ID: 1105943459

View in Genome Browser
Species Human (GRCh38)
Location 13:25170838-25170860
Sequence GACGCCCCGCGAGACCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943459_1105943465 6 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943465 13:25170867-25170889 GGGCTCCTCCGGCTCGCGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 118
1105943459_1105943467 12 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943467 13:25170873-25170895 CTCCGGCTCGCGCGCGGCTCTGG 0: 1
1: 0
2: 2
3: 8
4: 98
1105943459_1105943468 13 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943459_1105943463 -5 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943463 13:25170856-25170878 GCGTCCTGGCTGGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 32
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943459 Original CRISPR GACGCCCCGCGAGACCCAGC AGG (reversed) Exonic