ID: 1105943201

View in Genome Browser
Species Human (GRCh38)
Location 13:25169735-25169757
Sequence GTTGCTGGTGCACCACGGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943193_1105943201 13 Left 1105943193 13:25169699-25169721 CCGGGATTTTTGTTCTGGGCATC 0: 1
1: 0
2: 2
3: 14
4: 185
Right 1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG 0: 1
1: 0
2: 0
3: 12
4: 68
1105943190_1105943201 28 Left 1105943190 13:25169684-25169706 CCAGCACTTTGGAAACCGGGATT 0: 1
1: 0
2: 0
3: 10
4: 209
Right 1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG 0: 1
1: 0
2: 0
3: 12
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943201 Original CRISPR GTTGCTGGTGCACCACGGGA TGG Exonic
903305887 1:22413012-22413034 GTTACAGCTGCACCACGGGAAGG - Intergenic
913565489 1:120069148-120069170 GTTGGCGGGGCACCACGGGAGGG + Intronic
913632644 1:120724414-120724436 GTTGGCGGGGCACCACGGGAGGG - Intergenic
914286087 1:146228523-146228545 GTTGGCGGGGCACCACGGGAGGG + Intronic
914547118 1:148679276-148679298 GTTGGCGGGGCACCACGGGAGGG + Intronic
914619389 1:149391086-149391108 GTTGGCGGGGCACCACGGGAGGG - Intergenic
916665106 1:166959446-166959468 TTTGCTGGGTCACCACTGGAAGG - Intronic
1070786128 10:79163136-79163158 GGTGCTGGGGCAGCCCGGGAGGG + Intronic
1074693520 10:116028060-116028082 TTTGGGGGTGCACCAGGGGATGG + Intergenic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1082895965 11:58190468-58190490 GTTGCAGGTGAACCACTGGATGG + Exonic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1087219570 11:95531695-95531717 GTTACGGATGCACCACAGGATGG + Intergenic
1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG + Intergenic
1090908200 11:131095820-131095842 GATGCAGGTGCAACAGGGGAAGG - Intergenic
1102948396 12:117010650-117010672 ATTTCTGAAGCACCACGGGAAGG + Intronic
1104804213 12:131574618-131574640 GTTGCTGGTGCACCGCACGTTGG - Intergenic
1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG + Exonic
1107558804 13:41542463-41542485 CTCGCTGGTGGACCAGGGGAGGG - Intergenic
1111730863 13:92074856-92074878 GTTGCTGCTGCACCAGCAGATGG - Intronic
1114672171 14:24417137-24417159 GCTGCTGGAGCTCCACTGGAGGG + Exonic
1115549421 14:34491564-34491586 GTAGCAGGTGCTCCAGGGGAGGG - Intergenic
1115956749 14:38789745-38789767 GGTGCTGGTGCACCAGAGGTTGG - Intergenic
1117720915 14:58627979-58628001 GGTTCTGCTGCACCACGGGGGGG - Intergenic
1132286804 15:100669392-100669414 GCTGCTGGAGCACCGAGGGATGG + Intergenic
1132732926 16:1371734-1371756 GTTGCTGGGGCAGCCAGGGAAGG + Intronic
1132873031 16:2124034-2124056 GCTGCTGGGGCACCACTGGGTGG + Intronic
1133114268 16:3567265-3567287 GTTCCTGGGGCCCCACTGGAGGG - Intronic
1134552119 16:15143213-15143235 GCTGCTGGGGCACCACTGGGTGG + Intergenic
1137695023 16:50455725-50455747 TTTGCTGGTGCCCCAGGGCAGGG - Intergenic
1137706460 16:50539107-50539129 GTTGCAGGTTCACCAGGGGAAGG - Intergenic
1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG + Intronic
1155032175 18:21994212-21994234 GCTGGTGGTGCAGCACTGGAGGG + Intergenic
1157319537 18:46623732-46623754 GTGGCTGGTGCACCAGGCGCAGG - Intronic
1157700343 18:49758184-49758206 GTGGGTGGGGCACCTCGGGATGG + Intergenic
1159575878 18:70176737-70176759 GATGCTTGTGCACCACAGAATGG - Exonic
1161284046 19:3459698-3459720 GAGGCTGGTCCACCACGGGGAGG + Intronic
1161590385 19:5126753-5126775 GCTGCGGGTTCAGCACGGGAGGG + Intronic
1164274032 19:23701107-23701129 CTTTCTGGTGAACCACGGAAGGG + Intergenic
1167796634 19:51713685-51713707 GTGGCTGGGGCACCTCGGGCCGG - Exonic
924995326 2:355747-355769 GTTGCTGGTGCACCGCCGGCGGG + Intergenic
926300463 2:11598434-11598456 GAAGCTGGTGCCCCTCGGGAGGG + Intronic
930762524 2:55050883-55050905 GTTTCTGGCGCGCCACCGGAAGG + Intronic
1170863761 20:20134360-20134382 GTTGCTGGAGCATCAGGTGAGGG + Intronic
1174860537 20:54087158-54087180 CTTGCTGATACACCACTGGATGG - Intergenic
1175732772 20:61365376-61365398 GTGGCTGGTCCATCACGGGAGGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1183481287 22:38066948-38066970 GGTGCTGGGGCACCAAGGGGAGG - Intronic
950392483 3:12707563-12707585 GCTGCTGTTGCACAACAGGATGG - Intergenic
954608185 3:51929748-51929770 GTAGCTGGTGCAGGACGGGTTGG - Intergenic
955453526 3:59096311-59096333 GTTTCTGGTGGACCATGGAAGGG + Intergenic
967304082 3:188044021-188044043 CTTGCTGGGACACCACAGGAAGG + Intergenic
971498847 4:27297053-27297075 TTTGGTGGAGCACCAGGGGAAGG + Intergenic
976246989 4:83014175-83014197 GCTGTTGGGGCACCACTGGAAGG + Intergenic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
982145728 4:152388636-152388658 GTTTCTGGTGTACCATGGGATGG - Intronic
985768751 5:1795969-1795991 GATGCAGGTGCACCACTGGGAGG - Intergenic
986233237 5:5885713-5885735 GTTGCTTCTGCACCAATGGAAGG - Intergenic
988558617 5:32260343-32260365 GATGCTGGGGCACCAGTGGATGG + Intronic
998394307 5:141808627-141808649 GTTCCGGCTGCACCACAGGAAGG + Intergenic
1001132516 5:169076173-169076195 GTTGCTGGGGGATCACAGGAAGG + Intronic
1003339270 6:5204179-5204201 TTCCCTGGTGCCCCACGGGAAGG - Intronic
1006388629 6:33746187-33746209 GGTGGTGGTAGACCACGGGATGG - Intronic
1020558006 7:9693576-9693598 GGTGCAGGTGCACCAGAGGATGG - Intergenic
1021577399 7:22116833-22116855 GTTGCTAGTGCACCAGGGCCAGG + Intergenic
1023888642 7:44377518-44377540 GCTGCTGGAGCCCCATGGGAAGG - Intergenic
1023929694 7:44697752-44697774 GTTGCTGCTGCCCCATGGCATGG + Exonic
1032506983 7:132442984-132443006 GAAGCTGGTGCAGCACGGGCTGG - Intronic
1032715400 7:134505032-134505054 GTTGCTGGAGCCCCACTGCATGG + Intergenic
1034265530 7:149778958-149778980 GTTGCTGGTGTAGCAGGGAAGGG + Intergenic
1034570628 7:151953160-151953182 TTGGCTGGTGCACAACGGTAGGG + Intergenic
1037896520 8:22660039-22660061 GGTGGTGGTGCATCACGGTATGG - Intronic
1039289891 8:36083049-36083071 GTTGCTGGAGTACCATGGAAAGG - Intergenic
1041503873 8:58572291-58572313 GTTTCTGGTGCACCACTTCAGGG + Exonic
1049770183 8:144376421-144376443 GCTGCTGGTGGACCAGGGTAGGG + Intronic
1049830773 8:144699636-144699658 GGTGCTGGTGGGCTACGGGACGG + Intergenic
1057214579 9:93220792-93220814 GATGCTGGGGCAGCACGGGCAGG - Intronic
1058637251 9:107048674-107048696 GTTGCTGGTGTTCCACTGGGAGG - Intergenic
1059383850 9:113949113-113949135 GAGGCTGGTGCACCATGGGATGG + Intronic
1062458742 9:136654108-136654130 GTGGCTGGGGCAGGACGGGAAGG - Intergenic
1196492875 X:116289521-116289543 CTTTCTGGTGAACCACGGAAGGG + Intergenic