ID: 1105943448

View in Genome Browser
Species Human (GRCh38)
Location 13:25170815-25170837
Sequence TGAGCCCGCAGGGGGAGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 511}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943448_1105943458 -4 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943458 13:25170834-25170856 CTCACCTGCTGGGTCTCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1105943448_1105943460 4 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943460 13:25170842-25170864 CTGGGTCTCGCGGGGCGTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 143
1105943448_1105943462 9 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943448_1105943461 8 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943461 13:25170846-25170868 GTCTCGCGGGGCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1105943448_1105943456 -6 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943456 13:25170832-25170854 GGCTCACCTGCTGGGTCTCGCGG 0: 1
1: 0
2: 3
3: 21
4: 126
1105943448_1105943465 29 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943465 13:25170867-25170889 GGGCTCCTCCGGCTCGCGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 118
1105943448_1105943463 18 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943463 13:25170856-25170878 GCGTCCTGGCTGGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 32
4: 211
1105943448_1105943457 -5 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943457 13:25170833-25170855 GCTCACCTGCTGGGTCTCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943448 Original CRISPR TGAGCCCGCAGGGGGAGAGG AGG (reversed) Exonic