ID: 1105943468

View in Genome Browser
Species Human (GRCh38)
Location 13:25170874-25170896
Sequence TCCGGCTCGCGCGCGGCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943464_1105943468 -9 Left 1105943464 13:25170860-25170882 CCTGGCTGGGCTCCTCCGGCTCG 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943454_1105943468 26 Left 1105943454 13:25170825-25170847 CCCTGCGGGCTCACCTGCTGGGT 0: 1
1: 0
2: 1
3: 37
4: 169
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943455_1105943468 25 Left 1105943455 13:25170826-25170848 CCTGCGGGCTCACCTGCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943459_1105943468 13 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943450_1105943468 28 Left 1105943450 13:25170823-25170845 CCCCCTGCGGGCTCACCTGCTGG 0: 1
1: 0
2: 3
3: 16
4: 209
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943452_1105943468 27 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943468 Original CRISPR TCCGGCTCGCGCGCGGCTCT GGG Exonic
900180962 1:1310759-1310781 TCTGGGTCGTGGGCGGCTCTGGG + Intronic
900236593 1:1594497-1594519 TCCGGCTGGGACGCGGCTCCAGG + Intergenic
904252707 1:29236495-29236517 TCCGGCTCGCGCTCTGGACTCGG + Exonic
909698184 1:78491028-78491050 TGCGGGGCGCGCGCGGCTCCTGG - Intronic
1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG + Exonic
1072916056 10:99537807-99537829 ACTGGCTCACGCTCGGCTCTGGG - Intergenic
1076846657 10:133072489-133072511 TCCGGCTGGAGGGCGGGTCTGGG + Intronic
1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG + Exonic
1080503594 11:32892610-32892632 TCCGGCTGGCGGGCGCCCCTCGG + Intergenic
1087076193 11:94129015-94129037 CCCGGGCCGCGCGCGGCACTCGG - Exonic
1089590008 11:119533989-119534011 TGCGGCGCACGCCCGGCTCTCGG + Intergenic
1096127726 12:49131643-49131665 TCCGACTCGCGCCCGCCCCTCGG - Intergenic
1098106072 12:67069653-67069675 TCAGCCTCGCGCGCGTCTCGGGG - Intergenic
1102253984 12:111405812-111405834 TCCGACTCGCGCGCGGCCTGAGG + Intergenic
1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG + Exonic
1115545545 14:34462348-34462370 GCCGGGGCGCGCGCGGGTCTGGG - Exonic
1124696673 15:31870041-31870063 GCGGCCTCGCGCGCGGCTCGGGG + Intronic
1130952745 15:88605291-88605313 GCCGGCTCCCGCGAGGCTGTGGG - Intergenic
1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132642406 16:983861-983883 TCCGACTCGGGCGCGGAGCTGGG + Exonic
1132719458 16:1308849-1308871 TCCCGCGCGCTCGCGGGTCTGGG + Intergenic
1132779330 16:1614276-1614298 CCCGGCGCGGGCGCGGGTCTGGG - Intronic
1148013387 17:44503572-44503594 TCCGGGTCGCGCGCGGAGCAGGG - Intergenic
1148090947 17:45022165-45022187 GCCGGCTCGGGCGCGGGCCTGGG + Intergenic
1150790312 17:68197161-68197183 TCCCTCCCGCACGCGGCTCTGGG - Intergenic
1163657837 19:18557985-18558007 TCCGGGTCGGGCGCGGCCCCCGG + Intronic
1166737150 19:45092890-45092912 TCGCGCTTGCGCGCTGCTCTTGG + Intronic
930785593 2:55268930-55268952 CCCTCCTCGCGCGCGGCTGTGGG - Intronic
937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG + Intergenic
940954420 2:159712393-159712415 TCCAGCCCGCCCGCAGCTCTCGG + Intergenic
946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG + Exonic
1181541432 22:23575058-23575080 TCCTGCTCCAGCGCGGCTCCTGG - Exonic
1181796951 22:25318262-25318284 TCCTGCTCCAGCGCGGCTCCTGG + Intergenic
1182435557 22:30327209-30327231 TCCGGCTCGCGCTCTGCAGTAGG - Intergenic
1183649168 22:39144511-39144533 TCAGGCCCGCCCGGGGCTCTGGG + Intronic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
960582783 3:119294799-119294821 ACCGGCTGCCCCGCGGCTCTGGG - Exonic
997822080 5:137075365-137075387 TCCCGCTAGAGGGCGGCTCTCGG + Intronic
1010141510 6:72620198-72620220 TCAGGGTCCCGCGCAGCTCTAGG + Intergenic
1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG + Intergenic
1019357984 7:590917-590939 TCCGGCCCGCTCTCCGCTCTCGG - Intronic
1026470999 7:70694221-70694243 TCCGGCCCGCGCTCGGCTTGCGG - Intronic
1042040021 8:64580692-64580714 CCCAGCTCGCGCGCGTCTGTGGG + Exonic
1042059087 8:64798402-64798424 TCTGGGTCGCGCGCGGCCCGCGG + Intronic
1045114964 8:98972501-98972523 TGGGGCTCGGGCGGGGCTCTGGG + Intergenic
1049180097 8:141217831-141217853 GCTGGCCCGCGCGCGCCTCTGGG - Intronic
1049791017 8:144472773-144472795 TCGGGCTCGCTCGCCCCTCTAGG + Exonic
1054527991 9:66153223-66153245 ACCTGCTGGCGCGCGCCTCTAGG - Intergenic
1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG + Intergenic
1056732491 9:89178169-89178191 GCGGGCGGGCGCGCGGCTCTCGG - Exonic
1060695699 9:125707191-125707213 TCCGGGTCGTGTGCGGCTCGGGG - Exonic
1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG + Intergenic