ID: 1105943534

View in Genome Browser
Species Human (GRCh38)
Location 13:25171174-25171196
Sequence CCCAGAGCCGCAGGGCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943534_1105943544 -8 Left 1105943534 13:25171174-25171196 CCGCCGGGCCCTGCGGCTCTGGG 0: 1
1: 0
2: 3
3: 31
4: 423
Right 1105943544 13:25171189-25171211 GCTCTGGGGGGCCCCGGGTTCGG 0: 1
1: 0
2: 0
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943534 Original CRISPR CCCAGAGCCGCAGGGCCCGG CGG (reversed) Exonic
900109779 1:1000508-1000530 CCCAGTGGCGCAGGGTCCGGCGG + Intergenic
900266446 1:1759647-1759669 CCCAGAGACACAGAGCCCAGAGG + Intronic
900373569 1:2343366-2343388 GACAGAGCCGCCGGGCCCTGGGG + Intronic
900376074 1:2355479-2355501 CCCAGAGCCTCAGAGCCTCGGGG - Intronic
900387426 1:2416933-2416955 CCCAGAGCCCCAGAGCCCCAGGG - Intergenic
900556277 1:3282443-3282465 GCCAGCGCCGCAGGGCCCCCTGG + Intronic
901086475 1:6614568-6614590 CCCCGATCCCCCGGGCCCGGTGG + Intronic
901086501 1:6614631-6614653 CCGAGAGCCGTAGGGGGCGGGGG - Intronic
902184618 1:14715840-14715862 CACAGAGACGCAGGCCGCGGTGG + Intronic
902807962 1:18872549-18872571 CCCTGAGCCACTGGGCCCAGTGG + Exonic
903034530 1:20485654-20485676 CCCAGAGCCCCAGCGCGCCGAGG - Exonic
903738190 1:25543618-25543640 CCGCGCGCCGCAGGGCCGGGCGG + Exonic
903740113 1:25553879-25553901 CCCTGAGCCGCAGGGTCTGAGGG + Intronic
905692700 1:39955009-39955031 CACAGAGCCGCCGGGCGAGGCGG + Intergenic
905881091 1:41464227-41464249 CCCAGTGCTGCAGGCCCTGGCGG - Intergenic
906609358 1:47191041-47191063 CCCTGAGCTGGAGGGCCAGGTGG - Intronic
906725364 1:48040353-48040375 GCCAGAGCCTCAGGTCCCAGAGG - Intergenic
907377210 1:54053605-54053627 CCCAGAGGCGCGAGGGCCGGCGG + Exonic
909475349 1:76075191-76075213 CACAGAGCCGCGGGACCCGCGGG - Intronic
912052095 1:105542083-105542105 CACAGAGCAGGAGGGCCCTGGGG + Intergenic
912382523 1:109255097-109255119 GCCAGAGCTGCCGGGCCAGGAGG - Intronic
912539961 1:110407416-110407438 CCCAAGGCCGCAGGGCGGGGCGG - Intronic
915332872 1:155124616-155124638 GCCAGAGCTGCAGGGCCCTGGGG - Intergenic
915510481 1:156384442-156384464 CCCAGTGCCACAGGGCACAGGGG - Intronic
917991813 1:180387886-180387908 CCCAGAGAAGCCGGGCACGGTGG + Intronic
918951997 1:191151524-191151546 CCCAGAGCCGGTGGTGCCGGCGG - Intergenic
920528371 1:206684986-206685008 CCCAGAGCGCCAGGCCCCCGGGG + Intronic
920685767 1:208108042-208108064 ACCAGAGACGCGGGGCCCCGGGG - Intronic
921060194 1:211578780-211578802 CCCACAGGCGCGGGGCTCGGCGG - Intergenic
922985865 1:229865554-229865576 CCCGGGGCCGCAGGGCCGGCCGG - Intergenic
923146625 1:231202990-231203012 AGCAGAGCAGCAGGGCCCAGGGG + Intronic
924436590 1:244048651-244048673 CGCGGAGCCGCCGGGCCGGGTGG - Intergenic
924449658 1:244166119-244166141 GAGAGAGCCGCAGGGCCAGGAGG + Intergenic
1062989722 10:1804318-1804340 ACCAGAGCCTCAGGGCACAGCGG + Intergenic
1066220838 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG + Intronic
1067519280 10:46983790-46983812 CCCAGAGCAGCAGGGGCCAGGGG - Intronic
1067642965 10:48068049-48068071 CCCAGAGCAGCAGGAGCCAGGGG + Intergenic
1067661900 10:48242337-48242359 CGCAGAGCTGCAGGGGCTGGAGG + Exonic
1067850574 10:49751436-49751458 CCCAGGGCTGCAGGGGCTGGGGG - Intronic
1069535258 10:69248324-69248346 CCCAGTCCCGGAGGGCCCTGCGG - Intronic
1069615213 10:69802455-69802477 CCCAGGGCCGCGGGCACCGGTGG - Exonic
1069782388 10:70965055-70965077 ACCAGAGCCACAGGGACCCGTGG - Intergenic
1069874697 10:71554560-71554582 CCCAGGGCTGCAGGGGCTGGAGG - Intronic
1072151736 10:92689832-92689854 CCATTGGCCGCAGGGCCCGGCGG + Intergenic
1072253818 10:93601532-93601554 GCCAGAGCCACTGGCCCCGGAGG - Exonic
1072534671 10:96353126-96353148 CCCAGAGCCAGACTGCCCGGGGG - Intronic
1072641091 10:97211740-97211762 CTCACAGCCGCCGGGCGCGGTGG + Intronic
1072804798 10:98417590-98417612 CCCAGAGGCGCCGGGCCAGCTGG + Exonic
1073577529 10:104639073-104639095 TCCAGCGCCGCAGGCCCAGGTGG - Intergenic
1075366683 10:121896691-121896713 CCCAGAGACGCAGGGGTCTGAGG + Intronic
1075505017 10:123013766-123013788 CCCGGGGCCGCAGGGCCTGCCGG + Intronic
1075651549 10:124130778-124130800 CCCAGATCCTCAGGGTCTGGAGG + Intergenic
1075700850 10:124468696-124468718 CCGAGAGCCGAAGGGCACGCTGG - Intronic
1076247961 10:128962195-128962217 GCCAGTGCAGCAGGGCCGGGCGG + Intergenic
1076358136 10:129867592-129867614 CCCAGGGCTGCAGGGCAGGGGGG + Intronic
1076855441 10:133113561-133113583 CCCAGGGCCCCAGTGCCCGAGGG - Intronic
1077043388 11:534327-534349 CCCCGGGCCGCAGGCCCCTGAGG - Exonic
1077183249 11:1225676-1225698 CACAGAGACCCAGGGCCCTGTGG + Exonic
1077368852 11:2172317-2172339 GCCACACCTGCAGGGCCCGGGGG - Intergenic
1077442216 11:2574161-2574183 CCCACAGCTGCAGGGCCAGGTGG + Intronic
1077877304 11:6319504-6319526 ACCAGAGCCCTTGGGCCCGGCGG - Exonic
1078164542 11:8871002-8871024 CCGGGAGCCGCGCGGCCCGGAGG + Intronic
1079539860 11:21560276-21560298 ACCAGAGCAGGAGGGCCCAGAGG - Exonic
1081810122 11:45909795-45909817 GCCAGAGCCACAGGGCCCTGCGG + Exonic
1081935073 11:46898652-46898674 CCCAGAGCGGCAGGGCTGGTGGG + Exonic
1082074609 11:47966672-47966694 CCCAGAGAGGCCGGGCCCAGTGG - Intergenic
1083595508 11:63916862-63916884 CTGAGAGGCGCAGAGCCCGGGGG - Intergenic
1083815593 11:65130710-65130732 CCCTGATCCGCAGGCTCCGGGGG + Exonic
1083883074 11:65557959-65557981 TCCGGGGCCGCAGGACCCGGGGG + Exonic
1083936555 11:65872697-65872719 GCCAGAGCCGCGGGCCGCGGGGG - Exonic
1084310188 11:68312434-68312456 CCCAGCGGCGCAGGTCCCCGCGG - Intergenic
1084317507 11:68353979-68354001 CCCAGATCCTCAGGGGCCAGAGG - Intronic
1084909075 11:72373058-72373080 CCCAGAGCTCCAGGGCCTGCAGG - Intronic
1086002881 11:82001981-82002003 CCCAGAGGAGCAGGGCCAGAGGG + Intergenic
1087138196 11:94740791-94740813 CCCTGAGCCGGAGGCCCCGCGGG - Intronic
1088791679 11:113232174-113232196 CCCAAAGCTACAGGGCCCTGTGG + Exonic
1090412390 11:126518257-126518279 CGCAGAGCCGCTGGGCCCTAGGG - Intronic
1091175589 11:133554721-133554743 GCCAGCACTGCAGGGCCCGGGGG + Intergenic
1091259821 11:134225096-134225118 CCGAGACCCGCCCGGCCCGGCGG + Exonic
1091445946 12:544181-544203 CCCAGAGCCTCAGCTCCAGGAGG - Intronic
1091744509 12:2982553-2982575 CCATGAGCCGCAGGGCAGGGCGG + Intronic
1092623221 12:10296778-10296800 CCCAGTACTGCAGGGGCCGGGGG - Intergenic
1094839387 12:34336610-34336632 CCCAGAGTGGCTGGGCCCTGCGG + Intergenic
1094839900 12:34338496-34338518 CCCAGAGCAGCTGGACCCAGCGG + Intergenic
1094840611 12:34341270-34341292 CCCGGAGCGGCTGGGCCCCGCGG + Intergenic
1094840726 12:34341650-34341672 CCCGGAGCAGCTGGGCCCCGCGG + Intergenic
1094841955 12:34345952-34345974 CCCGGAGCTGCTGGGCCCCGCGG - Intergenic
1094842601 12:34348372-34348394 CCCAGAGCGGCTGGGCCCCGGGG - Intergenic
1095943467 12:47740664-47740686 TCCTGAGCAGCTGGGCCCGGGGG + Exonic
1096372894 12:51083466-51083488 CCCAGGGCGGCAGGGCGGGGAGG + Exonic
1097284222 12:57865315-57865337 CCCGGAGCCGCAGTGTCCAGAGG + Intergenic
1097925326 12:65121180-65121202 TCCTGAGCAGCATGGCCCGGAGG - Exonic
1102511864 12:113421357-113421379 CCCAGCCCCCCAGGGCCAGGCGG + Intronic
1103480612 12:121247834-121247856 CCCAGAGCCCAGGGGCCCGCCGG + Intronic
1103530150 12:121595522-121595544 GCCACAGCCGCCGGGCGCGGTGG - Intergenic
1103718754 12:122962181-122962203 CCCAGAGCCGCAGGGACACCCGG + Intronic
1104210519 12:126684133-126684155 CACAGAGAAGCAGGGCCCTGAGG + Intergenic
1104768672 12:131346523-131346545 CCCTGAGGCGAAGGGCCCAGGGG - Intergenic
1105236852 13:18564558-18564580 CTCAGAGCGGCCGGGCGCGGTGG - Intergenic
1105943534 13:25171174-25171196 CCCAGAGCCGCAGGGCCCGGCGG - Exonic
1108696213 13:52904655-52904677 CCCAGAGCCGGAGAGCAGGGAGG + Intergenic
1110170883 13:72498985-72499007 CCCAGAACTCCAGGGCCCTGTGG + Intergenic
1113885591 13:113656969-113656991 CCTAGAGAGGCAGGGACCGGGGG - Intronic
1115398557 14:32934809-32934831 CCCAGAGCCGCCGCGCCCGGGGG + Intergenic
1116812954 14:49556687-49556709 CCCAGCTACTCAGGGCCCGGAGG + Intergenic
1117063935 14:51989817-51989839 CCCAGAGGAGAGGGGCCCGGAGG - Intronic
1117962579 14:61177877-61177899 CTCAGAGGCCCAGGGCACGGAGG - Intergenic
1119049722 14:71354937-71354959 CCTGGAGACCCAGGGCCCGGGGG + Intronic
1119430754 14:74566879-74566901 CCCAGAGCCTCAGAGCACTGGGG - Intronic
1119741172 14:77014532-77014554 CCCAGAGCTGCAGTTCCAGGAGG - Intergenic
1120762926 14:88302420-88302442 CCCAGAGCGGCCAGGCGCGGTGG + Intronic
1121326781 14:93024813-93024835 CCCGGAGCCACAGGGACCTGGGG - Intronic
1121463676 14:94100815-94100837 CCCAGAGGCTCAGGGCTGGGGGG - Intronic
1121818208 14:96944236-96944258 CCCGGAGCCCCAGGGACCCGAGG - Intergenic
1122113416 14:99516395-99516417 CCCTGAGCCGCTGGGCCCCTGGG + Intronic
1122582193 14:102777751-102777773 CCCTGGGCGGCGGGGCCCGGGGG + Intronic
1122666742 14:103334916-103334938 CCGAGAGCCGGCGGCCCCGGAGG - Intronic
1122848527 14:104513862-104513884 CCCAGAGAAGCAGGGGCTGGTGG + Intronic
1122982058 14:105196445-105196467 CCCAGCGCCGCAGGATCTGGAGG + Intergenic
1123193454 14:106593197-106593219 CCCAGAGCTGCAGGGTCAGCTGG + Intergenic
1123199005 14:106643656-106643678 CCCAGAGCTGCAGGGTCAGCTGG + Intergenic
1123665729 15:22608484-22608506 CCTGGAGCCCCAGGGCCTGGGGG - Intergenic
1123752031 15:23364168-23364190 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124187856 15:27545473-27545495 CTGAGAGTCGCAGGGCCAGGTGG + Intergenic
1124284397 15:28388093-28388115 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124298300 15:28523521-28523543 CCTGGAGCCCCAGGGCCTGGGGG - Intronic
1124482961 15:30092533-30092555 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124489413 15:30144604-30144626 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124520616 15:30404685-30404707 CCTGGAGCCCCAGGGCCTGGGGG - Intronic
1124538041 15:30561534-30561556 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124544501 15:30613595-30613617 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124564464 15:30801030-30801052 CCTGGAGCCCCAGGGCCTGGGGG + Intergenic
1124754115 15:32393723-32393745 CCTGGAGCCCCAGGGCCTGGGGG - Intronic
1124760609 15:32446051-32446073 CCTGGAGCCCCAGGGCCTGGGGG - Intronic
1124778024 15:32603011-32603033 CCTGGAGCCCCAGGGCCTGGGGG + Intronic
1124962405 15:34408812-34408834 CCCAGAGCAGCAGCCCACGGGGG + Intronic
1124979029 15:34555034-34555056 CCCAGAGCAGCAGCCCACGGGGG + Intronic
1125674823 15:41496192-41496214 CCCAGAGCCGCACAGCGCGCCGG + Intronic
1125932744 15:43611949-43611971 CCCAGACCCGCAGCTCCCGGGGG + Exonic
1125945843 15:43711411-43711433 CCCAGACCCGCAGCTCCCGGGGG + Intergenic
1126837139 15:52679027-52679049 CCGAGAGGCGCAGGGCCAGCGGG + Intronic
1127880940 15:63157803-63157825 CCGAGAGCGGCCGGGCCAGGGGG - Intronic
1128945028 15:71814007-71814029 CCCAGAGACGCGGGGCCTGAAGG + Exonic
1129260640 15:74365383-74365405 CTCAGAGCCTCAGGGCCAAGGGG + Intronic
1129461600 15:75702642-75702664 TCCAGAGCCCCAGGGCTCAGAGG + Intronic
1129466705 15:75728216-75728238 CACAGAGCAGCAGGGGCCTGGGG + Intergenic
1129776654 15:78241293-78241315 CCCAGAGCCTCAGCGCCCTCTGG - Intronic
1132079784 15:98854167-98854189 CCCAGAACCTCATGGCCCCGGGG - Intronic
1132097409 15:98997994-98998016 ACCAGATCCGCAGGGGCAGGGGG - Intronic
1132299989 15:100769268-100769290 CCCAGAGCCCCAGGGAGCGATGG + Intergenic
1132530565 16:446340-446362 CCCAGAGAGGCAGGGCACTGAGG + Intronic
1132542807 16:519194-519216 CCCACAGGAGCAGGGCCCAGAGG + Intronic
1132683727 16:1153792-1153814 ACCAACGCCGCAGGGCCAGGGGG - Exonic
1132810759 16:1795535-1795557 TGCAGAGCCACAGGGCTCGGTGG - Intergenic
1132887155 16:2187318-2187340 CCCAGGGGCGCTGGGCCCAGTGG - Intronic
1133277443 16:4647297-4647319 CCCCGTGCCTCAGGGCACGGTGG - Intronic
1133924689 16:10182986-10183008 CCCAGCAGCGAAGGGCCCGGAGG - Intergenic
1136710738 16:32234580-32234602 TGCAGAGCTTCAGGGCCCGGCGG - Intergenic
1136757173 16:32694831-32694853 TGCAGAGCTTCAGGGCCCGGTGG + Intergenic
1136810936 16:33175544-33175566 TGCAGAGCTTCAGGGCCCGGTGG - Intergenic
1136817412 16:33285624-33285646 TGCAGAGCTTCAGGGCCCGGTGG - Intronic
1136823976 16:33342153-33342175 TGCAGAGCTTCAGGGCCCGGTGG - Intergenic
1137000025 16:35221644-35221666 CCCAGTGCAGCAGGGCGCAGTGG - Intergenic
1138105229 16:54284414-54284436 CCGGGAGGGGCAGGGCCCGGGGG - Intronic
1138641702 16:58392832-58392854 CCCAGGGCCGAGGGGCCCGCCGG - Intronic
1139516334 16:67454451-67454473 GGCAGAGCAGAAGGGCCCGGGGG + Intronic
1139699472 16:68698832-68698854 CCCAGAGCTGCTGGGCCCACTGG + Exonic
1139710293 16:68770795-68770817 CCCAGTGTGGCAGGGCCTGGTGG + Intronic
1139853768 16:69965412-69965434 GCCACGGCCGCAGCGCCCGGAGG + Intergenic
1141699984 16:85637947-85637969 CCCAGAGCTGCAGGGGGAGGTGG + Intronic
1142109466 16:88323565-88323587 CCAAGAGCCTCAGGACCCTGTGG + Intergenic
1142159652 16:88550449-88550471 TCCGGAGCGGCATGGCCCGGAGG + Intergenic
1142227392 16:88884280-88884302 GACAGAGGCCCAGGGCCCGGTGG - Intronic
1203059322 16_KI270728v1_random:955182-955204 TGCAGAGCTTCAGGGCCCGGCGG + Intergenic
1142687551 17:1586407-1586429 CCCAGAACGGCTGGGCGCGGTGG + Intronic
1142689797 17:1598689-1598711 AACAGAGCCACAGGGCCCTGGGG + Intronic
1142808638 17:2385045-2385067 CCCAGAGCCACGGGGTCTGGCGG + Exonic
1142881580 17:2885996-2886018 CCCAGAGCAGGAGGCCCCAGGGG - Intronic
1142900445 17:3008231-3008253 CCCAGAGCCCAAGGGCCAGCTGG + Intronic
1143016370 17:3893058-3893080 CCCGGAGCCGCGGCGCCCGCGGG - Intronic
1143081241 17:4383009-4383031 CCGTGAGCCACAGAGCCCGGCGG + Intergenic
1143470768 17:7173902-7173924 CCCAGGGCCCCAGGGCGCGAAGG + Intronic
1144604561 17:16653487-16653509 CCCAGCGCCGCCAGGCCCGCAGG + Intronic
1145752170 17:27363002-27363024 CCCAGAGCCCCAAGGCCAGTGGG + Intergenic
1145941078 17:28743783-28743805 CCCAGAGCCCGCGGGCCCCGGGG - Intergenic
1146886300 17:36473183-36473205 CCCAGAGGAGCAGGGCCAGTGGG + Intergenic
1147143017 17:38469674-38469696 CCCAGAGCAGCTGGCCACGGTGG - Intronic
1147364282 17:39950403-39950425 CCCAGAGGGACAGGGCCCTGTGG - Intergenic
1147364561 17:39951748-39951770 CCCAGAGGGACAGGGCCCCGTGG - Intergenic
1147867241 17:43561099-43561121 TCCAGAGGCGCAGGGCAAGGAGG + Intronic
1147975987 17:44248341-44248363 CCCAGAGTCGGGGGTCCCGGGGG - Intergenic
1148152587 17:45405265-45405287 CCCACAGCCCCAGGGACCAGAGG - Intronic
1148392344 17:47281591-47281613 CCCAGAGCCCCAGGGGGCCGTGG + Intronic
1148726379 17:49793856-49793878 ACCAAAGCAGCAGGGCGCGGTGG - Intronic
1148764538 17:50029401-50029423 CTCTGAGCCTCAGCGCCCGGGGG + Intergenic
1148800303 17:50220988-50221010 TCCTGAGCGGCAGGGCCTGGGGG - Intergenic
1150227536 17:63532030-63532052 CCCAGAGCTGCAAGGCCCTCAGG - Intronic
1151434419 17:74086152-74086174 CCTATAGCCGCAGGGCATGGGGG - Intergenic
1152318780 17:79596370-79596392 CAGAGAGCCCCAGGGCCTGGGGG - Intergenic
1152407781 17:80107462-80107484 CCCAGGGCACCAGGGCCCGGGGG + Intergenic
1152657849 17:81528207-81528229 CCCAGAGCCCGAGGGCCTGAGGG - Intergenic
1152718523 17:81911301-81911323 CGCAGAGCAGCCGGGCCCGGGGG - Exonic
1152965850 18:112515-112537 CCCAGAAACGGAGGCCCCGGGGG - Intergenic
1154145704 18:11864652-11864674 CCCAGAGCCGAAGGGCTGTGAGG + Intronic
1154204973 18:12328535-12328557 CCCAGAGAGCCAGGGCCCAGGGG + Intronic
1155298946 18:24411118-24411140 CCCATAGCCGGTGGGCACGGTGG - Intergenic
1156495845 18:37524762-37524784 CCCCGAGCCGCAGGCCGCTGGGG + Intronic
1157077228 18:44479322-44479344 TACAGAGCAGCAGGGCCCTGGGG - Intergenic
1158976723 18:62716502-62716524 CCCGGAGCCGCGGGACTCGGAGG + Exonic
1159618167 18:70606449-70606471 TCCAGAGCGGCCGGGCGCGGTGG + Intergenic
1160419600 18:78735089-78735111 CCCAGAGCAGGAGGGCTTGGAGG - Intergenic
1160691027 19:460786-460808 ACCCGAGCCGGCGGGCCCGGGGG - Exonic
1160701588 19:510084-510106 CCCAGAGCAGCCGGGCGCGGTGG + Intronic
1160707415 19:536037-536059 CCCAGCGCCCCGGGTCCCGGAGG - Intronic
1160707455 19:536171-536193 CCCAGTGCCCCAGGTCCCGGAGG - Intronic
1160844944 19:1162050-1162072 CCCACAGCCTCGGGGCCAGGAGG - Intronic
1160847409 19:1172682-1172704 CCCAGGGCCGCAGACCCCGTGGG - Intronic
1161169724 19:2806788-2806810 CCGAGAGGGGCAGGGACCGGAGG + Intronic
1161238256 19:3208457-3208479 CGCAGAGGCACAGGGGCCGGAGG - Exonic
1161620394 19:5294039-5294061 CCCAGACCCCCAGGTCCCGCTGG - Intronic
1161650248 19:5479980-5480002 CCCAGAGCCCCAGCCACCGGCGG + Intergenic
1161778555 19:6277184-6277206 CACAGAGCCGGAGGCCCCTGGGG - Intronic
1161965368 19:7544879-7544901 CCCAGATAAGCAGGGCCCAGGGG - Intronic
1162264736 19:9562449-9562471 CACAGAGCAGCCGGGCACGGTGG - Intronic
1163113890 19:15178027-15178049 CCGGGAGCTGCAGTGCCCGGTGG - Exonic
1163314007 19:16530659-16530681 CCCAGAGCTGCAGGAGCTGGCGG + Exonic
1163842265 19:19618626-19618648 CCATGAGCGGCAGGGCCGGGCGG + Exonic
1164466419 19:28490975-28490997 CTCATATCGGCAGGGCCCGGTGG + Intergenic
1164592954 19:29516188-29516210 CCCAGAAGCGCAGGGTCAGGTGG - Intergenic
1165062037 19:33209539-33209561 CCCAGACCCCCAGGGGTCGGGGG - Intronic
1165783781 19:38448777-38448799 CGCCGAGCCGCAGGGCCTTGGGG - Exonic
1165950275 19:39470388-39470410 AGCAGAGCTGCAGGTCCCGGGGG - Exonic
1166275438 19:41750392-41750414 CCCAGAGCTGCAGGTCCCAGAGG - Intronic
1166280463 19:41789189-41789211 CCCAGAGCTGCAGGTCCCAGAGG - Intergenic
1166331298 19:42079469-42079491 GCCGGGGGCGCAGGGCCCGGAGG + Exonic
1166360112 19:42249468-42249490 CCCAGATCCGGAGGGCCGGGTGG + Exonic
1166682624 19:44778140-44778162 CCCAGAGCCGCCGGGACCCCCGG - Exonic
1166802624 19:45467805-45467827 CCGAGACCCCCAGGGCCCCGAGG + Intronic
1166854740 19:45777911-45777933 CCCAGAGCTGGTGGGCCCAGAGG - Intronic
1166873582 19:45884601-45884623 CCCCGAGCCGGAGGGCGAGGCGG - Exonic
1166976335 19:46607212-46607234 CCCTGAGCCTCTGGGCCCTGGGG - Intronic
1167162605 19:47778163-47778185 CCTGCAGCCGCAGGGCGCGGTGG - Intergenic
1167240556 19:48340752-48340774 CTCAGAGCCGCAGGGAGCTGTGG - Intronic
1168112996 19:54205237-54205259 CCCACAGCCCCAGGGCCCTGGGG - Intronic
1168120202 19:54247693-54247715 CCCAGCACAGCAGGGCCTGGGGG + Intronic
1168271072 19:55250096-55250118 CCCAGACCCGCAGGGCCTCCTGG - Intronic
1168645025 19:58054073-58054095 CCCAGGGACTCAGGGCCGGGTGG - Exonic
925293437 2:2763143-2763165 CTCTGAGCCTCAGGGCCCTGAGG + Intergenic
925366232 2:3313975-3313997 CCCTGAGCCGCTGGGACCCGGGG + Intronic
925612912 2:5718188-5718210 CGCAGAGCCGCTGGGGCAGGAGG + Intergenic
926107300 2:10160428-10160450 CTCAAAGCTGCAGGGCCCGATGG - Intronic
926205264 2:10831006-10831028 CCCTGAGCCACAGGGGCTGGCGG + Intronic
927148086 2:20179947-20179969 CCCAGTGGGGCAGGGCCAGGCGG + Intergenic
927256400 2:21044047-21044069 CTCAGCCCCGCAGGTCCCGGTGG + Exonic
928312156 2:30220103-30220125 CCCAGAGAGGCAGGGCCCCTCGG - Intergenic
929031510 2:37653860-37653882 AACAGAGCCGCAGGTCCCTGGGG - Intronic
930753546 2:54954336-54954358 CCCAGGGTCCCAGGGCCAGGAGG + Intronic
931044555 2:58336121-58336143 CCCAGAGACACAAGGCCAGGGGG + Intergenic
932620245 2:73260776-73260798 CCCCGACCCCCAGGGCCCGCAGG + Exonic
932687796 2:73887929-73887951 TACAGAACCGCAGGGCACGGTGG + Intergenic
932761269 2:74440540-74440562 GGCGGAGCCGCAGGGCCTGGCGG - Intronic
935088862 2:99875244-99875266 CCCAGAACCACAGGCCTCGGGGG - Intronic
935301693 2:101698235-101698257 GGCAGAGCCGCGGGGCGCGGCGG + Intronic
935622823 2:105144083-105144105 CCCCGAGCCGCAGCTGCCGGGGG - Intergenic
936777700 2:115994192-115994214 CCCAGGGCAGCAGGGCCCTGAGG - Intergenic
937221249 2:120344394-120344416 CCCAGAGCGGCAGCCGCCGGCGG + Intergenic
937380312 2:121370732-121370754 GGCAGAGCTGCAGGGCCAGGAGG - Intronic
937885793 2:126899301-126899323 CCAAGAGCCCCAGGGCCTTGGGG + Intronic
938209696 2:129457520-129457542 CCCTGAGCCACAGGGCTAGGTGG - Intergenic
941462963 2:165793656-165793678 CCCTGAGAGGGAGGGCCCGGCGG - Intronic
941951273 2:171160127-171160149 CCCAGAGCCGGGGAGCCGGGCGG + Intronic
943033793 2:182716166-182716188 CCCACCGCCGCAGCGCCCGCTGG + Intronic
943185303 2:184598886-184598908 CCCACAGCCGCAGCGCGCCGGGG - Exonic
944857948 2:203785836-203785858 CCCAGGCCCGCAGGGCCGGCCGG + Intergenic
946154058 2:217795808-217795830 CCCAGCTCCGCAGGCCCTGGAGG + Intergenic
946644093 2:221815235-221815257 CACAGAGCAGCAGGGCCCTGTGG - Intergenic
947118544 2:226796056-226796078 TCCAGAGCCCAAGAGCCCGGGGG - Exonic
947715541 2:232337280-232337302 ACCAGCTCCGCAGGGCCTGGTGG + Intronic
947734570 2:232448029-232448051 ACCAGCTCCGCAGGGCCTGGTGG + Intergenic
948206092 2:236163605-236163627 CCCCGACCCGCAGGGCCGGCGGG + Intergenic
948611285 2:239168751-239168773 CGCAGGGCCGCAGGCCCCTGTGG - Intronic
948823104 2:240560368-240560390 CCCAGTGCCACAGGCCGCGGGGG + Exonic
948831761 2:240601784-240601806 CCCAGTGCAGCAGGTCCTGGAGG - Intronic
948880128 2:240852403-240852425 CCCAGAGCAGCAAGGCCTGCTGG - Intergenic
949027693 2:241774134-241774156 CCCAGGGCCCCAGGGCCCCAGGG - Intergenic
1171133467 20:22676019-22676041 GCCAGACCCGCCGGGCGCGGTGG - Intergenic
1172037210 20:32018845-32018867 CCCAGAGCCGCGAGGTCAGGTGG + Intronic
1172581329 20:36050880-36050902 CCCGGGGCCGGAGGGCCTGGAGG + Intergenic
1172811301 20:37650086-37650108 CCCTGAGCCCCAGGGCTTGGGGG + Intergenic
1172992664 20:39047832-39047854 TCCCGAGCCCCAGGGCCAGGCGG - Intergenic
1173165325 20:40683520-40683542 CCGCGAGCCGCAGGGAGCGGTGG + Intergenic
1173279704 20:41617907-41617929 CCCAGCGCGGCTGGGCCCGGGGG + Intronic
1173363611 20:42366111-42366133 CCCAGGGCAGCAGGGCCTTGTGG + Intronic
1175162387 20:57018741-57018763 CCAAGAGCGGGAGGCCCCGGAGG + Intergenic
1175392259 20:58634972-58634994 CACAGAGCAGCAGGCCCCAGAGG + Intergenic
1175561525 20:59934063-59934085 CCCAGAGCCACTGGGACCCGCGG + Intronic
1175994247 20:62805178-62805200 CCCCCAGCCCCAGGGCCCGGCGG + Intronic
1176172825 20:63703857-63703879 CCCAGAGCCCCACGCCCCAGTGG + Intronic
1176228130 20:64015301-64015323 CCCAGACCCTCAGGGGCCTGCGG - Intronic
1177779552 21:25607700-25607722 CCCAGAGGTGCAGGGCCCCCAGG + Intergenic
1178521008 21:33288540-33288562 CCCAAAGCCCCAGGTCCCTGAGG + Intronic
1178948421 21:36966729-36966751 CCCCGCGCCGCCTGGCCCGGGGG - Intronic
1179968136 21:44818399-44818421 CCCATGGCCGCAGGGACCTGGGG + Intronic
1180039016 21:45266290-45266312 CACAGAGCCACAGGGCCAGCAGG + Intronic
1180649863 22:17369273-17369295 CCCAGATCCGCAGGACCCAGGGG - Intronic
1181032052 22:20153018-20153040 CCCAGAGGCGCAGGGATCAGAGG - Intergenic
1181329648 22:22079958-22079980 CCCAGAGCCCCAGGGACTGAGGG - Intergenic
1181694993 22:24588548-24588570 TCCAGTCCCGCAGTGCCCGGCGG + Intronic
1181954620 22:26579408-26579430 CCCACAGCCCTGGGGCCCGGTGG + Intronic
1182808615 22:33096850-33096872 TCCAGATCCGCCGGGCGCGGTGG - Intergenic
1183228101 22:36563785-36563807 CCCAGGGAGGCAGGGCCCGCTGG + Intergenic
1183739073 22:39660133-39660155 CCCAGAGCCTCAGAGAACGGAGG - Intronic
1183862360 22:40679339-40679361 TGCAGAGCCCCAGGGCCCTGGGG - Exonic
1184035108 22:41914526-41914548 CCCCGAGGCGCAGGGTCCCGCGG - Exonic
1184411503 22:44328883-44328905 CCCAGACCCGCAGGTCCAGAAGG + Intergenic
1184651719 22:45922387-45922409 CCCACCGCCCCAGGGCCCAGCGG + Exonic
1184671344 22:46013664-46013686 CCCAGGGCTGCAGGTCCTGGCGG - Intergenic
1184723835 22:46331760-46331782 GCCAGAGTCGCCGGGCCCGTGGG + Intronic
1185338361 22:50280803-50280825 CCCTGAGCCGCGGCGGCCGGTGG - Exonic
1185345079 22:50307456-50307478 CCCAGCGCGGCAGGCCCGGGCGG + Intronic
950028302 3:9835296-9835318 TCCAGAGGCGCAGGGGCCTGGGG + Exonic
950480277 3:13239495-13239517 CCCAGGGCCTCACGGCCAGGAGG - Intergenic
951868508 3:27334022-27334044 CACAGAACTGCAGGGCCCTGAGG + Intronic
953705218 3:45225832-45225854 CCCCGAGCGCCCGGGCCCGGAGG - Exonic
953897353 3:46812457-46812479 CCCAGAGCGGCAGCTCCCTGGGG - Exonic
953998120 3:47536235-47536257 GCCAGAGCTCCAGGACCCGGGGG - Intergenic
959530697 3:107431432-107431454 CCCAGAGCGCCCGGGCCCAGGGG - Intergenic
961324627 3:126102924-126102946 CCCAGAGGGGCAGAGCCAGGTGG + Intergenic
961377223 3:126475313-126475335 CCCCGAGCCGCAGTGCGCGCTGG - Exonic
961378483 3:126482344-126482366 CTCAGAGCTGCAGGGCCTGCTGG + Exonic
961484928 3:127209862-127209884 CTCAGTGCCTCAGGGCCCAGAGG - Intergenic
961654770 3:128435249-128435271 GCCAGAGGGGCAGGGCCCAGGGG - Intergenic
961656886 3:128447657-128447679 CCCAGAGCAGCATGGCTGGGTGG + Intergenic
962235384 3:133702227-133702249 CCCAGAGCTGGAGGGGCCTGTGG - Intergenic
966732524 3:183162783-183162805 CCCAGGGCCGCTGGGCGGGGAGG + Exonic
966732555 3:183162866-183162888 CCCAGAGGCCCGGGCCCCGGCGG - Exonic
966908893 3:184547008-184547030 ACCAAAGCCGCCGGGCGCGGTGG - Intronic
967981679 3:195069675-195069697 CCCAGATCTGGAGGCCCCGGGGG + Exonic
968516634 4:1018282-1018304 CCCACAGCAGCAAGGCCCAGAGG - Intronic
968616493 4:1579799-1579821 CCCAGCGCTGCGGGGCCCGCAGG + Intergenic
968662416 4:1804238-1804260 CCCAGAGCCGCAGGCACCACTGG - Intronic
969056708 4:4407051-4407073 CCCAGGGCCGCAGTGCCCACAGG - Intronic
969343832 4:6558945-6558967 ATCAGAGCCGCAGGGCTGGGTGG - Intronic
969348110 4:6581778-6581800 CCCAGTGCCCCAGGCCCTGGCGG - Intronic
969520634 4:7675894-7675916 CCCAGAGCAGCCGAGCCAGGAGG + Intronic
969533738 4:7743126-7743148 CCCAGAGGCTGAGGGCCTGGAGG + Intergenic
974870782 4:67638379-67638401 CACAGAGGCGAAGGGCACGGGGG - Intronic
978618222 4:110615925-110615947 TCTGGAGCCGCAGGGCCCAGCGG - Intergenic
979487263 4:121283534-121283556 CCCAGGGCCCCAGGGCCCCAAGG + Intergenic
980619010 4:135272540-135272562 CCCAGAGAGGCCGGGCGCGGTGG - Intergenic
983232301 4:165141429-165141451 CCCAGAGCCTCAGGGGGCTGAGG - Intronic
983924977 4:173390774-173390796 CCCAGTGAGGCTGGGCCCGGTGG - Intronic
985574375 5:666667-666689 CTCAGAGGTGCAGAGCCCGGTGG + Intronic
985695680 5:1338826-1338848 CCCAGAGCTGGAGCGCCGGGGGG - Intronic
985749332 5:1665443-1665465 CCTACAGCTGCAGGGCCAGGCGG - Intergenic
985865306 5:2509652-2509674 CCCCAAGCCGCAGGGCCTAGAGG + Intergenic
986192488 5:5510065-5510087 CCCAGAGGCGCTGGACCCAGTGG - Intergenic
986858843 5:11903816-11903838 CCCAAAGGCGCGGCGCCCGGCGG + Exonic
991926490 5:71710245-71710267 TCCAGAGAGGCAGGGCCTGGGGG - Intergenic
994620328 5:102155038-102155060 CCCGGGGCCGCAGGGCCGGCAGG - Intergenic
995379120 5:111512544-111512566 CCCAGCGCCTCAGGGCAAGGCGG + Intronic
996046783 5:118882784-118882806 CACAGAGCAGCAGGGCCCTGGGG + Intronic
999132896 5:149298136-149298158 CCCGGAGCTGCAGGGCCTGGAGG - Intronic
999223574 5:150001124-150001146 CCCGGAGGCGCTTGGCCCGGCGG - Exonic
1001920716 5:175597186-175597208 CCCAGCGTCCCAGGCCCCGGGGG - Intergenic
1002076657 5:176712482-176712504 ACCAGAGCCCCAGGGCACAGAGG - Intergenic
1002094780 5:176824301-176824323 ACCAGAGCCTCAGGGCCTCGGGG - Intronic
1002326137 5:178407817-178407839 AACAGAGCCGCAGGGACCTGTGG + Intronic
1002540278 5:179902287-179902309 CACACAGCTGCAGGGCCTGGAGG - Intronic
1002613712 5:180437349-180437371 ACCAGAGAGGCCGGGCCCGGCGG + Intergenic
1003518015 6:6833867-6833889 CCCAAGGCCGCAGGACCCAGTGG + Intergenic
1004996225 6:21195795-21195817 TCCAGAGTGGCCGGGCCCGGTGG - Intronic
1005682356 6:28219033-28219055 TCGAGAGACGCAGGGCCAGGAGG - Intergenic
1006305348 6:33215253-33215275 CCCAGAGCCTCAGGGCCCTGAGG + Intergenic
1006333995 6:33411060-33411082 CCCAGAGCCGCCGGGACGGAGGG + Exonic
1006458480 6:34144920-34144942 CCCGGAGCCCTAGGGGCCGGAGG - Intronic
1007170994 6:39863464-39863486 CTGAGAGCTGCAGGGCCCGCTGG + Intronic
1007240301 6:40420093-40420115 CCCACAGCCGCAGAGCACAGCGG + Intronic
1007473478 6:42105079-42105101 GCCAGAGCCCCAGGCCCCTGTGG - Exonic
1010204554 6:73310445-73310467 GCCAGAAACGCAGGGGCCGGGGG + Intergenic
1010781079 6:79947067-79947089 CCGAAAGCCGCAGGGCGCGGGGG + Intronic
1012549056 6:100451193-100451215 CCCAGAGCCTGAGTGACCGGAGG + Intronic
1013419080 6:109949859-109949881 CCCAGCGCCGCAGGGCTGAGGGG + Intergenic
1014055874 6:117014855-117014877 CCCAGGGCTGCAGGGCCGGCCGG - Intergenic
1015994910 6:138987829-138987851 GCCCGAGCAACAGGGCCCGGAGG + Exonic
1017962497 6:159233858-159233880 CCCACAGGCGCAGGGGCAGGTGG + Exonic
1018063997 6:160113091-160113113 CCCAGAGGCACAGGGCCTTGGGG - Intronic
1018167051 6:161107993-161108015 CCCAGAGCCGCCAGGCCCAAAGG - Intronic
1018836509 6:167488253-167488275 CCCAGAGCCGCACCTGCCGGGGG - Intergenic
1019003897 6:168779986-168780008 CCCTGAGCCTGAGGGCCCAGTGG + Intergenic
1019120725 6:169801626-169801648 CAAAGAGCCCCAGGCCCCGGGGG + Intergenic
1019516408 7:1442142-1442164 CCCAGAGCTGCGGGCCCCCGGGG + Intronic
1019727755 7:2612448-2612470 CCCACGGCCCCAGGGCCTGGGGG + Exonic
1023876066 7:44286970-44286992 ACCAGGGGTGCAGGGCCCGGGGG + Intronic
1026669252 7:72373242-72373264 CACAGAGCCTCAGGGGCCTGTGG + Intronic
1029305578 7:99617189-99617211 TCCAGACCCGCAGGGCCTCGGGG - Intronic
1029666405 7:101997886-101997908 CCCAGTGCTGCTGGGCCCTGTGG + Intronic
1030227638 7:107169684-107169706 CGCGGAGCCGCTGGGCCCCGGGG + Intronic
1031011014 7:116525528-116525550 CCCAGACCGGCAGGTCCCGCAGG + Intronic
1031986784 7:128168593-128168615 CCCATAGCCGCAGCTTCCGGCGG + Intergenic
1032193469 7:129777408-129777430 CCAAGTGCCGCAGTGCCTGGGGG + Intergenic
1033278020 7:139987301-139987323 ACCAGAGCCCCAGGGTCCCGGGG + Intronic
1033283142 7:140019787-140019809 CCCAGAGCCCCTGGGCCAGAGGG + Intronic
1034210570 7:149358878-149358900 CCCAGGGCAGCAGGCTCCGGGGG + Intergenic
1035567167 8:649507-649529 CTCAGAGCCCCTGGGCCCCGGGG + Intronic
1036559383 8:9888676-9888698 CCCAGTGCCCCAGGGACAGGCGG - Intergenic
1037564893 8:20109663-20109685 TCCAAAGTCTCAGGGCCCGGGGG + Intergenic
1037769272 8:21789356-21789378 CCCAGCGGCGCAGGGGGCGGGGG - Intronic
1038483832 8:27919741-27919763 CCCACAGCCGCAGGGCCAGGAGG - Intronic
1039680515 8:39730456-39730478 CCCAGAGCTTCAAGGCCAGGCGG + Intergenic
1040652489 8:49464892-49464914 CCGAGAGCTGCAGGGCGCGGTGG + Intergenic
1040870977 8:52100282-52100304 GCCAGGGTAGCAGGGCCCGGGGG - Intergenic
1040945937 8:52883937-52883959 CACAGAGCAGCAGGGTCCTGGGG + Intergenic
1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG + Intronic
1045437043 8:102173826-102173848 CCCAGGGCAGCGGGGCCCTGGGG + Intergenic
1045638726 8:104223519-104223541 GCCAGAGCCTCAGGGTCCCGTGG + Intronic
1046811654 8:118539594-118539616 CCCAGAGCCACAGGGTCCTGGGG + Intronic
1047038346 8:120964804-120964826 CCAACAGCCTCAGGACCCGGGGG + Intergenic
1047262311 8:123274169-123274191 CCCAGAGTCTCCGGGCCCGCTGG + Exonic
1047766798 8:127996720-127996742 CCCACAGCAGCAGGGGGCGGCGG - Intergenic
1048943859 8:139426689-139426711 CCCAGAGCCGGAGGCCCTGTGGG - Intergenic
1049358291 8:142199473-142199495 CCCAGAGCCACAGGCCCAGCAGG - Intergenic
1049552719 8:143267834-143267856 CCCAGCGCCGCACCGCCGGGCGG + Intronic
1049643845 8:143727486-143727508 CCCAGAGCGCGAGGGCCCGGAGG - Exonic
1051282886 9:15460676-15460698 CCCAAAGCAGCCGGGCGCGGTGG - Exonic
1053453194 9:38210653-38210675 CACACAGCAGCAGGGCCCTGAGG - Intergenic
1053800762 9:41762991-41763013 CACAGAGCCCAAGCGCCCGGTGG + Intergenic
1057227768 9:93301585-93301607 CCCAGAGACGCAGGGGTGGGGGG - Intronic
1057295054 9:93829948-93829970 GCCAGTGCAGCAGGGCCCGGGGG - Intergenic
1057333950 9:94141724-94141746 CCCAGACCCGCAGAGCCCGCTGG + Intergenic
1057428174 9:94971092-94971114 CCCAGAGCCAGAGGGCTCAGGGG - Intronic
1057505002 9:95626620-95626642 CCCAGAGCCACAGAGACCAGAGG - Intergenic
1057785600 9:98085257-98085279 CCCTGAGCAGTAGGGCCTGGTGG + Exonic
1057869519 9:98707981-98708003 CCCAGGGCCGGAGGGGCCGCGGG - Intronic
1057914509 9:99045452-99045474 CCCAGAGCCGTAAGGCCAGAAGG - Intronic
1060811205 9:126612506-126612528 CCCTGCGCCGCGGGGCCCCGCGG - Intergenic
1061448590 9:130656251-130656273 CCCAGATCCTCAGAACCCGGGGG - Intergenic
1061825683 9:133256905-133256927 CCCAGAGTCCCAGGGCCTTGTGG + Intronic
1061845331 9:133385040-133385062 CCCAGAGCCGCACGCCGCCGTGG + Intronic
1061900564 9:133669980-133670002 CCCAGGCCAGCAGGGCCCGTGGG - Intronic
1061951059 9:133935996-133936018 CCCAGAGTGGCGGGGCCCTGGGG + Intronic
1061955615 9:133959830-133959852 CCCAGAGCCGCAGGAGGTGGGGG + Intronic
1062018028 9:134301545-134301567 CCCAGAGACACAGGGCAGGGAGG - Intergenic
1062068268 9:134540541-134540563 GACAGAGCCCCAGGGCCCTGAGG + Intergenic
1062068270 9:134540548-134540570 CCCAAAGCCTCAGGGCCCTGGGG - Intergenic
1062252782 9:135606620-135606642 CCCAGAGGCCCAGGGCTCTGGGG - Intergenic
1062269446 9:135701917-135701939 CCCAGGGGTGTAGGGCCCGGTGG + Intergenic
1062447290 9:136600284-136600306 CTCAGAGCCGCAGAGCACAGGGG + Intergenic
1062646648 9:137551419-137551441 CCCAGAGGAGCCGCGCCCGGCGG + Exonic
1187181512 X:16947148-16947170 CACAGACCCGCAGGGACAGGAGG - Intronic
1189153499 X:38730867-38730889 CCAGGATCCGCAGGGCCTGGTGG + Intergenic
1190226025 X:48545920-48545942 CCCAAATCCGCTGGGCACGGTGG + Intronic
1195636206 X:107118545-107118567 CCCACAGCAGCCGGCCCCGGTGG + Intronic
1196305226 X:114094861-114094883 ACCAGAGCCTCAGGGACCTGTGG - Intergenic
1198533454 X:137566290-137566312 CACAGAACCGCGGGGCCAGGAGG - Exonic
1199849428 X:151714834-151714856 CCCAGAGCCCCTGGGCCAGGTGG - Intergenic
1200250874 X:154553039-154553061 CCCAGAGCTGCAGGGAGGGGCGG + Intronic
1200304209 X:155008321-155008343 CCCAGAGCTGCAGGGAGGGGCGG - Intronic