:94865605-94865627 CCGGGGGTAGGTAGGGGATAGGG - Intronic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087675088 11:101152507-101152529 GTGGGGGTAGGGAGAGCATAAGG - Intergenic
1088218233 11:107537564-107537586 GTGGGGGAAGGGAGAGCATCAGG + Intronic
1088824599 11:113483216-113483238 CTGGGGGCATGGAGGGACACAGG - Intergenic
1089453443 11:118612097-118612119 CTGGGGCTAGGGGTGGAATGAGG - Intronic
1089693004 11:120198176-120198198 ATGGGGGAGGGGAGGGAATTGGG + Intergenic
1089693592 11:120201815-120201837 CTGGGGGCAGGGAGGGGGTGGGG - Intergenic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1090367520 11:126219759-126219781 CTGGGGGTAGGGAGGTGCTGGGG - Intronic
1090383135 11:126340648-126340670 CTGGGGATAGGGAGGCACCCTGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1091782779 12:3224498-3224520 CTGGGGGCAGAGGCGGAATCAGG + Intronic
1092199357 12:6570512-6570534 CTGGGGGAGGGGAGGGAGTGAGG - Exonic
1092343941 12:7699929-7699951 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092367037 12:7884878-7884900 CTGAGGGTAGGGTGGGAAAGAGG + Intronic
1093224342 12:16463440-16463462 GTGGGGGGAGGGAGGGCATCAGG + Intronic
1093253706 12:16839706-16839728 GTGGGAGGAGGGAGGGTATCAGG + Intergenic
1094038511 12:26097169-26097191 CTGGGGGTAGGGAGAGTCCCTGG + Intergenic
1094501295 12:31023275-31023297 CTCGGGGAAGGGCGTGAATCCGG + Intergenic
1094722454 12:33078277-33078299 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
1095233138 12:39765865-39765887 CTGGGAGGAGGGAGAGCATCAGG - Intronic
1095703273 12:45212814-45212836 GTGGGGGGAGGGAGGGCATCAGG - Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095803224 12:46290700-46290722 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
1095887387 12:47203442-47203464 TTGGGAGGAGGGAGAGAATCAGG - Intronic
1095932019 12:47636846-47636868 CTCGGGCTAGGGGGCGAATCCGG + Intergenic
1095943711 12:47741629-47741651 GTGGGGGAAGGGAGGGAGGCCGG + Intronic
1096011910 12:48224916-48224938 CTGGGGGGAGGGAGAGCATCAGG + Intergenic
1096086071 12:48865846-48865868 TTGGAGGGAGGCAGGGAATCTGG - Exonic
1096192616 12:49630403-49630425 CTTGGGGTGGGCAGGAAATCGGG + Intronic
1096338083 12:50772898-50772920 GTGGGGGAAGGGAGAGCATCAGG - Intronic
1096443296 12:51664863-51664885 ATGGGGGGAGGGAGAGCATCAGG - Intronic
1096569122 12:52509844-52509866 TTGGGGGAAGGGAGAGCATCAGG - Intergenic
1096638450 12:52975871-52975893 TGGGAGGTAGGGAGGGACTCAGG + Intergenic
1096873613 12:54610490-54610512 TTTGGGGTAGGGATGGACTCTGG + Intergenic
1097085204 12:56462803-56462825 CAGGGGGTGGGGAGGGCCTCAGG - Intronic
1097161387 12:57048767-57048789 CTGGGGGTAGATGGGGAGTCTGG - Intronic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1097658309 12:62397007-62397029 CTGGGGGGTGGGGGGCAATCTGG - Intronic
1097856549 12:64469583-64469605 CTGGGGAAAGTGAAGGAATCAGG - Intronic
1097861917 12:64526455-64526477 CTGGGGGTTGGGAGGGGTTAGGG - Intergenic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1098263723 12:68697478-68697500 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1098323845 12:69279733-69279755 CTGGGGCTAGGGTGGGAATGGGG - Intergenic
1098878780 12:75894803-75894825 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
1099283672 12:80687390-80687412 CAGGGGGAAGGGAGAGCATCAGG + Intergenic
1099596708 12:84675655-84675677 GTGGGGGTTGGGAGAGCATCAGG - Intergenic
1099902147 12:88724260-88724282 CTGGAGGTAGGCAGCGAACCAGG - Intergenic
1100407563 12:94284755-94284777 GTAGGGGTAGGGAGGCAAGCAGG + Intronic
1100738294 12:97562456-97562478 GTGGGGGTTGGGAGGGTAGCTGG + Intergenic
1101091867 12:101295180-101295202 CTGGGGGTAGGGAGGGTTCATGG + Intronic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1102025039 12:109709649-109709671 CTGGGGGTGGGGTGGGAGGCTGG + Intergenic
1102343337 12:112141048-112141070 CTTGGGGTCAGGATGGAATCTGG + Exonic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102659822 12:114516284-114516306 CTGGGGGTGGGGAGAGAATGGGG + Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102796737 12:115695484-115695506 GTGGGAGGAGGGAGGGGATCAGG - Intergenic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103260167 12:119580504-119580526 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1103275302 12:119706419-119706441 GTGGGAGGAGGGAGGGGATCGGG - Intronic
1103348101 12:120264796-120264818 CTAGGGGTGGGGAGAGAATCAGG + Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1103389573 12:120562128-120562150 GTGGGAGGAGGGAGGGGATCAGG - Intronic
1103693310 12:122793480-122793502 CTGGGGGTAGGTAAGGAATATGG + Intronic
1103859958 12:124004238-124004260 CTGGGTGGAGGGAGGGCATAAGG + Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1104313421 12:127675338-127675360 CTGGGAGGAGGGGGGGAATTAGG + Intergenic
1104338287 12:127922107-127922129 ATGGGAGGAGGGAGGGAGTCAGG - Intergenic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104603678 12:130171357-130171379 CTGGGGGCAGGGGTGGAATGGGG - Intergenic
1104650505 12:130528460-130528482 GTAGGGGAAGGGAGAGAATCAGG + Intronic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1105072543 12:133243797-133243819 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106008207 13:25791392-25791414 ATGGGAGTAGGGAGAGGATCAGG + Intronic
1106349110 13:28910525-28910547 CTGGGGGGAGGAAGAGCATCAGG - Intronic
1106626436 13:31425363-31425385 CTGGGGTTGAAGAGGGAATCAGG + Intergenic
1107396517 13:40023556-40023578 CATGGGGTAGGGTGGGAATGGGG + Intergenic
1107610439 13:42107535-42107557 CTGGAGGGAGGGAGGGAGTATGG + Intronic
1108426957 13:50312198-50312220 CTGGGGCTAGGGAAGGTGTCTGG + Intronic
1108545810 13:51492211-51492233 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1108648588 13:52453997-52454019 CTGAGGGTAGGGGGAGAATTGGG - Intergenic
1108651334 13:52482963-52482985 ATGGGGGGAGGGAGAGCATCAGG - Intergenic
1108759112 13:53541285-53541307 ATGGGAGAAGGGAGAGAATCAGG + Intergenic
1109175245 13:59147225-59147247 CTGGGGGGAGAGAGAGCATCAGG + Intergenic
1109237411 13:59842121-59842143 CTGGGTTTAGGCAGGGAATATGG - Intronic
1109594297 13:64530057-64530079 CTGGGGGGTGGGAGGAAAACAGG - Intergenic
1110145286 13:72183213-72183235 ATGGAGGTAGGGAGAGCATCAGG - Intergenic
1110254983 13:73423368-73423390 CTGGCTGTAGGGAAGGAATAAGG + Intergenic
1110489042 13:76080836-76080858 TTGGGGGCAGGGAGAGCATCAGG + Intergenic
1111716321 13:91883919-91883941 CTGGGAGGAGGGAGAGGATCAGG - Intronic
1111873717 13:93866729-93866751 GTGGGAGTAGGGAGAAAATCAGG + Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113269991 13:108662756-108662778 CTCGGGGGAGGGTGTGAATCAGG - Intronic
1113340123 13:109414569-109414591 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1113418001 13:110145728-110145750 GGAGGGGTAGGGAGGGAATGGGG + Intergenic
1113428077 13:110226420-110226442 TTGGGGGTAAGGAAGTAATCTGG - Intronic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1114583163 14:23784186-23784208 CTGGGGGAAAAGGGGGAATCTGG + Intergenic
1114616729 14:24072396-24072418 ATGGGGGTAGGGAGTGGATAGGG + Intronic
1114707935 14:24746346-24746368 CAGGAGGTAGGGAGGGACACAGG + Intergenic
1115100286 14:29690229-29690251 TTGGGGGTAGGGATGGACTTGGG - Intronic
1115258994 14:31433797-31433819 CTGAAGGTAGGGAGGAAATGGGG + Intronic
1116294908 14:43094593-43094615 TTGGGAGGAGGGAGGGCATCAGG + Intergenic
1116943722 14:50816215-50816237 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1117127968 14:52651938-52651960 CTGGGGGTGGGGAGTGGATGGGG - Intronic
1117305435 14:54469066-54469088 TTAGGGGTGGGGAGGGCATCTGG + Intergenic
1117368318 14:55052236-55052258 GTGGGGGTAGAGGGGAAATCGGG - Intronic
1117607163 14:57441428-57441450 CTGTGGGTGGGGAGGTAATCAGG + Intergenic
1118386208 14:65257563-65257585 ATGGGCGTGGGGATGGAATCTGG - Intergenic
1118698417 14:68409000-68409022 CTGGAGGTGGGCAGGGAATGAGG + Intronic
1118768897 14:68928797-68928819 CTGGGGGCAGGGAGAGGATGTGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118908693 14:70043282-70043304 CTTGGGGGAGGTAGGGAATGTGG + Intergenic
1119217864 14:72882956-72882978 CTCGATGTAGGGAGGGAGTCAGG + Intronic
1119731606 14:76954806-76954828 CTGGGAACAGGGAGGAAATCTGG - Intergenic
1119901525 14:78264483-78264505 GTTGGGGAGGGGAGGGAATCTGG + Intronic
1120368496 14:83602374-83602396 TTGTGGGGAGGGAGGGCATCAGG - Intergenic
1120582371 14:86268386-86268408 ATGGGGGGAGGGAGAGCATCAGG + Intergenic
1121043550 14:90771038-90771060 CTGGGGGTGGGAGGGGAATGGGG + Intronic
1121104055 14:91269468-91269490 CTGAGGGTGGGGTGGGAATCTGG - Intergenic
1121161846 14:91750388-91750410 CTGGGGAAAGGGAGAGCATCAGG + Intronic
1121732595 14:96196966-96196988 CTGGGGGTAGGAGGGGGTTCTGG + Intergenic
1122205239 14:100145069-100145091 CTGGGGGGCGGCAGGGAAGCGGG - Exonic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1123670107 15:22647893-22647915 CTGGGGGGAAGGAGAGCATCAGG + Intergenic
1123737212 15:23196946-23196968 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1124155966 15:27225632-27225654 CTGGTGGTGGGTAGGGAAGCAGG - Intronic
1124288428 15:28425608-28425630 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1124294796 15:28491706-28491728 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1125055992 15:35359363-35359385 CTTGGGGAAGGGCGCGAATCTGG - Intronic
1125444404 15:39737804-39737826 CTGGGAGGAGGGAGAGGATCAGG - Intronic
1125867406 15:43065494-43065516 GTGGGGGTAGAGAGAGTATCAGG - Intronic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126466196 15:48963411-48963433 CTGGGGTGAGGGTGGGAGTCGGG - Exonic
1128078509 15:64842652-64842674 CTAGCTGTAGGGAAGGAATCGGG + Intronic
1128088739 15:64904669-64904691 ATGGGAGGAGGGAGAGAATCAGG + Intronic
1128101056 15:65000310-65000332 ATGGGGGGAGGGAGAGCATCAGG - Intergenic
1128301835 15:66570826-66570848 TTTGTGGTAGGCAGGGAATCTGG + Intergenic
1128311584 15:66634316-66634338 CTGGAGGTAGAAAGGGAAGCGGG + Intronic
1128414445 15:67431495-67431517 GTGGGAGGAGGGAGAGAATCAGG + Intronic
1128647173 15:69386580-69386602 CCGGAGGGTGGGAGGGAATCCGG - Intronic
1128918614 15:71590562-71590584 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1129039036 15:72670192-72670214 GTGAGGGTAGGGAGGCCATCAGG - Intergenic
1129150580 15:73685122-73685144 TTGGGGGTGGGGAGGGAATTGGG + Intronic
1129208404 15:74051061-74051083 CTGGGGCTAGGGGAGGAATGGGG + Intergenic
1129238031 15:74235343-74235365 GTGGGGGTAGAGAGGGAGGCTGG + Intergenic
1129399548 15:75274042-75274064 GTGAGGGTAGGGAGGCCATCAGG - Intronic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1129886473 15:79041664-79041686 CTGGGCTCAGGGAGGGAACCAGG - Intronic
1130129075 15:81121846-81121868 GTGGGAGGAGGGAGAGAATCAGG - Intronic
1130186021 15:81683172-81683194 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130767757 15:86889526-86889548 GTGGGGGAAGGGAGAGCATCAGG - Intronic
1131096875 15:89661457-89661479 CTGGGGATGGGGAGGGATTGTGG + Intergenic
1131764853 15:95664606-95664628 CTAGGGGGAGGGAGAGAATGTGG - Intergenic
1131934381 15:97486630-97486652 CTAGGGGTAGGGAGAGCATCAGG + Intergenic
1132424908 15:101707688-101707710 CTGGGGGCAGGGCGGGAATGGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133020881 16:2966557-2966579 CTGGGGTCGGGGTGGGAATCGGG - Intronic
1133025633 16:2987940-2987962 CTGGGGAGAGGGCGGGAACCAGG - Intergenic
1133424031 16:5672134-5672156 CTGGGGGCAGGCAGTGGATCAGG + Intergenic
1133472190 16:6085960-6085982 CTGGGGGAAGAGAGAGCATCAGG - Intronic
1133591419 16:7247899-7247921 GTGGGAGTAGGGAGAGGATCAGG + Intronic
1133598919 16:7320213-7320235 GTGGGGGAAGGGAGAGCATCAGG - Intronic
1134202533 16:12210736-12210758 GAGGAGGTAGGGAGGGAATGAGG - Intronic
1134336961 16:13309200-13309222 TTGGGGCTAGGGAGGGCATCAGG + Intergenic
1135221790 16:20620831-20620853 CTGGGGGAAGGAAGGGGATAGGG + Intronic
1135840966 16:25875862-25875884 CTGGTGGGAAGCAGGGAATCAGG - Intronic
1135853898 16:25988720-25988742 GTGGAGGGAGGGAGAGAATCAGG + Intronic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136366987 16:29813490-29813512 TTGGGGGTAGGCTGGGAATCTGG - Exonic
1136428857 16:30185750-30185772 CTCAGGGTTGGGAGGGACTCTGG + Intronic
1136452359 16:30360518-30360540 CTGGAGGCAGGGAGAGGATCTGG - Intronic
1136591902 16:31222804-31222826 CTGGGGGTGGGGAGGGGAAGGGG - Intronic
1137354161 16:47743292-47743314 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1137415953 16:48279652-48279674 CTGGGGTGGGGGAGGGGATCTGG + Intronic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138061292 16:53893307-53893329 GTGGGGGTAGGAAGTGCATCGGG - Intronic
1138137160 16:54533060-54533082 CAGGGGCTAGGTAGGGAAACAGG + Intergenic
1138214588 16:55191946-55191968 CTGGAGGGTGGGAGGGAATTTGG + Intergenic
1138319644 16:56101248-56101270 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
1138410225 16:56833569-56833591 CTGGGGGGTGGGGGGGAAGCAGG - Intronic
1138430150 16:56963260-56963282 GTGGGGGTAGGGAAGGTGTCAGG - Intronic
1138511031 16:57508460-57508482 CTGGGGGTGGGGTGGGGTTCTGG + Intergenic
1138533858 16:57649406-57649428 CTGGGGGTGGGGAGGGGCTTTGG + Intronic
1138924626 16:61576207-61576229 CTGGGAGTAGTGAGGCAATGCGG + Intergenic
1139558739 16:67728709-67728731 CTGGGGCAAGGGTGGGAATCAGG - Intronic
1139908185 16:70380842-70380864 CTGGGGGTAGGGACGGAGTCGGG + Exonic
1140213900 16:72992331-72992353 ATGGGGGAAGGCAGGGAAGCTGG - Intronic
1140256884 16:73345373-73345395 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1140892405 16:79296374-79296396 CAGGGTGTAGGGAGAGCATCAGG + Intergenic
1140906122 16:79410825-79410847 CTGGGGTTTGGGTGTGAATCAGG + Intergenic
1141427171 16:83951967-83951989 AAGGAGGTAGGGAGGGAAGCAGG - Intronic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1142084633 16:88170433-88170455 CTGGGAACAGGGAGGGAATGGGG - Intergenic
1142876657 17:2855091-2855113 GTGGTGGTAGGCAGGGAATACGG + Intronic
1142922793 17:3205769-3205791 ATGGGAGGAGGGAGAGAATCAGG + Intergenic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1143290388 17:5823492-5823514 CTGGGGGTGGGGAGGAGATGGGG + Intronic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1144585467 17:16485028-16485050 GTGGGGGTAGGGAGGAGAGCAGG + Intronic
1144675509 17:17159017-17159039 CTGGGAGCAGGGTGGGGATCTGG - Intronic
1144823176 17:18089624-18089646 TTGGGGGTGGGGAGGGACTGGGG + Intronic
1145105434 17:20111616-20111638 CTAGGGGCAGGGTGGGAATGAGG + Intronic
1146017124 17:29242743-29242765 GTGGTGGTCGGGTGGGAATCAGG - Intergenic
1146613708 17:34333815-34333837 CTGGGCGGAGGGAGAGGATCAGG + Intergenic
1146640157 17:34534481-34534503 CTGGGATTAGGGAGGGGATGGGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147452452 17:40514175-40514197 GTGGGAGCACGGAGGGAATCAGG + Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1148029073 17:44607766-44607788 CTGGGAGTAGGCTGGGAGTCTGG - Intergenic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149220515 17:54411686-54411708 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1149246994 17:54720932-54720954 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149654356 17:58302481-58302503 CAGGGGGTCAGGAGGGAATCAGG - Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1151683987 17:75636238-75636260 CGTGGGGTTGGGAGGGACTCTGG + Intronic
1151973651 17:77471854-77471876 CTTGGGGTGGGGAAGGCATCAGG + Intronic
1152151556 17:78604354-78604376 CTGGCGCTGGGGAGGGACTCAGG - Intergenic
1152290785 17:79438814-79438836 CTGAGGGGAGGGATGAAATCTGG + Intronic
1152296395 17:79469620-79469642 GTGGGTGGAGGGAGGGAGTCTGG - Intronic
1152337187 17:79705646-79705668 CTGAGTGTAAGGAGGAAATCAGG + Intergenic
1152645054 17:81464995-81465017 TTGGGGGTGAGGAGAGAATCTGG - Exonic
1152909272 17:82989347-82989369 GTGGGGGAAGGGAGGGCATCAGG + Intronic
1152923847 17:83079002-83079024 CCGGGAGGAGGGAGGGAAGCCGG + Intergenic
1153077842 18:1185707-1185729 CTGGGGAAAGGGAGAGCATCAGG + Intergenic
1153078425 18:1192609-1192631 GTGGGAGGAGGGAGGGGATCAGG + Intergenic
1153120674 18:1722813-1722835 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1153351975 18:4091097-4091119 GTGGGGGTAGGGAGAGCATCAGG + Intronic
1153565166 18:6412124-6412146 ATGGGAGGAGGGAGGGGATCAGG - Intronic
1153589370 18:6657161-6657183 GTGGGAGGAGGGAGGGGATCAGG + Intergenic
1153683315 18:7521745-7521767 CTGGGGGTAGGGGAGGAACCGGG - Intergenic
1153879087 18:9404883-9404905 CTAGGGGAAGGGAGAGAATGAGG + Intergenic
1153970897 18:10226145-10226167 TTGGGGGAGGGGAGGAAATCTGG - Intergenic
1154302790 18:13209077-13209099 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1156198467 18:34803131-34803153 CTGGGGGTATGCAGGGATTTAGG - Intronic
1156700408 18:39818147-39818169 GTGGGGGTAGGGATAGCATCAGG + Intergenic
1156820183 18:41363031-41363053 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1157144212 18:45144755-45144777 CTGGGAGAAGGTAGGGAATGGGG - Intergenic
1157190937 18:45581046-45581068 CATGGGGAAGGGAGGGAATGTGG + Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157792886 18:50548723-50548745 TTGTGGGTAGGAGGGGAATCTGG - Intergenic
1159544397 18:69820904-69820926 GTGGGAGAAGGGAGGGGATCGGG + Intronic
1159906481 18:74097240-74097262 CTTGGGGGAGGGTGTGAATCCGG + Intronic
1160064873 18:75565250-75565272 GTGGGGGCATGGGGGGAATCAGG + Intergenic
1161041618 19:2113497-2113519 CTGGGGGCAGCGAGGGCAGCTGG - Intronic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161537879 19:4831294-4831316 CTGGGTGTTGGGGAGGAATCTGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162134091 19:8544581-8544603 TTGGGGGTGGGGAGGGCACCAGG + Intronic
1162199860 19:9012028-9012050 CTGGGAGGGGGCAGGGAATCAGG + Intergenic
1162758556 19:12874678-12874700 CTGGGGCTAGGGAGGGTGTCTGG - Exonic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163371896 19:16905787-16905809 CTGGGGGTAGGGGTGGAGTGGGG + Intronic
1163767757 19:19172718-19172740 CTGGGAGAGGGGAGAGAATCTGG - Intronic
1164768438 19:30789445-30789467 ATGGGGGTAGGGTGGAAATTTGG + Intergenic
1165060667 19:33203833-33203855 CTTGGGGAGGGGAGTGAATCAGG + Intronic
1165229417 19:34377603-34377625 CTTGGGGTAGGGTGGGAGTCTGG + Intronic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165382987 19:35494273-35494295 CTGGGTCTAGGGAGGGAGTGGGG + Intronic
1165425839 19:35745011-35745033 CGGGCGGTGGGGAGGGACTCAGG + Intronic
1165444163 19:35847893-35847915 CTGAGGTTTGGCAGGGAATCAGG - Intronic
1165643193 19:37407844-37407866 CTGGGGGGAGGGATGGAGTGGGG - Intergenic
1165749305 19:38250644-38250666 CTGGGGGTGGTGAAGAAATCTGG - Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166317763 19:41998495-41998517 CTGGAGGTGGGGAGGGCCTCTGG - Exonic
1166338437 19:42122670-42122692 CTGGGGGTAAGGGGGGAATTTGG - Intronic
1166764566 19:45245198-45245220 CTGGGGGCAAAGAGAGAATCTGG - Intronic
1167120614 19:47514460-47514482 CTGGGGGGACGGAGGGAGTCCGG - Intronic
1167173387 19:47848815-47848837 CTGGGGGAAGGGAGGGTGTTTGG - Intergenic
1167197474 19:48040556-48040578 CCGGGGTTAGGGAAGGGATCAGG - Intronic
1167377535 19:49119801-49119823 CTGGGATGAGGAAGGGAATCCGG - Intronic
1167424295 19:49422146-49422168 ATGGGGGTAGGGAGGGACAGGGG + Intergenic
1167594480 19:50419785-50419807 CAGGGGGTAGTGGGGGAGTCCGG + Intronic
1167721754 19:51184544-51184566 CTCGGCATGGGGAGGGAATCTGG + Intergenic
1168278428 19:55289882-55289904 CTGGGGGCAGGAGGGGAATGGGG - Intronic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168443186 19:56389532-56389554 TTGGGCGGAGGGAGAGAATCAGG + Intronic
925024622 2:598045-598067 GTGGGGGGAAGGAGGGCATCAGG + Intergenic
925203531 2:1988151-1988173 CTGGCGGGAGGGTGGGAATGTGG - Intronic
925508893 2:4602687-4602709 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926152254 2:10431930-10431952 CACGGGGTGGGGAGGGAGTCAGG - Intergenic
926425236 2:12733878-12733900 ATGGGGGTGGGGGGAGAATCGGG + Intronic
926515058 2:13832985-13833007 GTGGGGGGAGGGAGAGAATGAGG + Intergenic
926702097 2:15810674-15810696 CTGGGGGGAGTGAGGGGATGGGG - Intergenic
926705869 2:15837054-15837076 CTGGAGGGAGGGAGGGAATGGGG + Intergenic
927265934 2:21151224-21151246 GTGGGGGAAGGGAGGGCATTGGG - Intergenic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
928230815 2:29497378-29497400 CCGGTGGTAGGGAGGGAGCCAGG - Intronic
928245645 2:29624600-29624622 ATGGGGGGAGGGAGAGCATCAGG + Intronic
928285162 2:29983982-29984004 GTGGGGGGAGGGAGAGAATCAGG - Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928697600 2:33865490-33865512 TGGGGGGAAGGGAGGGAAACAGG + Intergenic
929367448 2:41177182-41177204 GTGGGGGTAGGGAGACCATCAGG - Intergenic
929565206 2:42979612-42979634 GTGGAGGTGGGGTGGGAATCTGG + Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932269201 2:70394450-70394472 CAGGGGGAAGGGAGAGCATCAGG - Intergenic
932361738 2:71114193-71114215 GTGGGGGAAGGGAGAGCATCAGG + Intronic
933064427 2:77776417-77776439 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
933225191 2:79740145-79740167 TTGGGAGGAGGGAGAGAATCAGG - Intronic
933758876 2:85661194-85661216 CGGGGGGTTGGGGGGGAAGCTGG + Intronic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
934107241 2:88706560-88706582 GTGGGGGGAGGGAGAGCATCAGG + Intronic
934127208 2:88907368-88907390 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
934514693 2:94979202-94979224 GTGGGAGGAGGGAGGGAATCAGG + Intergenic
934767042 2:96885476-96885498 CTGAGGACAGGGAGGGAATGTGG + Intronic
934792526 2:97073910-97073932 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
934814093 2:97309771-97309793 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
934823602 2:97398710-97398732 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935517781 2:104064395-104064417 CTGGGGGTAGGGAGTAAAGTGGG + Intergenic
935571135 2:104661128-104661150 CTGGGAGGGTGGAGGGAATCAGG - Intergenic
935609839 2:105010822-105010844 GTGGTGGCAGGGAGGGTATCTGG - Intergenic
935654826 2:105413100-105413122 CTGGTGGAAGGGATGGAACCAGG - Intronic
935710865 2:105896940-105896962 CTGGGGGTAGGGGGGAACACAGG - Intergenic
935888523 2:107649786-107649808 CTGGGAGGAGGGAGAGAATTAGG + Intergenic
935890215 2:107668781-107668803 GTGAGGGTAGGGAGAGCATCAGG + Intergenic
935923099 2:108036109-108036131 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
936095628 2:109528576-109528598 GTGGGAGAAGGGAAGGAATCAGG + Intergenic
936728574 2:115354321-115354343 GAGGGGGTAGGGAGGGAATGTGG - Intronic
937028560 2:118719301-118719323 GTGGGGGAAAGAAGGGAATCAGG - Intergenic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937647727 2:124284465-124284487 ATGGGGGAAGGGAGAGCATCAGG + Intronic
938026468 2:127953385-127953407 CTGGGAACAGGGATGGAATCGGG - Intronic
938247237 2:129787520-129787542 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
939121673 2:138125009-138125031 CTGGGTGCAGGAAGGGGATCTGG - Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
940022937 2:149174795-149174817 GTGGGAGGAGGGAGAGAATCAGG + Intronic
940618739 2:156084114-156084136 CTTGGGGGAGGGTGTGAATCTGG - Intergenic
940839412 2:158561907-158561929 CTGGGGGGAGGGATGGCATTGGG - Intronic
940862063 2:158781050-158781072 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
941743522 2:169061879-169061901 ATGGGAGGAGGGAGAGAATCAGG + Intergenic
941842598 2:170103024-170103046 CTGGGGGGAGGGAGAGCATCAGG - Intergenic
941859781 2:170267143-170267165 CTGGGGGTAGGGTGGGAATTGGG + Intronic
943028957 2:182663683-182663705 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
943281035 2:185933154-185933176 CAGGGGGAAGGGAGGGAGTGGGG + Intergenic
943552747 2:189360755-189360777 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
944163029 2:196686745-196686767 GTGGGTGGAGGGAGAGAATCAGG - Intronic
944315505 2:198281230-198281252 CTGGGGAGAGGGAGGAAATAGGG - Intronic
944845098 2:203660126-203660148 GTGGGGGTGGGGTGGGAATGGGG + Intergenic
945158105 2:206860354-206860376 GTGGGGGGAGGGAGGACATCAGG - Intergenic
945431330 2:209769654-209769676 CTGGGAGTAGGGAGAGGATCAGG - Intergenic
945441456 2:209884905-209884927 GTGGGGGTTGGGAGAGCATCGGG + Intronic
945608969 2:211974091-211974113 GTGGGAGGAGGGAGAGAATCAGG + Intronic
946408942 2:219507018-219507040 CTGGGGGTGGGGGCGGAAGCGGG + Intergenic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
946452852 2:219795797-219795819 CTGGGTCCAGGGAGGGGATCAGG + Intergenic
946721669 2:222615464-222615486 TTGAGGGTAGAGAGGGAGTCAGG - Intronic
946884536 2:224209991-224210013 CTGGGGGTAGGGATTTATTCCGG + Intergenic
946996020 2:225392325-225392347 GTGGGGGTAGGGAGAGCATTAGG + Intergenic
947384316 2:229576074-229576096 GTGGGGGTAGGGAGTGTAGCGGG - Intronic
947408469 2:229807639-229807661 GTGGGTGTAGGGATGGAATGGGG - Intronic
947474888 2:230435699-230435721 CTGGGAGGAGGGAGAGGATCAGG - Intronic
947571517 2:231239149-231239171 GTGGGGGAAGGGTGGGATTCAGG + Intronic
947957745 2:234208728-234208750 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
947969755 2:234313270-234313292 CAGGGAGAAGGGAGGGGATCAGG - Intergenic
948010171 2:234645930-234645952 GTGGGAGTAGGGAGGCAGTCGGG - Intergenic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
948124791 2:235556551-235556573 CTTGGGGGAGGGAAGGCATCAGG + Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948669240 2:239556578-239556600 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1169465838 20:5837442-5837464 GTGGGGGGAGGGAGAGCATCAGG - Intronic
1170042033 20:12049133-12049155 CTTGGGGTAGGGAGGAAATGGGG + Intergenic
1170128867 20:12997230-12997252 CTGGGAGTGGAGAGGGCATCTGG + Intergenic
1170162562 20:13328809-13328831 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1172367807 20:34363381-34363403 CTCGGGAGAGGGAGGGAGTCCGG + Intronic
1172482132 20:35277493-35277515 CTGGGTGTAGGCTGGGAAGCAGG + Intergenic
1172649528 20:36493035-36493057 CTGTGGGTAGGGTGGGGATGGGG - Intronic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1173014921 20:39216284-39216306 ATGGGTGTGGGGATGGAATCGGG - Intergenic
1173082299 20:39879900-39879922 GTGGGAGAAGGGAGAGAATCAGG - Intergenic
1173121187 20:40290958-40290980 CTGGGGGTAGGGGTGGGATCAGG - Intergenic
1173202590 20:40965179-40965201 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1173759617 20:45547974-45547996 CAGGGTGTAGGGGAGGAATCAGG + Intergenic
1173857579 20:46260556-46260578 CTGGGGCCTGGGAGGGACTCAGG + Intronic
1174108713 20:48182828-48182850 CTAGGGGCAGGGAGGGAGTGAGG - Intergenic
1174538563 20:51271682-51271704 GTGGGGGGAGGGAGAGGATCAGG + Intergenic
1174832254 20:53823604-53823626 CTGGGGGTAAGAATGGAATCAGG + Intergenic
1175172429 20:57090039-57090061 CTGGGGGTGGGGAGGTTGTCAGG - Intergenic
1175237729 20:57525634-57525656 CTGGGGGGAGGGGTGGAATGAGG + Intronic
1175237932 20:57526180-57526202 CTGGGGGGAGGGGTGGAATGAGG + Intergenic
1175237994 20:57526349-57526371 CTGGGGGGAGGGGTGGAATGAGG + Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175424874 20:58856912-58856934 CTGGGGGGAGGGTGGGGAACTGG - Intronic
1175572692 20:60036379-60036401 CTGGGGGAAGGGTGGCAATGGGG - Intergenic
1175843587 20:62047280-62047302 CTCGGGGTAAGGAGGGAGCCTGG - Intronic
1175845042 20:62053739-62053761 CTGGGGGCAGGGTGGGATACGGG - Intronic
1176949070 21:15022394-15022416 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1177864899 21:26500666-26500688 CTGGGGGTGGGGAGGACTTCTGG + Intronic
1177971328 21:27793487-27793509 ATGGGGGTAGGGAGAGCATCAGG + Intergenic
1178473169 21:32913301-32913323 TTGGGGGTAGGGAGAGCATTAGG - Intergenic
1178794931 21:35735119-35735141 CTGGGGACAGGGATGGGATCTGG + Intronic
1178884610 21:36475426-36475448 CTGGAGGTAGCCAGGGCATCCGG - Intronic
1179055927 21:37934081-37934103 CTGGGAGGAGGGAGAGCATCAGG - Intergenic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179106035 21:38401665-38401687 CTCGGGCTAGGGAGGGAGACGGG - Intronic
1179238259 21:39566282-39566304 CTGGGGCCCGGGAGGGGATCCGG - Intronic
1179296511 21:40067720-40067742 ATGAGGGGAGGGAGGGAATGAGG - Intronic
1179314198 21:40226880-40226902 GTGGGAGGAGGGAGAGAATCAGG - Intronic
1179471383 21:41612995-41613017 CAGAGGGCAGGGAAGGAATCTGG - Intergenic
1179486820 21:41715855-41715877 CTGGGGGTAGGGAGTGGGGCAGG + Intergenic
1179498508 21:41790813-41790835 ATGGGGGAGGGGAGGGAATGGGG + Intergenic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179902985 21:44403288-44403310 CTGGGGCTAGGGAGGGTGTGGGG + Intronic
1180202411 21:46232559-46232581 CAGGGGTTGGGGAGGGAATGGGG + Intergenic
1180764370 22:18234979-18235001 CTGGGAGTGGGGAGGGACTGGGG + Intergenic
1180771269 22:18389562-18389584 CTGGGAGTGGGGAGGGACTGGGG - Intergenic
1180802656 22:18639177-18639199 CTGGGAGTGGGGAGGGACTGGGG - Intergenic
1180853893 22:19034733-19034755 CTGGGAGTGGGGAGGGACTGGGG - Intergenic
1181219065 22:21356084-21356106 CTGGGAGTGGGGAGGGACTGGGG + Intergenic
1181387705 22:22557879-22557901 CTGGGGGTGGGGAGGAGATGGGG + Intronic
1181532982 22:23527649-23527671 CTGGGTGGAGGGAGGGAGTGAGG + Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181865906 22:25855081-25855103 ATGGGAGGAGGGAGAGAATCAGG - Intronic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182093162 22:27609599-27609621 CTGGGGGAAGGGACGGGAGCGGG - Intergenic
1183214150 22:36468239-36468261 CTGGGGGCAGGGAGGAGCTCAGG + Intronic
1183377802 22:37475150-37475172 CTGGGGGTACAGGGAGAATCAGG + Intronic
1183481721 22:38068971-38068993 CTGGGGGCAGGGATGGCCTCTGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184743442 22:46442480-46442502 CTGGGGGCAGGGAGGGGCCCTGG - Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185214473 22:49590561-49590583 CTCGGGGTAGGGAAGGAGCCTGG + Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1203233109 22_KI270731v1_random:130553-130575 CTGGGAGTGGGGAGGGACTGGGG - Intergenic
949458463 3:4264298-4264320 CTGGAGCTAATGAGGGAATCTGG + Intronic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950556368 3:13698627-13698649 CTGGGGGCGGGGAGGGAGTGTGG - Intergenic
950692229 3:14668972-14668994 CTAGGGGTAGGCAGGGAGACTGG + Intronic
951202428 3:19890261-19890283 CTTGGGGGAGGGAGGGATTAAGG - Intronic
951515637 3:23556014-23556036 ATGGGGGTGGGGAGGGAAATGGG + Intronic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
951742789 3:25942785-25942807 CTGGTGGGAGGGAGGTAAACTGG - Intergenic
951897126 3:27620231-27620253 GTGGGGGGAGGGAGGACATCAGG - Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953779776 3:45857375-45857397 TTGGGGGCAGGGAGAGCATCAGG + Intronic
954177732 3:48857863-48857885 GTGGGGTTAGGGAGGGGCTCTGG - Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954419909 3:50413240-50413262 CTGGGGGCAGTCAGGGTATCTGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954708774 3:52494869-52494891 CTGGGGCTAGTGAGGGGATGTGG + Intergenic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
955065304 3:55528878-55528900 CTGGGGGTGGGGAGGGATATGGG + Intronic
955740523 3:62086380-62086402 CTGGGGTTAGGGTGGGAATTTGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
955915316 3:63901971-63901993 CGGGGGTTGGGGAGGGAATGTGG + Intronic
956067135 3:65408790-65408812 CTGAGGGTAGGAAGGAAAACAGG + Intronic
956155630 3:66293520-66293542 CTGGGAGGAGGGAGAGGATCAGG - Intronic
956186578 3:66568342-66568364 TTGGGGGAAGGGAGAGCATCAGG - Intergenic
956373825 3:68592664-68592686 GTGGGGGGAGGGAGAGAATTAGG - Intergenic
956600891 3:71021194-71021216 CTGGGAGTTGGGAGGAAATGGGG - Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958793081 3:98674720-98674742 CTGGGAGGAGGGAGACAATCAGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959519634 3:107310620-107310642 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959997208 3:112693136-112693158 CTGGGGGGAGGGTGCAAATCCGG + Intergenic
960177990 3:114540043-114540065 ATGGGAGGAGGGAGAGAATCAGG - Intronic
960384617 3:117007155-117007177 GTGGAGGGAGGGAGGGCATCAGG - Intronic
960428908 3:117544782-117544804 TTGGGGGAAGGGAGAGCATCAGG + Intergenic
961501738 3:127341030-127341052 CTGGGGGTGAGGTGAGAATCTGG + Intergenic
961990368 3:131183421-131183443 CCAGGGGGAGGGAGAGAATCAGG - Intronic
962361648 3:134748114-134748136 GTGGGGGTAGGGTGGGAGTTAGG + Intronic
962378640 3:134879098-134879120 CTGGGTGCAGGAAGGGAGTCAGG - Intronic
962608458 3:137052089-137052111 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
962609463 3:137062024-137062046 CTGGGGGCGGGGAGGGGATGGGG + Intergenic
962931137 3:140037683-140037705 GTCGGGGTAGGGAGAGCATCAGG - Intronic
963071425 3:141308446-141308468 ATGGGGGAAGAGAGGGAAACTGG - Intergenic
963296103 3:143548300-143548322 GTGGGGGTGGTGAGGGAATGTGG + Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963639222 3:147838117-147838139 TTGAGGGGAGGGAGGGCATCAGG - Intergenic
964243013 3:154617674-154617696 GTAGGGGTAGGGAGAGCATCAGG + Intergenic
964507959 3:157420184-157420206 CTGGGGGGAGGGAAAGTATCAGG + Intronic
964571584 3:158112780-158112802 ATGGGGGAAGGGAGAGCATCAGG - Intronic
965256362 3:166418605-166418627 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
965548255 3:169937390-169937412 ATGGGGGGAGGGAGAGCATCAGG - Intronic
965714815 3:171591590-171591612 ATGGGGGGAGGGAGGGCGTCAGG - Intergenic
965733042 3:171792567-171792589 CTGGGGCTGGGCAGGGAAACAGG - Intronic
966440849 3:179942580-179942602 CTGGGTCGAGAGAGGGAATCCGG - Intronic
966540993 3:181089645-181089667 ATTGGGGTAGAGAAGGAATCTGG - Intergenic
966566696 3:181390636-181390658 CTGAGGGGAGGGAGAGCATCAGG - Intergenic
966893593 3:184426107-184426129 CTGGGGGTGGGGTGGGAGTAGGG + Intronic
966992066 3:185242845-185242867 CTCGGGGGAGGGTGGGAATCTGG - Intronic
967131581 3:186475955-186475977 CTGGGGACAGGTAGGCAATCTGG + Intergenic
967157183 3:186704141-186704163 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
967209024 3:187150294-187150316 CTCAGGGGAGGGCGGGAATCTGG + Intronic
967528658 3:190523501-190523523 GTGGGAGGAGGGAGAGAATCAGG - Intronic
968448446 4:663974-663996 CGGCGGGCAGGGACGGAATCCGG - Intronic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
969594286 4:8140107-8140129 GTGGGGGGAGGGAGAGCATCAGG + Intronic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969781587 4:9408693-9408715 CTCGGGGGAGGGCGTGAATCCGG + Intergenic
969848585 4:9938907-9938929 CTGGGGGTGGGGATGGAGTGGGG + Intronic
970030090 4:11664368-11664390 CTGGGAGGAGGGAGAGCATCAGG + Intergenic
970117599 4:12716535-12716557 ATGGGAGGAGGGAGAGAATCAGG + Intergenic
970797796 4:19935060-19935082 CTGGGGGAAGGAAGGGAATGAGG + Intergenic
970869366 4:20797752-20797774 CTGTGGGTCGGCAGGGAATTAGG + Intronic
971323799 4:25627591-25627613 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
971396478 4:26232381-26232403 CTGGGAGGAGGGAGAGTATCAGG - Intronic
971646661 4:29215465-29215487 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
971703202 4:30007270-30007292 GTGGGAGGAGGGAGGAAATCAGG + Intergenic
972151208 4:36093215-36093237 GTGGGGGGAAGGAGAGAATCAGG + Intronic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972679447 4:41291305-41291327 CTGGGGGAGGGAAGGGAATTGGG - Intergenic
972830410 4:42808306-42808328 CTGGGAGAAGAGAGAGAATCAGG - Intergenic
972852863 4:43072061-43072083 CTGGGGGTGGGTAGGGAGTTAGG + Intergenic
972910690 4:43812827-43812849 TTGGGAGGAGGGAGAGAATCAGG + Intergenic
973554300 4:52066641-52066663 TTGGGGGAAGGGAGAGCATCAGG - Intronic
973561199 4:52137910-52137932 TTGGGAGGAGGGAGAGAATCAGG + Intergenic
973728037 4:53795482-53795504 GTGGGGGGAGGGAGAGCATCAGG + Intronic
973919150 4:55667126-55667148 CTGGGGGGCAGGAGGGAATGGGG - Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
974706721 4:65527823-65527845 ATGGGAGGAGGGAGAGAATCAGG - Intronic
974715801 4:65668727-65668749 TTGGGGGTAGGGAGGGGGACTGG + Intronic
974920687 4:68235475-68235497 GTGGTGGTAGGGAGGGATGCAGG - Intronic
975215726 4:71751739-71751761 AGGGGAGTAGGGAGGGAAACTGG + Intronic
975425619 4:74223477-74223499 TTGGGAGGAGGGAGGGAATTAGG + Intronic
975472149 4:74782248-74782270 CGGGGGATAGGGAGAGCATCAGG - Intronic
975976878 4:80108440-80108462 ATGGGGGAAGGGAGAGCATCAGG + Intronic
976396073 4:84557019-84557041 GTGGGGAAAGGGAGAGAATCAGG + Intergenic
977183646 4:93909427-93909449 TTGGGAGGAGGGAGAGAATCAGG - Intergenic
977475587 4:97504422-97504444 CTTGTGGTAGGGAGAGAATGTGG + Intronic
977492665 4:97734399-97734421 TTGGGAGGAGGGAGAGAATCAGG - Intronic
977735323 4:100408276-100408298 TTGGAGGTAAGGAGGCAATCTGG + Intronic
977852539 4:101847843-101847865 CTCAGGGGAGGGAGCGAATCCGG - Intronic
977980446 4:103314704-103314726 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
978619039 4:110621557-110621579 CTGGGGGAGGGGAGGAAATGGGG - Intronic
978747792 4:112213314-112213336 CTGGGGGTGGGGCGGGAGCCAGG - Intergenic
979141158 4:117176553-117176575 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
979279782 4:118852728-118852750 GTGGGAGGAGGGAGAGAATCAGG + Intronic
980021595 4:127717131-127717153 GTGGGGGTAGGGAGAGTATTAGG - Exonic
980147601 4:129008794-129008816 CTGGGAGGAGGGAGAGGATCAGG - Intronic
980524077 4:133966801-133966823 TTGGGGGTAGGGTGGGAGTGGGG + Intergenic
980649092 4:135686878-135686900 GTGGGGGTTGGGAGAGCATCAGG + Intergenic
980969426 4:139555662-139555684 CTGGCGGCCGGGAGGGGATCGGG + Intronic
981081244 4:140641617-140641639 ATGGGGGTGGGGAGGAACTCGGG + Intronic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981289602 4:143058914-143058936 TTGGGAGGAGGGAGAGAATCAGG - Intergenic
981919203 4:150068338-150068360 CTGGGGCAAGGGAGGCATTCAGG + Intergenic
981955296 4:150465050-150465072 CTGGGGTGAGGGAGAGAATGAGG - Intronic
982213646 4:153061478-153061500 GTGGGAGGAGGGAGGGCATCAGG + Intergenic
983118045 4:163844108-163844130 GTTGGGGTAGGGAGAGGATCAGG - Intronic
983232946 4:165147584-165147606 GTGGGAGGAGGGAGAGAATCTGG - Intronic
983315593 4:166129073-166129095 GTGGGGAGAGGGAGAGAATCAGG - Intergenic
983462534 4:168046481-168046503 GTGGGGGTAGGGAGGGAGAGAGG - Intergenic
983764666 4:171463708-171463730 GTAGGGGGAGGGAGGGGATCAGG + Intergenic
983971849 4:173885223-173885245 GTGAGGGGAGGGAGAGAATCAGG - Intergenic
984979929 4:185270678-185270700 CTGGAGGGAGGGAAGGAATGGGG - Intronic
985132027 4:186748426-186748448 GTGGGAGGAGGGAGGGGATCAGG - Intergenic
985180296 4:187253352-187253374 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985932683 5:3071086-3071108 ATGGGAGGAGGGAGAGAATCAGG - Intergenic
986011284 5:3718059-3718081 GTGGGAGGAGGGAGGGGATCAGG - Intergenic
986377741 5:7149558-7149580 CTGGGGGTGGGGAGAGACTGGGG - Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987381254 5:17288006-17288028 ATGAGAGGAGGGAGGGAATCTGG - Intergenic
987639517 5:20594806-20594828 TTGGGAGTAGGGAGAGCATCAGG - Intergenic
988515049 5:31897051-31897073 CTGGATGTAGGGTGGGGATCTGG + Intronic
988537371 5:32080930-32080952 GTGGGGGGAGGGAGAGCATCAGG + Intronic
988736832 5:34030943-34030965 GTGGGAGGAGGGAGAGAATCAGG + Intronic
989085693 5:37673749-37673771 ATGGGTGAAGGGAGAGAATCGGG - Intronic
989126937 5:38063886-38063908 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
989547363 5:42690081-42690103 CTGGGGGTTGGGTGGAAAACAGG - Intronic
990630064 5:57659016-57659038 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
990779444 5:59343084-59343106 GTGGGAGAAGGGAGAGAATCAGG - Intronic
990900670 5:60745178-60745200 CTGGGAGAAGGGAGAGGATCAGG - Intergenic
992021401 5:72628191-72628213 GTGAGGGGAGGGAGGGGATCAGG + Intergenic
992185674 5:74242106-74242128 CTGGGGGTAGGTGGGAAATGGGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993359760 5:86959753-86959775 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
993686730 5:90946595-90946617 GTGGGGGGAGGGAGAGCATCAGG - Intronic
993840693 5:92875596-92875618 CTGGGGGTAGGGGAGATATCAGG + Intergenic
993995683 5:94719681-94719703 ATGTGGGGAGGGAGGGCATCAGG + Intronic
994423060 5:99546723-99546745 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
994841098 5:104926068-104926090 GTGGTGGTAGGGAGAGCATCAGG - Intergenic
996159693 5:120147189-120147211 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
996696037 5:126396308-126396330 GTGGGAGTAGGGAGAGGATCAGG - Intronic
997032541 5:130147985-130148007 GTGGGAGGAGGGAGGGGATCAGG - Intronic
997235858 5:132271625-132271647 CAGGGGGTGGAGAGGGAATCGGG - Intronic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997320685 5:132975948-132975970 TTGGGAGTAGGGAGGTAATGAGG + Intergenic
997582713 5:135027656-135027678 CTGTGGGTAGAAAGGGAACCGGG - Intergenic
997660458 5:135585397-135585419 CTGGGGCTAGGACGGGAGTCAGG - Intergenic
997690215 5:135823136-135823158 CAGGGGCTAGGGTGGGAGTCGGG + Intergenic
997829136 5:137133951-137133973 CTGGGGGTGGGGGGGGTAGCGGG + Intronic
998051178 5:139036704-139036726 ATGGGAATAGGGAGGGGATCAGG + Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
999195162 5:149776944-149776966 CTGAGGGTGGGGAAGGACTCGGG - Intronic
999480115 5:151940548-151940570 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1000034476 5:157434204-157434226 CTGGAGGTAGGGACTGGATCAGG - Intronic
1000125468 5:158239547-158239569 CTGGGGGTGGGGAAGGACTGGGG - Intergenic
1000372627 5:160551741-160551763 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001168739 5:169395957-169395979 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003123623 6:3337980-3338002 GTGGGAGAAGGGAGGGAGTCTGG - Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003923455 6:10855495-10855517 CTTGGGGGAGGGCGGGAAGCAGG + Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004201369 6:13551194-13551216 CTGGGGAGAGGGCGGGAATAAGG + Intergenic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004949219 6:20649705-20649727 GTGGGGGAAGGGAGAGCATCAGG - Intronic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005919212 6:30383929-30383951 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1005994786 6:30924501-30924523 CTGGGGGCAGGGGGGCAACCAGG - Exonic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006463619 6:34177928-34177950 TTGGGGGTAGGTAAGGAATTGGG + Intergenic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006650388 6:35546183-35546205 CTGTGGGGAGGGAGAGCATCAGG + Intergenic
1006750610 6:36374459-36374481 CTGTGGGTAGAGAGCCAATCTGG + Intronic
1007050965 6:38828884-38828906 CTGGGGCAAGAGAGAGAATCAGG - Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007810103 6:44479630-44479652 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1007913022 6:45535102-45535124 CTGGGAGGAGGGAGAGGATCAGG + Intronic
1008345780 6:50424548-50424570 CCTGGGGTAGGGAGAGCATCAGG + Intergenic
1008598501 6:53065867-53065889 CTGGGGGTCGGCGGGGACTCTGG + Intronic
1009279451 6:61728297-61728319 GTGGAGGGAGGGAGGGCATCAGG + Intronic
1010067354 6:71699546-71699568 ATGGGAGAAGGGAGAGAATCAGG - Intergenic
1010346163 6:74813480-74813502 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1011600338 6:89054038-89054060 CTGGGGGAAGGGAGACAATGGGG - Intergenic
1012203719 6:96436464-96436486 CTTGGGGGAGGGAATGAATCAGG + Intergenic
1012243642 6:96901714-96901736 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1013235522 6:108194987-108195009 CTGGAGGTAGGGAGGGCCTGGGG + Intergenic
1013881058 6:114901451-114901473 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1014218560 6:118777093-118777115 CTGGGGCTGGGGAGGGCATGGGG + Intergenic
1014315305 6:119857072-119857094 CTTGGGGGAGGGAGAGCATCAGG + Intergenic
1014386168 6:120804983-120805005 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
1015184834 6:130403804-130403826 GTGGGAGAAGGGAGAGAATCAGG - Intronic
1015821955 6:137270928-137270950 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016265434 6:142227662-142227684 TTGGGGGTAGAGAGAGCATCAGG - Intergenic
1016614610 6:146030868-146030890 CTTGGGGGAGTGAGGGAATCTGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1017005772 6:150027291-150027313 CTGGGGGCAGTGTGGGACTCAGG - Intergenic
1017011196 6:150064855-150064877 CTGGGGGTAGGAAGGGAGAAGGG + Intronic
1017215473 6:151901422-151901444 CTTGGGGGAGGGAGTGAATTTGG - Intronic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1018009352 6:159655474-159655496 CTCGGGGGAGGGTGCGAATCTGG + Intergenic
1018182702 6:161238060-161238082 CTGGGGGTGGGGGGGTAATGGGG + Intronic
1018184073 6:161250202-161250224 GTGGGAGTAGGGAGAGGATCAGG + Intronic
1018558405 6:165074257-165074279 CTGGGAGGAGAGAGAGAATCAGG - Intergenic
1018814522 6:167320862-167320884 CTAAGGGAAGGGAGGGAGTCAGG - Intergenic
1019419796 7:945723-945745 CTGGGAGGAGGGAGGGAAAGAGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020015872 7:4831392-4831414 CTGGGAGGAGGGAGAGGATCAGG + Intronic
1020100541 7:5391936-5391958 CTGGGCTTAGGCAGAGAATCAGG - Intronic
1020439483 7:8201988-8202010 CTGGGGGTAGGCAGGGGACATGG - Intronic
1021245068 7:18251367-18251389 GTGGGGGGAGGGAGAGCATCAGG + Intronic
1021916453 7:25438173-25438195 CTGGGGGGAGGAAGAGCATCAGG - Intergenic
1023667088 7:42534821-42534843 TCTGGGGTAGGGAGGGCATCAGG + Intergenic
1023842343 7:44104521-44104543 ATGGGGTGAGCGAGGGAATCCGG - Exonic
1024479059 7:49845135-49845157 GTGGGGGAAGGGAGAGCATCAGG + Intronic
1026461769 7:70620857-70620879 CAAGGGGCAGGGAGGGAAACTGG + Intronic
1026618508 7:71929261-71929283 GTGGGAGGAGGGAGGGCATCAGG - Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027346080 7:77261252-77261274 ATGGGAGGAGGGAGAGAATCAGG - Intronic
1028168956 7:87572906-87572928 GTGGGGGGAGGGAGAGAATCAGG + Intronic
1028306829 7:89276176-89276198 GTGAGGGTAGGGAGAGCATCAGG + Intronic
1028444912 7:90910913-90910935 GTGGGGGAAGGGAGAGGATCAGG - Intronic
1028481437 7:91310634-91310656 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1028695700 7:93708623-93708645 CGGGGGGAAGGGAGAGAATCAGG + Intronic
1028858442 7:95618846-95618868 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1028913401 7:96232452-96232474 GTGGGAGGAGGGAGAGAATCAGG + Intronic
1028960622 7:96745792-96745814 CTGCTGGTAGGGATGGAAACAGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029529330 7:101114813-101114835 CTGGGAGTAGTGGGGGCATCAGG + Intergenic
1029788587 7:102818932-102818954 GTGGGAGGAGGGAGAGAATCAGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030097263 7:105911371-105911393 CTGGGGGAAGGGGAGGAATGAGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030406495 7:109121275-109121297 GTGGGAGGAGGGAGGGGATCAGG - Intergenic
1030419002 7:109283756-109283778 TTGGGAGGAGGGAGAGAATCAGG - Intergenic
1030732473 7:113006305-113006327 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
1031124085 7:117753770-117753792 CTGGCGGGAGGGAGAGCATCAGG + Intronic
1031215040 7:118879555-118879577 CTGGCCTCAGGGAGGGAATCTGG + Intergenic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031927322 7:127651332-127651354 CTGGGGCTAGGGAAGGTATCCGG + Intergenic
1032081113 7:128858915-128858937 CTCGGGGTCAGGAGGGTATCTGG - Exonic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1032823953 7:135551201-135551223 CTGGGGGTAGGAATGGAGTGGGG + Intergenic
1033981349 7:147169999-147170021 TTGGGGGTAAGGAGGCACTCTGG + Intronic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034326781 7:150242783-150242805 GTGGTGGTAGGGAGGGGATTTGG + Intergenic
1034339031 7:150340697-150340719 CTGGGGGGAGGGTGGGGAGCGGG + Exonic
1034415759 7:150963568-150963590 CTGGGGCTGGGGTGGGAATGGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034766425 7:153726482-153726504 GTGGTGGTAGGGAGGGGATTTGG - Intergenic
1034829344 7:154295664-154295686 CTGAGGGTAGGGAGGGGAAGGGG - Intronic
1035076391 7:156180370-156180392 CCCAGGGTAGAGAGGGAATCAGG + Intergenic
1035135776 7:156701772-156701794 GTCGGGGGAGGGAGAGAATCAGG - Intronic
1035493133 7:159297244-159297266 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1035543815 8:463437-463459 CTGGGGGCCAGCAGGGAATCTGG - Intronic
1035607316 8:938520-938542 GTGGGGGTAGGGAAGGGATCTGG + Intergenic
1036032136 8:4985520-4985542 CTGGGGATAGGAAGAGAATTGGG - Intronic
1036837832 8:12090037-12090059 CTCGGGGGAGGGCGTGAATCAGG - Intergenic
1036859622 8:12336285-12336307 CTCGGGGGAGGGCGTGAATCAGG - Intergenic
1037222864 8:16546481-16546503 TTGGGGGTAGGGAGGAAATGGGG + Intronic
1037308829 8:17533896-17533918 CTGAGGGGAGGGAGAGCATCAGG - Intronic
1037558118 8:20046278-20046300 CTGGTGGGAGGGGGAGAATCAGG - Intergenic
1037575925 8:20202821-20202843 CTGGGGTGAGGGAGGGGATATGG - Intronic
1037844428 8:22270568-22270590 CTGGGGCTGGGGTGGGAATTAGG - Intergenic
1037977524 8:23224341-23224363 ACGGGGGTGGGGAGGGAATCAGG + Intronic
1038359801 8:26865255-26865277 CTTCGGGTAGGGAGGGAGTCCGG - Exonic
1038381314 8:27097147-27097169 CTGGGGGGAGGGAGAGCCTCAGG - Intergenic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1038989791 8:32855663-32855685 GTGGGGGCAGGGAGAGCATCAGG - Intergenic
1039028231 8:33281442-33281464 GTGGGAGAAGGGAGGGAATTCGG + Intergenic
1039571771 8:38592712-38592734 CTGGGGGGAGGGCGTGAATCTGG + Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1040588791 8:48769938-48769960 CCTGGGGTTGGGAGGGAATGAGG + Intergenic
1041345814 8:56896777-56896799 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1041364643 8:57089122-57089144 GTGGGGGGAGGGAGAGCATCTGG - Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042044411 8:64632410-64632432 CTGGGGAGAGGGAGGAAATGGGG + Intronic
1042189490 8:66171217-66171239 GTGGGAGGAGGGAGAGAATCAGG - Intronic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1043040734 8:75259344-75259366 CTTGGGGGAGGGTGTGAATCCGG + Intergenic
1043147532 8:76676831-76676853 CTGGAGGAGGGGAGGGATTCAGG + Intergenic
1043329975 8:79103622-79103644 GTGGGAGGAGGGAGGGGATCAGG + Intergenic
1043558563 8:81463241-81463263 ATGGGGGGAGGGAGAGCATCAGG + Intergenic
1044065409 8:87692949-87692971 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1044794365 8:95881615-95881637 TTGGGGGTAGGGAGGAAAAAGGG + Intergenic
1044944514 8:97378142-97378164 CTGGGGGGAGGGAGAACATCAGG - Intergenic
1046064255 8:109177618-109177640 GTGGGGGAATGGAGGGCATCAGG - Intergenic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047332568 8:123905221-123905243 TTGGGGGGAGGGAGAGTATCAGG - Intronic
1047362859 8:124184854-124184876 TTGGGGATAGGGTGGGAATAGGG - Intergenic
1047695689 8:127401457-127401479 TTGGGGGTAGGTCAGGAATCAGG - Intergenic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048017451 8:130510272-130510294 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
1048132777 8:131716154-131716176 GTGGGGGGAGGGAGAGCATCAGG + Intergenic
1048320826 8:133399123-133399145 ATGGGAGGAGGGAGGGGATCAGG - Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048484302 8:134832537-134832559 CTGGGGTTTGGGAGGTAATTTGG + Intergenic
1048620168 8:136123990-136124012 CTGAGGGGAGGGAGAGCATCAGG - Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1048916827 8:139192616-139192638 CATGGGGTAAGGAGGGAATGAGG + Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049418745 8:142507509-142507531 CTGGGGGCAGGGAGAGAGACGGG - Intronic
1049610741 8:143553634-143553656 CTGGGAGGAGGGAGGGAGGCCGG - Exonic
1050394412 9:5179852-5179874 CTGGGGGAAGGGAAAGTATCAGG + Intronic
1051029463 9:12657642-12657664 CTGGGGCAAGGGAGTGTATCTGG - Intergenic
1051290946 9:15545156-15545178 CAGGGGGCAGGGAGAGCATCAGG + Intergenic
1051313424 9:15802390-15802412 CTGGGAGGAGGGAGAGGATCAGG - Intronic
1051479960 9:17548986-17549008 CAGGGGGAAGGGAGAGCATCAGG + Intergenic
1051708048 9:19901272-19901294 CTGGGTGTAGGGGAGGACTCAGG + Intergenic
1052165365 9:25319775-25319797 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1052379571 9:27755529-27755551 TTGGGGGAAGGGAGAGCATCAGG + Intergenic
1052590128 9:30481270-30481292 CTGGGAGGAGAGAGAGAATCAGG - Intergenic
1052885587 9:33644669-33644691 GTGGGGGGAGGGAGGGCATTAGG + Intergenic
1052926299 9:34019506-34019528 CTGGGGGTAGGGGAAGAATGGGG + Intronic
1052981224 9:34451181-34451203 CTGGCTGCAGGGAGGGACTCTGG - Intronic
1052982258 9:34458134-34458156 TGAGGGGGAGGGAGGGAATCAGG - Intronic
1052990823 9:34518531-34518553 TTGAGGGGAGGGAGGGAGTCGGG + Intronic
1053036153 9:34828072-34828094 CAGGAGGTAGAGAGGGATTCTGG - Intergenic
1053354946 9:37437659-37437681 CTGGGGGCAGGGAGGGGCTGGGG - Intergenic
1053531258 9:38883863-38883885 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1053575479 9:39354919-39354941 CCGGTGGTAGGGAGAGCATCAGG + Intergenic
1053839986 9:42182854-42182876 CTGGTGGTAGGGAGAGCATCAGG + Intergenic
1054097040 9:60913602-60913624 CCGGTGGTAGGGAGAGCATCAGG + Intergenic
1054118447 9:61189229-61189251 CCGGTGGTAGGGAGAGCATCAGG + Intergenic
1054203482 9:62108295-62108317 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1054589309 9:66993335-66993357 CCGGTGGTAGGGAGAGCATCAGG - Intergenic
1054634880 9:67480069-67480091 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1055234601 9:74105353-74105375 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1055307479 9:74944629-74944651 GTGGGAGGAGGGAGGAAATCAGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057794956 9:98148978-98149000 CTGGGGTTAAGGAGGGAATGGGG + Intronic
1057816708 9:98301220-98301242 CTGAGGGTAGGGTGGGGGTCAGG + Intronic
1058378387 9:104351710-104351732 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1058767128 9:108192467-108192489 CTGAGGGTGGGGAGAGAATCAGG - Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1058847487 9:108975335-108975357 GTGGGGGTAGGGGGGGCAACAGG + Intronic
1059064841 9:111072420-111072442 GTGGAGGTAGGGAGAGCATCAGG - Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059305541 9:113350422-113350444 GTGGGGGTAGGGAGAATATCAGG + Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059601636 9:115785010-115785032 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1059691266 9:116687704-116687726 GTGGGAGATGGGAGGGAATCAGG + Intronic
1060030132 9:120207527-120207549 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
1060472863 9:123963223-123963245 CGGGGGGTGGGCAGGGAATAAGG - Intergenic
1060880301 9:127113374-127113396 CTGGGGGGAGGGGAGGAATTGGG - Intronic
1061227863 9:129291192-129291214 CTAGGGGTGGGGAGGGATTCCGG - Intergenic
1061450790 9:130665995-130666017 CTGGGAGCAGAGAGGGACTCGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062391670 9:136336358-136336380 CTGGGGGTGTGGAGGGATTCGGG - Intronic
1062564920 9:137160048-137160070 ATGGGGGTGGGGAAGGGATCTGG - Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186138249 X:6543113-6543135 ATGGGGGGAGGGAGAAAATCAGG - Intergenic
1186237612 X:7530527-7530549 GTGGGAGGAGGGAGAGAATCAGG + Intergenic
1186301065 X:8200394-8200416 ATGGGGGGAGGGAGAGCATCAGG - Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186912625 X:14185203-14185225 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1186985678 X:15011253-15011275 GTGAGGGAAGGGAAGGAATCAGG + Intergenic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1187576133 X:20558210-20558232 GTTGGGGTAGAGAGGGAATGGGG - Intergenic
1187600219 X:20820962-20820984 CTGGGAGGAGGGAGAGGATCAGG + Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188140958 X:26550424-26550446 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1188761810 X:34041654-34041676 GTGGGGGTGGGGTGGGCATCTGG - Intergenic
1188874452 X:35412820-35412842 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1189075054 X:37905950-37905972 CTGGGGGTGGGGAGGGAGAGGGG + Intronic
1189682357 X:43529746-43529768 GTGGGGAAAGTGAGGGAATCTGG + Intergenic
1189925802 X:45953332-45953354 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1190123712 X:47684876-47684898 GTGGGGGAAGGGAGAGCATCAGG + Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190448867 X:50557762-50557784 CTCAGGGGAGGGAGCGAATCAGG + Intergenic
1190632179 X:52398837-52398859 CTTGGGGGAGGGTGTGAATCCGG - Intergenic
1191021521 X:55865962-55865984 GTGGGAGAAGGGAGAGAATCAGG + Intergenic
1191954073 X:66625174-66625196 CTTGGGGTAGGGCATGAATCTGG + Intronic
1192140127 X:68639706-68639728 CTGAGGGAAGGAAGGGACTCAGG + Intergenic
1192555487 X:72085815-72085837 CGGGTGGTAGGGAGGGAGTAGGG - Intergenic
1192615122 X:72612315-72612337 CTGGGGGAATGGAGGGATTGGGG + Intronic
1193159313 X:78209944-78209966 TTGGGGGGAGGGAGAGCATCAGG + Intergenic
1193565667 X:83073626-83073648 ATTGGGGTAGGGAGAGCATCAGG - Intergenic
1193613543 X:83660867-83660889 CTGGGAGGAGGGAGAGGATCAGG - Intergenic
1193799481 X:85917304-85917326 CTGGGAGGAGGGAGAGGATCAGG + Intronic
1193955695 X:87858972-87858994 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1194057623 X:89156108-89156130 TTGGGAGGAGGGAGAGAATCAGG + Intergenic
1194170470 X:90574756-90574778 TTGGGGGGAGGGAGAGCATCAGG + Intergenic
1194268753 X:91783528-91783550 CTGGTGGCAGGGAAGAAATCTGG + Intronic
1194299144 X:92163320-92163342 CTCAGGGTAGGGCGTGAATCTGG - Intronic
1194766950 X:97852459-97852481 GTGGGGGTAGGGTGGGAAGTTGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195507369 X:105673302-105673324 ATGGGGGTAGGGAGAGTATTAGG - Intronic
1195532825 X:105976594-105976616 GTGGGAGGAGGGAGAGAATCAGG - Intergenic
1195801142 X:108712347-108712369 TTGGGGGTAGTGGTGGAATCTGG - Intergenic
1196767691 X:119263438-119263460 ATGAGGGTAGGGAGGAAATGTGG - Intergenic
1196779719 X:119372926-119372948 TTGGGGGGAGGGAGAGCATCAGG + Intergenic
1196982029 X:121225112-121225134 GTGGGTGAAGGGAGAGAATCAGG - Intergenic
1197830857 X:130640763-130640785 CTGGGAGGAGGGAGAGCATCAGG + Intronic
1197982373 X:132230318-132230340 GTGGGGGTAGGGAGAGCATCAGG - Intergenic
1198322596 X:135533532-135533554 GTGGGGGAAGGGAGAGCATCAGG - Intronic
1198338915 X:135694413-135694435 GTGGGGGAAGGGAGAGCATCAGG - Intergenic
1198416018 X:136420453-136420475 GTGGGGGGAGGGAGAGGATCAGG + Intergenic
1198992039 X:142525844-142525866 GTAGGGGGAGGGAGGGTATCAGG - Intergenic
1199415498 X:147577866-147577888 AGGGGGTTGGGGAGGGAATCAGG + Intergenic
1199476198 X:148248119-148248141 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1199678075 X:150204830-150204852 CAGGGGGTGGGGAGGGAGCCTGG - Intergenic
1199930537 X:152514663-152514685 TTGGGAGGAGGGAGAGAATCAGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200141378 X:153904585-153904607 CTGGGGAAAGGAAGGGAAACAGG + Intronic
1200367978 X:155688023-155688045 GTGGGGGGAGGGAGAGCATCAGG - Intergenic
1200585955 Y:5004451-5004473 CTGGTGGCAGGGAAGCAATCTGG + Intronic
1200616748 Y:5388154-5388176 CTCAGGGTAGGGTGTGAATCTGG - Intronic
1200756337 Y:6993527-6993549 GTGGGGGGAGGGAGAGCATCAGG - Intronic
1201618379 Y:15927060-15927082 GTGGGGGGAGGGAGAGAATGAGG + Intergenic
1202107800 Y:21388330-21388352 TTGGAGGGAGGGAGGGAATAAGG + Intergenic