ID: 1105946745

View in Genome Browser
Species Human (GRCh38)
Location 13:25196887-25196909
Sequence GTGGGTTCGCTCCCCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105946745 Original CRISPR GTGGGTTCGCTCCCCACTCC AGG Intergenic
900291939 1:1927367-1927389 GTGGCTTTGCTCCCCACCCGTGG + Intronic
900885580 1:5413122-5413144 GTGGGTTAGTTCCCCTCTCGAGG - Intergenic
902429437 1:16352028-16352050 GTGGGTTCGCTCCCAACCCAAGG + Intronic
904412987 1:30336148-30336170 GTGAGTTGGCTGCCCTCTCCAGG + Intergenic
905198675 1:36301491-36301513 GGGGGTTTGTTCCCCATTCCTGG + Intronic
905472998 1:38207254-38207276 GTGGGTTCCCTGCCCTCCCCTGG + Intergenic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
919904271 1:202067268-202067290 GTGGCCTCACTCCCCACACCTGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1067877745 10:50020056-50020078 GTGGCTGCCCTCCCCATTCCTGG - Intergenic
1067877763 10:50020123-50020145 GTGGCTGCCCTCCCCATTCCTGG - Intergenic
1069639929 10:69948079-69948101 GGGGGTGTGCCCCCCACTCCAGG - Intronic
1072633473 10:97163167-97163189 GTGGGTTGGGGACCCACTCCAGG + Intronic
1073465930 10:103694457-103694479 GAGGGGGAGCTCCCCACTCCTGG - Intronic
1075657671 10:124172936-124172958 CTGGGTGTGCTCCCCACCCCAGG + Intergenic
1081735229 11:45398442-45398464 GTGGTTTCCTTCCACACTCCTGG + Intergenic
1083026048 11:59551813-59551835 GTGGGTTCGAACCCCACTTCTGG + Intergenic
1088834057 11:113562275-113562297 GTGGGTTTGAACCCCACTCCTGG - Intergenic
1091564673 12:1639636-1639658 GCGGGTGCGCTCTCCTCTCCCGG - Intronic
1093509917 12:19914338-19914360 GTGGCTTCCCTCCACACTTCTGG - Intergenic
1093889358 12:24501028-24501050 GTGGGTCCGCCCCACCCTCCAGG - Intergenic
1096078379 12:48818555-48818577 ACGGGTTCGTTCCCCTCTCCCGG + Intronic
1096143742 12:49264423-49264445 GAGGGCTTGCTCCCCACTCTAGG - Intronic
1097224825 12:57471082-57471104 GTGAGTTCCCTTCCCACTCTGGG + Exonic
1099793571 12:87366400-87366422 GTAGGTTTGCCCCCCACTTCAGG - Intergenic
1100880425 12:99010014-99010036 TTGGGTTCCCTCCACGCTCCTGG - Intronic
1104682279 12:130760249-130760271 GTGGTTTTGCTCCCCACAGCAGG - Intergenic
1105946745 13:25196887-25196909 GTGGGTTCGCTCCCCACTCCAGG + Intergenic
1111420660 13:88006016-88006038 GAGGATTCGCACCCAACTCCTGG + Intergenic
1113588906 13:111484413-111484435 CTGGGTGCGCTCCATACTCCAGG - Intergenic
1125201199 15:37101774-37101796 GTGGCTCCGCCCCCAACTCCGGG - Intergenic
1128344880 15:66847572-66847594 AGGGGATGGCTCCCCACTCCAGG - Intergenic
1129110184 15:73332594-73332616 GTGGCTTCTCTGCCCACTTCTGG - Intronic
1131065822 15:89434433-89434455 GTGGGTCGTTTCCCCACTCCAGG + Intergenic
1133013438 16:2927709-2927731 GTGGGTTCACGCCCCACACTGGG + Intronic
1133437570 16:5793101-5793123 GTGGGTTCCCTACCGACACCTGG - Intergenic
1138482163 16:57310693-57310715 GTGGGTTCCTTCCCCTCCCCAGG - Intergenic
1139596537 16:67961590-67961612 GCGGGTGCCCTCCCCACTCTCGG + Exonic
1142175650 16:88643790-88643812 AGGGGTTCGGGCCCCACTCCTGG - Intronic
1144217422 17:13068647-13068669 GTGGGGTCTCTGCCAACTCCAGG - Intergenic
1148201700 17:45753748-45753770 GAGGGTTGGCTGCCCACACCTGG - Intergenic
1152546740 17:81004098-81004120 GGGGGTGCGAGCCCCACTCCCGG - Intronic
1152683733 17:81683629-81683651 GTGAGTCCCCGCCCCACTCCGGG + Intronic
1161021299 19:2012967-2012989 GTGGGTTTGCTCCCTCCACCTGG - Intronic
1161075010 19:2281252-2281274 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075020 19:2281295-2281317 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075071 19:2281510-2281532 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161075081 19:2281553-2281575 GTGGGTTTGCTGCCCTCTCTGGG + Intronic
1161580723 19:5079361-5079383 GTGGCTTCGTTCCACACTCACGG - Intronic
1161976562 19:7610928-7610950 GTAGGTACGCTCCCCACACTGGG + Exonic
1163270272 19:16248768-16248790 GGGGCTTCCCTACCCACTCCAGG - Intergenic
1163566989 19:18057854-18057876 GTGGGTTTGCAGCCAACTCCAGG + Intergenic
1164145693 19:22511212-22511234 TTGGGTTCTCAGCCCACTCCAGG + Intronic
1167587563 19:50383618-50383640 GTCGCTTCGCTCCGAACTCCTGG - Intergenic
1168214807 19:54917655-54917677 GTGATTTTGCTCTCCACTCCAGG + Intergenic
926887781 2:17613660-17613682 ATGGCTCCACTCCCCACTCCAGG - Intronic
931777937 2:65556182-65556204 CTGGGTTCCTTCCCCACCCCCGG - Intergenic
931995206 2:67833125-67833147 TTGGGTCAGCTCCCCACTGCTGG + Intergenic
935398920 2:102640347-102640369 GTGGATTCTCTCCCGACTCCAGG - Intronic
937350556 2:121157665-121157687 ATGGGTTTGAACCCCACTCCTGG - Intergenic
938068685 2:128295230-128295252 TTTGGTTCTCTCCTCACTCCAGG + Intronic
939386890 2:141512300-141512322 GTGTGTTCTCTCCTCCCTCCAGG + Intronic
943042499 2:182820248-182820270 GTGACTTCCCTCCCCACTTCTGG - Intergenic
947911518 2:233803846-233803868 CTGGGCTCCCTCCCCACCCCAGG - Intronic
948199483 2:236119544-236119566 GCCGGTGCGCTCCCCACACCTGG - Intronic
948803367 2:240442722-240442744 CTGGGCTAGCTCCCCACTACAGG - Intronic
1168856674 20:1013684-1013706 GTGGGTGCCCTGCCCACACCAGG + Intergenic
1172067646 20:32233107-32233129 GTTGGTTTGCTCTCCACTGCTGG - Intronic
1177590592 21:23160632-23160654 GTTGGTGCCCACCCCACTCCTGG - Intergenic
1179477666 21:41658298-41658320 GTGGGTTAGCTCCACTCTGCAGG - Intergenic
1179955202 21:44734615-44734637 GAGGGGCCGCTCCCCACTTCGGG - Intergenic
1181445365 22:22968574-22968596 GTGGCTTTGCTCCTCCCTCCTGG + Intergenic
1181574674 22:23786384-23786406 CTGGTTTCACTCCCCACTGCAGG + Intergenic
1183663999 22:39237015-39237037 CTTGGTTCGCTCCACATTCCCGG + Intronic
950615254 3:14152846-14152868 TTGGGTTCACTGCCCCCTCCTGG - Intronic
950746365 3:15093043-15093065 GTGGGTTCGGGGCCCAGTCCTGG - Intronic
956072724 3:65471636-65471658 GTGGTGCCCCTCCCCACTCCAGG + Intronic
956772719 3:72540087-72540109 CTGGGTTCTGTGCCCACTCCTGG + Intergenic
959125973 3:102290736-102290758 GTGGATTCTCTCGGCACTCCTGG + Intronic
965039676 3:163490406-163490428 GTGGGTTGGCTGCCCTCTGCTGG + Intergenic
968726557 4:2250571-2250593 GTGGCTTCGGGCCCCACTGCCGG - Exonic
968940619 4:3635609-3635631 GTGGGTTCTCACGTCACTCCAGG - Intergenic
969512242 4:7625345-7625367 GTGGGTCATCTCACCACTCCAGG + Intronic
975704220 4:77095895-77095917 GTGAGTTCCCTGCCCACTTCAGG + Intergenic
981085099 4:140675574-140675596 GTGGGTTCCATCCTAACTCCAGG - Intronic
981862457 4:149373756-149373778 GTGGGTTGACTCCTCACTTCTGG + Intergenic
985775266 5:1837924-1837946 AGGGTCTCGCTCCCCACTCCTGG + Intergenic
988497744 5:31759073-31759095 GTGGGGGAGCTCACCACTCCTGG - Intronic
988989005 5:36651211-36651233 TTGGGTTCCTTCCCCACACCAGG + Intronic
991925675 5:71703034-71703056 CTGGGTTCCCTCCCCTCTCCAGG - Intergenic
999768372 5:154756817-154756839 GTGGTTTCCCTCCCCGATCCCGG + Intronic
1005580579 6:27230557-27230579 GTGGGTTCGAGCCCCACTCCCGG - Intergenic
1005632426 6:27721121-27721143 GTGGGTTCGAACCCCACTCTCGG - Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1012399155 6:98830745-98830767 GTGGGTTTTCTGCCAACTCCTGG + Intergenic
1014163366 6:118195883-118195905 GAGTGTTCACTCCGCACTCCTGG + Intronic
1016454522 6:144216605-144216627 GTGGGTTCGAACCCCACTCCTGG + Intergenic
1019342150 7:513382-513404 GTGGGTCCTCTCCCTACTGCGGG - Intronic
1019645696 7:2127645-2127667 GTGGGTCCGCTCCTCTCTGCAGG - Intronic
1020520014 7:9173604-9173626 GTGGGTTCTCTCCTGGCTCCCGG + Intergenic
1021215668 7:17912824-17912846 GAGGGTCCTTTCCCCACTCCAGG - Intronic
1022943289 7:35258918-35258940 GTGGGTTCTCACCCCGGTCCCGG + Intergenic
1023201520 7:37702593-37702615 GTGCTATCCCTCCCCACTCCTGG - Intronic
1025794888 7:64730090-64730112 GTGGGTTCTCTCAGCATTCCTGG + Intergenic
1026957640 7:74387759-74387781 GTGATATCGCTCCCCACACCAGG + Intronic
1028999867 7:97141578-97141600 GTGGGTTCGAGCCCCACATCGGG - Intronic
1033601671 7:142893167-142893189 GTGGGCTGGCTCCCCAATCCAGG + Intergenic
1034473197 7:151267245-151267267 TTTGGTTCTCTCCACACTCCAGG + Intronic
1034997033 7:155584106-155584128 CAGGCTTCTCTCCCCACTCCAGG + Intergenic
1039430037 8:37519053-37519075 GTAGACTTGCTCCCCACTCCAGG + Intergenic
1042677834 8:71342208-71342230 GTGGCTTCTCTACCGACTCCAGG + Intronic
1045317800 8:101058529-101058551 GAGAGTTCTCTACCCACTCCTGG + Intergenic
1046838302 8:118827706-118827728 TTGGGTTCCCTTCCCATTCCTGG - Intergenic
1047940286 8:129822629-129822651 GTGGCCTGGCTCCCCACCCCTGG - Intergenic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1049273365 8:141707749-141707771 CTGGGCTCACTCCCCACCCCAGG - Intergenic
1049536714 8:143185963-143185985 GGGGGCGCGCTCCCCACTGCGGG + Intergenic
1052051133 9:23850677-23850699 GGGGCTTCCCTCCCCTCTCCTGG - Intergenic
1053163518 9:35829367-35829389 GCGGCTCCGCTCCCCACCCCCGG - Intronic
1053399122 9:37801473-37801495 CTGGGCTCGCTCCCCGCGCCCGG + Intronic
1057264377 9:93604238-93604260 GTGAGTTGGCTCTCGACTCCTGG + Intronic
1060774692 9:126364454-126364476 GAGGCTGCACTCCCCACTCCAGG + Intronic
1061088285 9:128411960-128411982 ATGGGCCCGCACCCCACTCCTGG - Intronic
1061296902 9:129681772-129681794 TGGGGTTCACTCCCCACACCGGG - Intronic
1061382502 9:130266637-130266659 GTGAGTCCGCTCCCCACTGCAGG - Intergenic
1061822566 9:133236655-133236677 GTGACTGCACTCCCCACTCCAGG + Intergenic
1061848182 9:133399906-133399928 CTTGCTTCGCTCCACACTCCAGG + Intronic
1062644685 9:137541487-137541509 GTGGGATCACAGCCCACTCCCGG + Intronic
1189231680 X:39457069-39457091 GTGGGTTTGAACCCCACTTCTGG + Intergenic
1189238777 X:39509340-39509362 GTGGGTTTGTACCCCACTCCTGG - Intergenic
1193979577 X:88165361-88165383 GTGTGTTCACTCAGCACTCCTGG - Intergenic
1194403056 X:93461699-93461721 CTGGGTTGGTTCCCCACCCCCGG + Intergenic
1199609406 X:149600168-149600190 CTGTGTTCTCTCCCCTCTCCTGG + Intronic
1199629711 X:149769186-149769208 CTGTGTTCTCTCCCCTCTCCTGG - Intergenic