ID: 1105943534

View in Genome Browser
Species Human (GRCh38)
Location 13:25171174-25171196
Sequence CCCAGAGCCGCAGGGCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105943534_1105943544 -8 Left 1105943534 13:25171174-25171196 CCGCCGGGCCCTGCGGCTCTGGG 0: 1
1: 0
2: 3
3: 31
4: 423
Right 1105943544 13:25171189-25171211 GCTCTGGGGGGCCCCGGGTTCGG 0: 1
1: 0
2: 0
3: 16
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105943534 Original CRISPR CCCAGAGCCGCAGGGCCCGG CGG (reversed) Exonic