ID: 1105947492

View in Genome Browser
Species Human (GRCh38)
Location 13:25202301-25202323
Sequence CAACCCAATCCCTCTCTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105947482_1105947492 1 Left 1105947482 13:25202277-25202299 CCATATCCCCACTCCCCACTGCT 0: 1
1: 0
2: 6
3: 63
4: 661
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947483_1105947492 -5 Left 1105947483 13:25202283-25202305 CCCCACTCCCCACTGCTCCAACC 0: 1
1: 0
2: 6
3: 58
4: 706
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947480_1105947492 3 Left 1105947480 13:25202275-25202297 CCCCATATCCCCACTCCCCACTG 0: 1
1: 0
2: 4
3: 59
4: 553
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947479_1105947492 14 Left 1105947479 13:25202264-25202286 CCAGAATGGGGCCCCATATCCCC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947481_1105947492 2 Left 1105947481 13:25202276-25202298 CCCATATCCCCACTCCCCACTGC 0: 1
1: 0
2: 2
3: 51
4: 542
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947484_1105947492 -6 Left 1105947484 13:25202284-25202306 CCCACTCCCCACTGCTCCAACCC 0: 1
1: 1
2: 6
3: 66
4: 684
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1105947485_1105947492 -7 Left 1105947485 13:25202285-25202307 CCACTCCCCACTGCTCCAACCCA 0: 1
1: 1
2: 10
3: 96
4: 857
Right 1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105947492 Original CRISPR CAACCCAATCCCTCTCTAAG GGG Intergenic
903534924 1:24060567-24060589 CAACCCAAGCCAGTTCTAAGCGG - Intronic
914850528 1:151310640-151310662 CAACCAAATCCTTCTCCATGGGG + Intronic
924456819 1:244225430-244225452 CAAAAAGATCCCTCTCTAAGTGG + Intergenic
1066017235 10:31260150-31260172 TAACCCAATCCCTGTCTTTGAGG - Intergenic
1072761321 10:98059397-98059419 CACCACATTGCCTCTCTAAGAGG + Intergenic
1074024431 10:109619716-109619738 CCACCCCATCCCACTCTAACAGG - Intergenic
1077853404 11:6097207-6097229 AGTCCCAATCCCTCTCTAAATGG + Intergenic
1079786141 11:24675161-24675183 CAACCCAATTCCACTTCAAGGGG - Intronic
1080128217 11:28762800-28762822 CTACCCAATACCTTTCTCAGAGG + Intergenic
1083197889 11:61102037-61102059 CAACCTCATCCCTCACAAAGGGG + Intergenic
1085174195 11:74472398-74472420 CTTCCAAATCCCTCTCTAAGGGG + Intergenic
1094213027 12:27912450-27912472 CAACCTACTCTCTCTCTAAAGGG + Intergenic
1103191766 12:119007794-119007816 CAGACCAATCCCACTCCAAGAGG + Intronic
1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG + Intergenic
1106197173 13:27503847-27503869 CAGCCCAATCTCTCCCTAATGGG - Intergenic
1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG + Intronic
1117745008 14:58860559-58860581 CAACCCAACCCCTAGCAAAGGGG - Intergenic
1119610726 14:76059635-76059657 CATCCCACTCCCTCTCTCACTGG + Intronic
1119850472 14:77862937-77862959 CAATTCCATCCATCTCTAAGGGG - Intronic
1121021471 14:90582783-90582805 ATAGCCATTCCCTCTCTAAGAGG + Intronic
1121519868 14:94578641-94578663 CTGCCCAATCCCTCTCTTGGGGG + Intronic
1124910175 15:33912567-33912589 TAACTTAATCCCTCTCAAAGAGG + Intronic
1126636618 15:50786266-50786288 CAACCTATTCTCTCTCTCAGTGG + Intergenic
1127432673 15:58926108-58926130 CAACCCAAACCAACTCTATGGGG + Intronic
1128444093 15:67741448-67741470 CAACCCACTTCCTGTCTGAGAGG + Intronic
1138217551 16:55217912-55217934 CAACCCTGTCACTCTCCAAGTGG + Intergenic
1141005248 16:80346077-80346099 CAACCAAATCCCTTTTTAAGGGG + Intergenic
1141402546 16:83763001-83763023 CAGCCCAAACCATCTCTACGGGG + Intronic
1147031958 17:37645685-37645707 GAACCTAATCCCTATGTAAGTGG + Intergenic
1156296593 18:35797398-35797420 CAACACAGTCTCCCTCTAAGGGG - Intergenic
1157446555 18:47750879-47750901 CCCCCCAATCCCTCAGTAAGGGG + Intergenic
1163740762 19:19010409-19010431 AAACACAAACCCTTTCTAAGTGG + Intronic
1164914259 19:32037833-32037855 CAAGCCATTCCCTCTCTATCAGG + Intergenic
1165738911 19:38194122-38194144 CCACCCATTCCAGCTCTAAGCGG + Intronic
928277693 2:29917957-29917979 CATCCCAAGCCCTCCCTCAGTGG - Intronic
928674025 2:33632878-33632900 CAACCCCTTCACTCTCTAACAGG + Intergenic
930243367 2:48958554-48958576 CAACCCAAATCCTCTCTCATGGG - Intergenic
930676426 2:54205508-54205530 CAACTCAAGCCATCTCAAAGAGG - Intronic
932326339 2:70864522-70864544 CACACCAGTCCCTCTGTAAGTGG + Intergenic
947111093 2:226720566-226720588 CAGCTCCATCCCTCACTAAGTGG + Intergenic
1170042500 20:12053220-12053242 CAGCCCAATCCCTCTCCATGTGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1181489506 22:23252750-23252772 CAACCCAACCCCCCTGTATGGGG + Intronic
1181563947 22:23722583-23722605 CATCCCATTGCCTCTCTAAAAGG + Intergenic
1183234966 22:36610206-36610228 CTGCCCAATCACGCTCTAAGGGG - Intronic
1183234978 22:36610265-36610287 CTGCCCAATCACGCTCTAAGGGG - Intronic
1183234984 22:36610295-36610317 CTGCCCAATCACGCTCTAAGCGG - Intronic
1183631643 22:39036657-39036679 AAACCAAATTCCTATCTAAGGGG - Intergenic
950864047 3:16174924-16174946 CACCCCAAGTCCTCTCTGAGTGG - Exonic
955717821 3:61849082-61849104 AAACCCATTTCCTCTCTCAGTGG + Intronic
959299138 3:104576798-104576820 CAGCCCAATCACTCTGTATGGGG + Intergenic
964541137 3:157781358-157781380 CAACCCAAACTTTCTCTTAGGGG - Intergenic
971886275 4:32452885-32452907 CAACCCACTTGATCTCTAAGTGG - Intergenic
972901485 4:43690330-43690352 CAACCCAATTCTTTTCAAAGTGG - Intergenic
975811845 4:78177784-78177806 CAATCCAATCCGTATGTAAGGGG - Intronic
978015995 4:103747339-103747361 CAAACCAATCCATTTTTAAGTGG - Intergenic
979098122 4:116576429-116576451 CAACCCAATCCAGCTCTTAGGGG + Intergenic
981017252 4:139987037-139987059 CAGCCCAAACCTTTTCTAAGTGG - Intronic
983005744 4:162482714-162482736 CAACTCACTCACTCTCAAAGAGG + Intergenic
983087887 4:163469514-163469536 CAAACCAACCCCTCTCTGATTGG + Intergenic
983990480 4:174113105-174113127 CTACCATTTCCCTCTCTAAGGGG - Intergenic
984448588 4:179869927-179869949 CAATCCCATCCCTCTCCAAAAGG - Intergenic
989239149 5:39183417-39183439 CTACCCAGTGCTTCTCTAAGAGG - Intronic
992029331 5:72705348-72705370 CAACCAAAGGCCTCTCCAAGTGG + Intergenic
998908861 5:146936350-146936372 CATCCCACTCCCCCTCTGAGTGG + Intronic
1001283261 5:170403461-170403483 CAGCCCCATCCCTCTGTATGGGG - Intronic
1002939391 6:1702875-1702897 CCACCCCAACCCTCGCTAAGAGG + Intronic
1003626769 6:7748151-7748173 AAAACCAAACACTCTCTAAGGGG - Intronic
1004125668 6:12870436-12870458 CTACCAAATCCCTCTCCAAATGG - Intronic
1006596101 6:35193502-35193524 CAAAGCAATCCCTCTGTAGGTGG + Intergenic
1009359768 6:62796908-62796930 CGCCCCAATCCCACTCAAAGCGG + Intergenic
1013052089 6:106546160-106546182 CAACCCCATTCATATCTAAGTGG - Intronic
1013280869 6:108635834-108635856 CAGCCCAATCCCTCTGACAGAGG - Intronic
1013590476 6:111615621-111615643 CAACGCACTGCCTCTCTGAGGGG + Intergenic
1017456079 6:154602815-154602837 CAACCCCATCCCTATCCCAGAGG + Intergenic
1021085836 7:16420780-16420802 CAACCCATGCACTCTCTAATCGG + Intronic
1036772874 8:11591261-11591283 CAGCCCAGTCCCTCTCTCAAGGG + Intergenic
1044186983 8:89264974-89264996 CTACCCAATACTTCTCTAAAGGG + Intergenic
1052402665 9:28020149-28020171 GCATGCAATCCCTCTCTAAGTGG + Intronic
1053471442 9:38348409-38348431 CAACCCAATCTCTCTCTCTCTGG + Intergenic
1060496376 9:124122233-124122255 AAGCCCAAGCCCTCTCTAATGGG - Intergenic
1061743553 9:132724068-132724090 CAGCCCAGGCCCTCTCTGAGGGG - Intergenic
1062723600 9:138058559-138058581 CAATGCAAGCCCTCTGTAAGGGG - Exonic
1187536902 X:20149263-20149285 TAACCCATTCCCTCTCTACTAGG + Intergenic
1187639517 X:21273252-21273274 CTACCCCTTCCCTCTCTAATGGG - Intergenic
1191678516 X:63816730-63816752 CCTCCCTATCCCTCTCTGAGAGG + Intergenic
1193241948 X:79180910-79180932 CCATCCAATCCATATCTAAGAGG + Intergenic
1193660219 X:84248312-84248334 CACCCAAATTCCTGTCTAAGGGG - Intergenic
1195022313 X:100841811-100841833 CAACCCCATCTCTCTCGTAGTGG + Intergenic
1200137188 X:153880851-153880873 CAACCTCACCCCTCCCTAAGAGG + Intronic