ID: 1105943449

View in Genome Browser
Species Human (GRCh38)
Location 13:25170818-25170840
Sequence AGGTGAGCCCGCAGGGGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943449_1105943463 15 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943463 13:25170856-25170878 GCGTCCTGGCTGGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 32
4: 211
1105943449_1105943458 -7 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943458 13:25170834-25170856 CTCACCTGCTGGGTCTCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1105943449_1105943462 6 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943449_1105943457 -8 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943457 13:25170833-25170855 GCTCACCTGCTGGGTCTCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 140
1105943449_1105943461 5 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943461 13:25170846-25170868 GTCTCGCGGGGCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1105943449_1105943456 -9 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943456 13:25170832-25170854 GGCTCACCTGCTGGGTCTCGCGG 0: 1
1: 0
2: 3
3: 21
4: 126
1105943449_1105943460 1 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943460 13:25170842-25170864 CTGGGTCTCGCGGGGCGTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 143
1105943449_1105943465 26 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943465 13:25170867-25170889 GGGCTCCTCCGGCTCGCGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943449 Original CRISPR AGGTGAGCCCGCAGGGGGAG AGG (reversed) Exonic