ID: 1105941765

View in Genome Browser
Species Human (GRCh38)
Location 13:25153951-25153973
Sequence TCTTAGATGCAGACAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 7, 3: 36, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105941762_1105941765 -7 Left 1105941762 13:25153935-25153957 CCTCTCAGTTCATTGTTCTTAGA 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG 0: 1
1: 1
2: 7
3: 36
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105941765 Original CRISPR TCTTAGATGCAGACAAGGGA AGG Intergenic
902967469 1:20018338-20018360 TACTAGAGGCAGAAAAGGGAAGG - Intergenic
905186092 1:36197902-36197924 TCTTAGAAGAAAACAGGGGAAGG - Intergenic
905621415 1:39451195-39451217 TCATGGATGCACACAAGGTAGGG + Exonic
905823840 1:41014815-41014837 TCATAGATGGAGACCAGGGGTGG + Intergenic
906263686 1:44412213-44412235 TCGTGGCTGCTGACAAGGGATGG - Exonic
906559226 1:46742897-46742919 TATTAGAAGCTGAAAAGGGAGGG + Intergenic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
909619041 1:77646805-77646827 TCTAAGCTGCAGAGAAAGGAAGG + Intronic
911531275 1:99045803-99045825 TCTTACATGGAAACCAGGGATGG - Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
915140177 1:153763045-153763067 TCTTACAAGCAAACAAGGGCAGG - Intronic
916411064 1:164547614-164547636 TCATAGATGAAGAGAAAGGAAGG + Intergenic
917541797 1:175921665-175921687 TCCTACATCCAGACAAGGGAGGG - Intergenic
917542906 1:175932979-175933001 TTCTAGATCCAGACAAGGGAGGG - Intergenic
920305231 1:205014345-205014367 TCTTAGACTCATCCAAGGGAGGG - Intronic
922240893 1:223755033-223755055 TGTTAGATTCAGACAAGTGCAGG + Intronic
922891278 1:229063543-229063565 TCCTAGATCCAGACAAGTGAGGG + Intergenic
923109114 1:230876918-230876940 TCTTAGCTGAAGATAAGGGCAGG + Intergenic
923505977 1:234607593-234607615 TCTTAGTAGCAGACAATGCAGGG - Exonic
923526920 1:234779720-234779742 TCCTAGATCTGGACAAGGGAAGG - Intergenic
923791251 1:237113018-237113040 TCTTGGATGCAGAAAGGAGAAGG - Intronic
923887497 1:238175592-238175614 TCTTAGATTCAAACAGGAGAGGG - Intergenic
1063521958 10:6749109-6749131 TCTTAGATACTTTCAAGGGAAGG - Intergenic
1064335888 10:14440807-14440829 TCTTAGAGGTAGTCAGGGGAAGG - Intronic
1064804899 10:19119650-19119672 TCTTAGAAGCAGTTTAGGGAGGG + Intronic
1065553286 10:26890009-26890031 TCTTACATCCAGACAAGGAAGGG + Intergenic
1066023847 10:31331634-31331656 TCTTATATGCATAGAGGGGATGG + Intronic
1066190025 10:33047626-33047648 TCCTAGATCCGGACAAGGGTGGG + Intergenic
1066581659 10:36888387-36888409 TCTTACATCCAGAAAAGGGAGGG + Intergenic
1068103316 10:52582640-52582662 TCTTACATGGAGACAGGGCAGGG + Intergenic
1068634357 10:59331987-59332009 TCTTAGAGACAGACTAGGGCTGG + Intronic
1070319233 10:75342478-75342500 TCTTGGATTGAGACAAGGGGTGG + Intergenic
1070848173 10:79540801-79540823 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
1070925604 10:80219368-80219390 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1071204306 10:83255620-83255642 TCCTAGAACCAGAGAAGGGAAGG + Intergenic
1071395164 10:85216223-85216245 TCTGAGATGCAGCCAAAGTACGG + Intergenic
1071526262 10:86361271-86361293 CCTTGGATGCCTACAAGGGATGG - Intronic
1072217964 10:93303866-93303888 TCTTAGAAGCAGACAAATTAGGG - Intergenic
1072818799 10:98536032-98536054 TCTTATATGCAGACAAAAGATGG + Intronic
1073191866 10:101657090-101657112 TCTGAGGTGCTGACAAGGGCGGG - Intronic
1078315579 11:10290520-10290542 TCTTAGATCCAGACTGGGGTAGG + Intronic
1080929762 11:36797549-36797571 ACTTAGATGCATACTAAGGAAGG - Intergenic
1084746919 11:71176953-71176975 TCTTAAAAGCAGACTAGGGAAGG + Intronic
1085579537 11:77638304-77638326 TCTTAGGTGCAGTTTAGGGAGGG - Intergenic
1085868719 11:80325448-80325470 TCTTAGATCTGGACAAGGGAGGG - Intergenic
1086029033 11:82330837-82330859 TGTTAGATGGAAACAAGGCAAGG + Intergenic
1087088628 11:94245408-94245430 TCTTAGAGGCTGAGGAGGGAGGG - Intergenic
1087510550 11:99086959-99086981 TCATAGATGAAGAAAATGGAGGG + Intronic
1089217959 11:116847141-116847163 TCTTGGAGCCAGTCAAGGGAGGG - Intronic
1089374476 11:117984933-117984955 TCTGAAATGCAGAAAAGGCAAGG + Intergenic
1092644353 12:10553113-10553135 TCTTCAATGCAGAAAAGGGGTGG - Intergenic
1095663279 12:44763197-44763219 TCTTAGTTGGAAAGAAGGGAGGG - Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1101486718 12:105171501-105171523 AGGTAGATGCAGACAAGGTAAGG + Intergenic
1103037077 12:117665253-117665275 TCTTAGGTGGAGACCAGGGCGGG + Intronic
1105941765 13:25153951-25153973 TCTTAGATGCAGACAAGGGAAGG + Intergenic
1106266659 13:28116555-28116577 ATTAAGATGCAGACCAGGGAGGG - Intergenic
1106575241 13:30968372-30968394 TCTTAGATCCAGACAAGGGAAGG + Intronic
1107021432 13:35756404-35756426 TCCTAGATCTGGACAAGGGAAGG + Intergenic
1108171979 13:47751156-47751178 CCTTAGGTGCAGAAAAGGCAGGG - Intergenic
1108809037 13:54197915-54197937 TTTTAGATGCAAGCAATGGAAGG - Intergenic
1110262363 13:73499802-73499824 TCTTAGAGGCAGAGTAGTGAGGG - Intergenic
1110420186 13:75298839-75298861 TCTTACATGAAGATAAAGGAGGG + Intronic
1113076022 13:106468687-106468709 TCTAAGATGGAGACACAGGATGG - Intergenic
1114422264 14:22594235-22594257 TCTTAGGAGCAGTCTAGGGAGGG + Intergenic
1114783978 14:25572581-25572603 TCTTAGATGATGCCAAGGCAAGG - Intergenic
1115297668 14:31847630-31847652 TGTTAGATGCTGAATAGGGAAGG + Intronic
1115349058 14:32373491-32373513 TCTTAGGTGCAGTTTAGGGAGGG + Intronic
1115864662 14:37731603-37731625 TATTAGATGCATACAAATGAAGG + Intronic
1116137062 14:40939659-40939681 TCTTAGATCCAGATGAGGGGAGG - Intergenic
1118162004 14:63299899-63299921 TCTACGCTGCAGACAAGGCAAGG - Intergenic
1119597898 14:75953521-75953543 TTTTAAAAGCAAACAAGGGAAGG + Intronic
1124145938 15:27125332-27125354 TATTAGAGGCTGAGAAGGGAAGG + Intronic
1125107955 15:35996068-35996090 TATTAGATGAAGACAAGAGGGGG + Intergenic
1125237117 15:37528361-37528383 TCTTAGATCAAGAAAATGGATGG - Intergenic
1129381258 15:75168897-75168919 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1129527239 15:76227105-76227127 TCTTAAATGCAGGCCAGGCATGG + Intronic
1130792748 15:87173223-87173245 GCTTAGATGCAAACAAGTGGAGG + Intergenic
1131175072 15:90204194-90204216 CCTAAGATGCATGCAAGGGAGGG - Intronic
1131914281 15:97247183-97247205 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
1132024476 15:98393093-98393115 TCTGAGATGCAGGAAAGAGAAGG + Intergenic
1132135477 15:99333698-99333720 TCTTAAATGGAGAAAAGGGCTGG - Intronic
1133122282 16:3617039-3617061 TCTTAGAAGAATACAAGGGTAGG + Intronic
1133743527 16:8669812-8669834 TCTTAGAAGAAAACATGGGAAGG - Intergenic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1137735002 16:50717223-50717245 TCTTAGACACAGAAAAGGAAAGG - Intronic
1137754853 16:50893191-50893213 TCTGAGATATTGACAAGGGAAGG - Intergenic
1138785492 16:59840885-59840907 GTGTGGATGCAGACAAGGGAAGG + Intergenic
1139153637 16:64414921-64414943 AGTTAGATGCAGGCATGGGAAGG - Intergenic
1144445959 17:15329488-15329510 TCTTAAAGGCAGTCAAGGGTAGG + Intronic
1145283547 17:21486737-21486759 TCCTAGATCCAGACAAGGGAAGG - Intergenic
1145393907 17:22478763-22478785 TCCTAGATCCAGACAAGGGAAGG + Intergenic
1147275324 17:39311445-39311467 TCTAAGTGGCAGGCAAGGGAGGG + Intronic
1147623420 17:41883463-41883485 TCAGAGGTGCAAACAAGGGATGG + Intronic
1148115074 17:45170734-45170756 TCTCTGATGCAGACAGGCGAGGG - Intergenic
1151022300 17:70631454-70631476 TCTTAGAAGTAGGAAAGGGAGGG + Intergenic
1151284247 17:73098510-73098532 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
1152118654 17:78404566-78404588 TCTTTGATGCATAAAAGAGACGG - Intronic
1152297262 17:79475330-79475352 TCTTAAAATCAGCCAAGGGATGG + Intronic
1153131775 18:1861788-1861810 GATTAGATGCAAACAAGGGGTGG - Intergenic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1156576950 18:38328165-38328187 CCTTAGATGGGGAAAAGGGAAGG + Intergenic
1156907356 18:42369917-42369939 TCTTAGATCTGGACAAGGGAAGG + Intergenic
1158493060 18:57928081-57928103 GTTCAGATGCAGACAAGTGAGGG + Intergenic
1158868546 18:61661625-61661647 TCCTAGATCCAGAAAAGGGAAGG + Intergenic
1159386118 18:67727126-67727148 TGACAGATGGAGACAAGGGAAGG - Intergenic
1159580509 18:70230157-70230179 TCTTAGGAGCAGTTAAGGGAGGG + Intergenic
1160104939 18:75965078-75965100 TCTGAGATGCAAACAGGAGAGGG - Intergenic
1160453151 18:78979200-78979222 TCTTAAATACAGGAAAGGGAGGG - Intergenic
1161902143 19:7126768-7126790 TCCTAGATGCAGTCTAGGGCAGG + Intronic
1164755263 19:30684729-30684751 TCTTTGGTTCAGGCAAGGGAGGG + Intronic
1167683858 19:50943340-50943362 TCAGAGCTGCAGAGAAGGGATGG + Exonic
1167711680 19:51115552-51115574 TCTGGGATGCAGATAAAGGAGGG - Intergenic
1168227398 19:55005642-55005664 TCTTAGAAGCAGTTTAGGGAGGG + Intergenic
925832378 2:7909211-7909233 GCTTAGATGGAGACAGGAGAAGG + Intergenic
926389215 2:12370352-12370374 TCCTAGATCTGGACAAGGGAAGG - Intergenic
927385189 2:22524433-22524455 TCCTAGATCCAGACAAGGCCAGG - Intergenic
927944645 2:27128308-27128330 TCTCACATGCAGACAAAGCAGGG + Intronic
930113538 2:47699188-47699210 TCCTAGATTCAGAGAAGGGAAGG + Intronic
931386208 2:61799829-61799851 TCTGAGATGTAGACACGTGAGGG + Intergenic
935960083 2:108417166-108417188 TCTTTGATACAGTCAAGAGATGG - Intergenic
936061524 2:109298198-109298220 AAATAGATGCAGAGAAGGGAAGG + Intronic
936619798 2:114083608-114083630 CCATAGAGGAAGACAAGGGAAGG - Intergenic
937771133 2:125721868-125721890 TCTTAGAAGGACACAAGGGATGG - Intergenic
940173516 2:150853729-150853751 TCCTAGGTCCAGACAAGGGAAGG - Intergenic
941513987 2:166449209-166449231 TTTTAGAACCAGACAATGGATGG + Intronic
942641590 2:178066647-178066669 TCTTAGATGGGGTCTAGGGAGGG + Intronic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
945417264 2:209589943-209589965 TCTCAGATGTAGACATGGAAGGG + Intronic
945726389 2:213475947-213475969 ACTTAAATGCAGAGGAGGGAAGG + Intronic
946023226 2:216656192-216656214 TCTGGGACGCAGCCAAGGGATGG + Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
1169510157 20:6255412-6255434 TCCTAGAAGCAGACCTGGGATGG + Intergenic
1169679394 20:8193582-8193604 TGGTAGATGGAGACAAGGGTGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171870626 20:30521593-30521615 TCTTAGATGCAGACATGATTAGG + Intergenic
1173299854 20:41792686-41792708 CCTAAGATGTAGACAAGAGAAGG - Intergenic
1177173881 21:17682896-17682918 TCCTAGATCCAGACAAGAAAGGG + Intergenic
1177307593 21:19340231-19340253 TAGTACATGCAGGCAAGGGATGG - Intergenic
1178133960 21:29605210-29605232 TCAGAGATGCGGACAGGGGAGGG - Intronic
1180352701 22:11817338-11817360 TCTTAGGTGCAGACATGATAAGG + Intergenic
1180352848 22:11818508-11818530 TCTTAGGTGCAGACATGGTTAGG - Intergenic
1180385394 22:12173849-12173871 TCTTAGGTGCAGACATGGTTAGG + Intergenic
1180385549 22:12175019-12175041 TCTTAGGTGCAGACATGATAAGG - Intergenic
1180862886 22:19097167-19097189 ACTTAGAAGCAGCCAAGGCAAGG - Intronic
1181954074 22:26575512-26575534 TTTTAGATGGACACAAGGGGAGG - Intronic
1182120685 22:27784442-27784464 TCTCAGACGCAGAGGAGGGAAGG + Intronic
1182938094 22:34245791-34245813 TCTAACATGCAGCCAAGGTAAGG + Intergenic
1183644391 22:39115239-39115261 TCCTAGATCTGGACAAGGGAGGG + Intergenic
1184844510 22:47072893-47072915 GCCCAGCTGCAGACAAGGGAGGG + Intronic
952833049 3:37581320-37581342 TCTTAGATGTGAAAAAGGGAGGG + Intronic
953109386 3:39918945-39918967 TCTTAGACTTGGACAAGGGAGGG + Intronic
955367370 3:58322397-58322419 CCCGAGATCCAGACAAGGGAAGG + Intergenic
958717589 3:97804224-97804246 TCCTTGATCCAGACATGGGAGGG - Intergenic
959091028 3:101902832-101902854 TCTTAGATTCATCCAAGGCAAGG - Intergenic
961545058 3:127627701-127627723 TCTTAGAAGCAAACAAGAAATGG - Intergenic
964921207 3:161897944-161897966 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic
966051231 3:175619488-175619510 ACTTAAATGCAGAGGAGGGAAGG + Intronic
966589428 3:181664658-181664680 TCTTACATTGAGACAAGGGTGGG + Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967140180 3:186551124-186551146 TCTTACATGCAGACACTGGTAGG - Exonic
967223067 3:187265525-187265547 TTTTAGAAGCAGAGAAGAGAAGG + Intronic
967589291 3:191253739-191253761 TCCTAGATCTGGACAAGGGAAGG + Intronic
969319806 4:6404850-6404872 GCTAAGAGGCAGGCAAGGGAGGG + Intronic
970408339 4:15784765-15784787 TCTTAGGTGCAGGCGAGGCACGG + Intronic
971316617 4:25573147-25573169 TCTTAAAAACAGACAAGGGCCGG - Intergenic
971511230 4:27426799-27426821 TCTTTGATGAAGACAAGGAAAGG + Intergenic
971827384 4:31643535-31643557 TCTGAGATGCAGGCAAGGAAAGG + Intergenic
972035323 4:34512822-34512844 TCATAGATCCAGACAAGAGAAGG + Intergenic
973067678 4:45817702-45817724 TCTTAGTTGTAGAAAAGGCAGGG + Intergenic
973534852 4:51870954-51870976 ACTCAGATCCAGGCAAGGGAAGG - Intronic
974202910 4:58663944-58663966 TCCTAGATGTAGACAAGGAAAGG + Intergenic
974203278 4:58668355-58668377 TCCTAGATGCAGACAAGGAAAGG - Intergenic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
976740581 4:88352492-88352514 TCCCAGATCTAGACAAGGGAAGG + Intergenic
978840770 4:113209332-113209354 TTCTAGATCCAGACAAGGGAGGG + Intronic
981400227 4:144305080-144305102 GTTTATATGCAGACAAGGGTGGG + Intergenic
981659111 4:147145659-147145681 CCTCAGATGCAGACAAGTAATGG + Intergenic
983760757 4:171403399-171403421 TCCTAGATCCAGGCAAGGGAAGG - Intergenic
984141255 4:176006022-176006044 TCCTATATCCAGACAAAGGAAGG + Intergenic
984286763 4:177740218-177740240 GCTTAGATGGTGATAAGGGAAGG - Intronic
985552804 5:541827-541849 CCTCAGCTGCAGGCAAGGGACGG + Intergenic
986969605 5:13316499-13316521 TCTCAGATGTAGGCCAGGGATGG + Intergenic
987693154 5:21294850-21294872 TCCCAGATTGAGACAAGGGAAGG - Intergenic
987821290 5:22970121-22970143 GCTTGGAAGCAGACCAGGGAAGG + Intergenic
988271536 5:29023630-29023652 TCCTAGATCTGGACAAGGGAGGG - Intergenic
988388250 5:30594455-30594477 TCCTAGATCCAGACAAGGGAAGG - Intergenic
989582750 5:43048299-43048321 TCCTAGATCCAGACAAGAGAAGG + Intergenic
990830370 5:59949578-59949600 TCATAGAGGCAGTCAAGGAATGG - Intronic
991142022 5:63255585-63255607 TCTTAGGAGCAGTCTAGGGAGGG - Intergenic
991747123 5:69754706-69754728 TCCCAGATTGAGACAAGGGAAGG + Intergenic
991750582 5:69800536-69800558 TCCCAGATTGAGACAAGGGAAGG - Intergenic
991798725 5:70334644-70334666 TCCCAGATTGAGACAAGGGAAGG + Intergenic
991826499 5:70630019-70630041 TCCCAGATTGAGACAAGGGAAGG + Intergenic
991829870 5:70675437-70675459 TCCCAGATTGAGACAAGGGAAGG - Intergenic
991891056 5:71333971-71333993 TCCCAGATTGAGACAAGGGAAGG + Intergenic
993185987 5:84620278-84620300 TCTTAAATGCATACAACTGAGGG - Intergenic
993203752 5:84850635-84850657 TCTTAGAGGCTGGGAAGGGAAGG + Intergenic
993982536 5:94559966-94559988 TCCTAGATCCAGACAAGAGAAGG - Intronic
994923754 5:106086481-106086503 TCCTAGATCCTGAGAAGGGAGGG + Intergenic
995883221 5:116865687-116865709 TCTTAGATCTGGAAAAGGGAAGG - Intergenic
996050704 5:118929808-118929830 TCCTAGATCTGGACAAGGGAAGG - Intronic
999071873 5:148752027-148752049 TCTTAGAAGCAGACAATGAATGG - Intergenic
1000231772 5:159322239-159322261 TCTTCAATGTAGACAAGGAAGGG + Intronic
1002907949 6:1466047-1466069 TCCTAGATCTGGACAAGGGAGGG + Intergenic
1006529837 6:34642415-34642437 GATTAGCTGCAGACAAGGGCAGG + Intronic
1006873348 6:37273443-37273465 TGATAGGTGCAGACAAGGTATGG - Intronic
1009050406 6:58268294-58268316 TCCTAGATTCAGACAAGGGGTGG + Intergenic
1009240003 6:61174093-61174115 TCCTAGATTCAGACAAGGGGTGG - Intergenic
1012481146 6:99668552-99668574 GCTAATATGCAGACAAGAGAGGG - Intergenic
1015208217 6:130666284-130666306 TCTTACATACAGAGAAGGGGAGG - Intergenic
1017954197 6:159164817-159164839 TCAAAGATGCAGACAAGAAATGG - Intergenic
1018313235 6:162531657-162531679 TCTTAGAGGCAGTTTAGGGAGGG + Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1022841365 7:34167111-34167133 TCTTAGATATAGAAAAAGGACGG - Intergenic
1022845801 7:34208616-34208638 TCTATGATGGAGACAAGGCAGGG + Intergenic
1022863155 7:34389094-34389116 TCCTAGATCCAGACAAAGAAAGG - Intergenic
1023907484 7:44532820-44532842 TGTTACATGCAGACCAGGCATGG + Intronic
1024029667 7:45448357-45448379 TCCCAGATCCAGACAAGGAAAGG - Intergenic
1024422546 7:49185814-49185836 TCCTAGATATAGACAAGGGAGGG + Intergenic
1028356739 7:89919274-89919296 TCATAGATGCAGGCATGGCATGG - Intergenic
1030606472 7:111643793-111643815 TCCTAGATCCTGAAAAGGGAGGG - Intergenic
1033075510 7:138246603-138246625 TCCTAGATCTAGACAAGGGAGGG - Intergenic
1034232212 7:149539562-149539584 TCTTAAAAGCAGCCAAGGGCCGG + Intergenic
1035354147 7:158266956-158266978 TCTTGGATGTAGACGTGGGAGGG - Intronic
1036475365 8:9088204-9088226 TGTTAAATGCAGAGAAGAGAAGG - Intronic
1037412833 8:18616444-18616466 TCCTAGATCCAGACGAGGGAAGG - Intronic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1037909633 8:22736305-22736327 TCTTAGAAGTAGACAAGAGTGGG + Intronic
1038338223 8:26662391-26662413 TCTTGGATGCAACCAAGAGATGG - Intergenic
1039029732 8:33296452-33296474 CCATAGATCCAGACAAAGGAGGG - Intergenic
1039247818 8:35629003-35629025 TCTTTGATGCAGAGGAGGGGAGG + Intronic
1039301716 8:36216657-36216679 TCTTAGAAGCAGTTTAGGGAAGG - Intergenic
1039328720 8:36513441-36513463 TCTTAGGGGCAAGCAAGGGAAGG - Intergenic
1040552511 8:48449506-48449528 TCACAAATGCAGAAAAGGGAAGG - Intergenic
1041258688 8:56001388-56001410 GCTGAGATGCAAACCAGGGAAGG + Intronic
1041804847 8:61838820-61838842 TCCTAGATCCAGACAAGGAAAGG + Intergenic
1042639320 8:70915894-70915916 TCCTAGATCTGGACAAGGGATGG - Intergenic
1042824232 8:72964006-72964028 TCCTAGATCCAGACAAGGGAAGG + Intergenic
1043618157 8:82153992-82154014 TCTTAGAGACAGAGAAGGAAAGG - Intergenic
1043783396 8:84365712-84365734 TCTTGGATACAGACAACAGAAGG + Intronic
1044748772 8:95396620-95396642 TCGTAGATTCAGCCAATGGAAGG - Intergenic
1045055602 8:98365407-98365429 TCCTTGATGAAGAGAAGGGAGGG + Intergenic
1048082419 8:131143045-131143067 TTGTAGATGCAGAGAAGGGAAGG - Intergenic
1048773712 8:137922393-137922415 TGTAAGATGCAGAAAATGGAAGG + Intergenic
1050165665 9:2762365-2762387 TTCTAAATCCAGACAAGGGAAGG + Intronic
1051011586 9:12421495-12421517 TCTTACATCCAGAGAAAGGAAGG + Intergenic
1051104718 9:13566326-13566348 TCTTAGATACAAACAAGACATGG + Intergenic
1051870900 9:21736335-21736357 TCCTAGATCCAGTCAAGGGAAGG + Intergenic
1051972845 9:22911905-22911927 TCCTAGATCCAGACAAGGAAAGG + Intergenic
1052012287 9:23424605-23424627 TCCTAGATCTGGACAAGGGAGGG + Intergenic
1052921343 9:33972552-33972574 ACGTAGATGCAGTCAAGGAAAGG - Intronic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1054924756 9:70578332-70578354 TCTTAGATGCAAACTTGAGAAGG + Intronic
1055049790 9:71966870-71966892 TCCTAGATCCAGACAAGGGCGGG + Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055574744 9:77649232-77649254 ATTTTGATGCAGAAAAGGGAAGG + Intergenic
1056763315 9:89429403-89429425 TCTTAGCTGCAAAAGAGGGATGG - Intronic
1057318497 9:93989478-93989500 TCTTAGGAGCAGTCTAGGGAGGG - Intergenic
1057928047 9:99170454-99170476 TCTGAGCTGCTGGCAAGGGAGGG - Intergenic
1058761837 9:108141557-108141579 TCTTTGAGATAGACAAGGGAAGG + Intergenic
1185516293 X:701581-701603 TCTTCGATGTAGAGAGGGGACGG + Intergenic
1186744897 X:12557375-12557397 CCCTAGATCCAGACAAGGGAAGG + Intronic
1187874806 X:23795443-23795465 TCCTAGATCCGGACAAGGGAGGG - Intergenic
1189684031 X:43545178-43545200 TCCTAGATACAGACAAGGGAAGG + Intergenic
1190510493 X:51169400-51169422 TCCTAGGTCCAGACAAGGGAAGG - Intergenic
1191637706 X:63395131-63395153 TCTTAGATCCAGACGAGGGAGGG + Intergenic
1192116040 X:68412140-68412162 TCCTAGATCTGGACAAGGGAGGG + Intronic
1192160409 X:68782195-68782217 TCCCAGATCCTGACAAGGGAAGG + Intergenic
1192161438 X:68791154-68791176 TCCCAGATCCTGACAAGGGAAGG - Intergenic
1192453004 X:71254799-71254821 CCGTGGCTGCAGACAAGGGAAGG - Intronic
1192790977 X:74381607-74381629 TCCTAGATTTGGACAAGGGAAGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1195564072 X:106322109-106322131 TCTGAGATGCAGAAAACTGAGGG - Intergenic
1196076134 X:111578326-111578348 TCCTAGGTCCAGACAAGAGAAGG - Intergenic
1196257688 X:113541147-113541169 TCCTAAATCCAGACAAGGGAAGG - Intergenic
1196279321 X:113804403-113804425 TCCTAGATCTGGACAAGGGAAGG - Intergenic
1196366232 X:114927408-114927430 TCCTAGATCTGGACAAGGGAAGG + Intergenic
1197652809 X:129084426-129084448 TCCTAGATCTGGACAAGGGAAGG - Intergenic
1199362094 X:146933097-146933119 TCTTAGAAGCAGTTTAGGGAGGG - Intergenic