ID: 1105943452

View in Genome Browser
Species Human (GRCh38)
Location 13:25170824-25170846
Sequence CCCAGCAGGTGAGCCCGCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943452_1105943468 27 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943452_1105943467 26 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943467 13:25170873-25170895 CTCCGGCTCGCGCGCGGCTCTGG 0: 1
1: 0
2: 2
3: 8
4: 98
1105943452_1105943463 9 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943463 13:25170856-25170878 GCGTCCTGGCTGGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 32
4: 211
1105943452_1105943461 -1 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943461 13:25170846-25170868 GTCTCGCGGGGCGTCCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1105943452_1105943460 -5 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943460 13:25170842-25170864 CTGGGTCTCGCGGGGCGTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 143
1105943452_1105943462 0 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943452_1105943465 20 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943465 13:25170867-25170889 GGGCTCCTCCGGCTCGCGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943452 Original CRISPR CCCAGCAGGTGAGCCCGCAG GGG (reversed) Exonic