ID: 1105943468

View in Genome Browser
Species Human (GRCh38)
Location 13:25170874-25170896
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943450_1105943468 28 Left 1105943450 13:25170823-25170845 CCCCCTGCGGGCTCACCTGCTGG 0: 1
1: 0
2: 3
3: 16
4: 209
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943455_1105943468 25 Left 1105943455 13:25170826-25170848 CCTGCGGGCTCACCTGCTGGGTC 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943459_1105943468 13 Left 1105943459 13:25170838-25170860 CCTGCTGGGTCTCGCGGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943452_1105943468 27 Left 1105943452 13:25170824-25170846 CCCCTGCGGGCTCACCTGCTGGG 0: 1
1: 0
2: 2
3: 34
4: 226
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943464_1105943468 -9 Left 1105943464 13:25170860-25170882 CCTGGCTGGGCTCCTCCGGCTCG 0: 1
1: 0
2: 2
3: 17
4: 218
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1105943454_1105943468 26 Left 1105943454 13:25170825-25170847 CCCTGCGGGCTCACCTGCTGGGT 0: 1
1: 0
2: 1
3: 37
4: 169
Right 1105943468 13:25170874-25170896 TCCGGCTCGCGCGCGGCTCTGGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type