ID: 1105943462

View in Genome Browser
Species Human (GRCh38)
Location 13:25170847-25170869
Sequence TCTCGCGGGGCGTCCTGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943454_1105943462 -1 Left 1105943454 13:25170825-25170847 CCCTGCGGGCTCACCTGCTGGGT 0: 1
1: 0
2: 1
3: 37
4: 169
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943452_1105943462 0 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943450_1105943462 1 Left 1105943450 13:25170823-25170845 CCCCCTGCGGGCTCACCTGCTGG 0: 1
1: 0
2: 3
3: 16
4: 209
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943449_1105943462 6 Left 1105943449 13:25170818-25170840 CCTCTCCCCCTGCGGGCTCACCT 0: 1
1: 0
2: 0
3: 32
4: 318
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943448_1105943462 9 Left 1105943448 13:25170815-25170837 CCTCCTCTCCCCCTGCGGGCTCA 0: 1
1: 0
2: 8
3: 73
4: 511
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1105943455_1105943462 -2 Left 1105943455 13:25170826-25170848 CCTGCGGGCTCACCTGCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1105943462 13:25170847-25170869 TCTCGCGGGGCGTCCTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943462 Original CRISPR TCTCGCGGGGCGTCCTGGCT GGG Exonic