ID: 1105947520

View in Genome Browser
Species Human (GRCh38)
Location 13:25202462-25202484
Sequence TGCCTGTGGTGACAGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105947520_1105947528 23 Left 1105947520 13:25202462-25202484 CCACCACACTGTCACCACAGGCA 0: 1
1: 0
2: 0
3: 36
4: 297
Right 1105947528 13:25202508-25202530 CCACCTCGTAGCCCTGCCCAAGG 0: 1
1: 0
2: 1
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105947520 Original CRISPR TGCCTGTGGTGACAGTGTGG TGG (reversed) Intergenic
900259721 1:1720024-1720046 TGACTGTGGTGACAGTTTCAGGG + Intronic
903185740 1:21627904-21627926 AGCCTGTGGCATCAGTGTGGGGG + Intronic
903210556 1:21815853-21815875 CCCCCATGGTGACAGTGTGGGGG - Intronic
903538492 1:24082874-24082896 TGCCTGAGATGACACCGTGGAGG + Intronic
904050765 1:27636900-27636922 TGCCTGGGGTAACAGAGTGGTGG + Intergenic
904590661 1:31613670-31613692 AGCCTGTGGAGGCAGGGTGGGGG - Intergenic
904920799 1:34006455-34006477 TTCCTCTGGAAACAGTGTGGAGG - Intronic
905941877 1:41869717-41869739 TGCCTGTGGTGACAGCATCATGG + Intronic
906218937 1:44062021-44062043 TTACTGAGGTGGCAGTGTGGTGG - Intergenic
906798223 1:48714300-48714322 TCCCTGGGGTGGCACTGTGGAGG - Intronic
906938481 1:50235235-50235257 TCCCAGTGGGGACTGTGTGGGGG - Intergenic
907249328 1:53127717-53127739 TGCCTGTGGAGACAGCTGGGTGG + Intronic
907794374 1:57700149-57700171 TGGCTGTGGGGACAGAGTGAAGG - Intronic
907890593 1:58632887-58632909 TCCTAGTGGTGACTGTGTGGTGG - Intergenic
910354364 1:86339344-86339366 TGTCTGTGGTCATAGTGGGGGGG + Intergenic
911983414 1:104594247-104594269 TCCCAGTGGAGACTGTGTGGAGG - Intergenic
915200102 1:154220945-154220967 GGCCCGGGGTGTCAGTGTGGAGG + Exonic
915874458 1:159597816-159597838 AGCTTCTGGTGACAGTGTAGGGG - Intergenic
917428578 1:174941522-174941544 TGCCTCGGGTGACACTGTGCAGG - Intronic
918364747 1:183795733-183795755 TCACTGTGGTCACTGTGTGGAGG + Intronic
918546655 1:185692105-185692127 TGCTGGAGGTGACAGTGAGGAGG - Intergenic
919608552 1:199716652-199716674 TGTCTGAGTTGACAGTGAGGTGG + Intergenic
921831408 1:219731970-219731992 TGCCTTTGGTGACAAATTGGTGG + Intronic
922827039 1:228529113-228529135 TGCATGTGGAAGCAGTGTGGGGG - Intergenic
922882014 1:228988218-228988240 TGCCTGTGCTGGCATTGTGGAGG + Intergenic
1063766701 10:9149816-9149838 TGCCTGAAGTGTCAGTGGGGAGG - Intergenic
1064335426 10:14436288-14436310 TGCCTCTGGTGACATTGGGTGGG - Intronic
1064667353 10:17669027-17669049 AGACTGTGGGGACAGTCTGGTGG - Intronic
1064863428 10:19852276-19852298 TGCCTGTGGTGCCAGCTAGGAGG + Intronic
1065645173 10:27826556-27826578 TGCGTGTGGTGGCAGTGAGTTGG - Intronic
1065834551 10:29644911-29644933 AGCCTGTGGGGACAGAATGGTGG + Intronic
1068885239 10:62091259-62091281 TGCCAGCGGTGGCTGTGTGGTGG - Exonic
1070628442 10:78067695-78067717 GGCCTGGAGTGAGAGTGTGGAGG + Intergenic
1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG + Intergenic
1072746357 10:97941783-97941805 TGACTCTGGCTACAGTGTGGGGG - Intronic
1073325650 10:102642955-102642977 TGGCTGTGATGAGAGTGTTGGGG + Intergenic
1074117030 10:110464075-110464097 TGCCTATGCTGACATTGTGAAGG - Intergenic
1074131673 10:110584744-110584766 TGCCTGTGGTCCCAGTTAGGAGG - Intronic
1076351150 10:129816068-129816090 TGGCTGTGGTGGCTGTGGGGAGG - Intergenic
1076745645 10:132512091-132512113 TGACAGTGGTGAGAGTGTGTAGG + Intergenic
1077511805 11:2969443-2969465 TTCCTGTGGTGTGAGTGTGCAGG - Intronic
1078328256 11:10397888-10397910 TGCCCCTGGAGAGAGTGTGGGGG + Intronic
1078716405 11:13843488-13843510 TACCTGTGGTGAGAGGGAGGTGG - Intergenic
1079153692 11:17924581-17924603 GCACTGTGGTGGCAGTGTGGAGG + Intronic
1079238016 11:18703250-18703272 TGGCTCTGGTGACACTGTGCCGG + Exonic
1080411335 11:32028112-32028134 TGACTGTGCTCCCAGTGTGGAGG + Intronic
1080675534 11:34423400-34423422 TCGCTGGGGTGACAGTGGGGTGG + Intergenic
1080686841 11:34523072-34523094 TGTCTGTGGGGAGAGTGTGGTGG - Intergenic
1082160459 11:48883505-48883527 AGCCAGTGGGGACAGTGTGGTGG - Intergenic
1082161907 11:48896901-48896923 AGCCAGTGGGGACAGTGTGGTGG + Intergenic
1082239526 11:49855859-49855881 AGCCAGTGGGTACAGTGTGGTGG - Intergenic
1082242625 11:49888492-49888514 AGCCGGTGGGGACAGTGTGGTGG + Intergenic
1082609574 11:55281233-55281255 AGCCAGTGGGGATAGTGTGGTGG - Intergenic
1082657110 11:55869295-55869317 AGCCAGTGGGGACAGTGTGGTGG + Intergenic
1082941712 11:58711955-58711977 TGACTGTGGTGACAGCATGATGG - Intronic
1083071279 11:59984971-59984993 TGACTGTAGTGAGAGTGTGTAGG - Intergenic
1083325429 11:61870684-61870706 TGCCTGAGGACATAGTGTGGTGG + Intergenic
1087791749 11:102413400-102413422 TGCCAGTGGTGATGGGGTGGTGG - Intronic
1088583371 11:111336064-111336086 TGGCTGTGATGACAATGAGGAGG - Intergenic
1089609670 11:119662456-119662478 TGCTTGTGGGGAGGGTGTGGAGG + Exonic
1089800158 11:121021475-121021497 TGGCAGTGGTGACAGCGTGCTGG + Intergenic
1091624731 12:2113292-2113314 TTCCTGTGGGGACGGGGTGGAGG + Intronic
1091800852 12:3323636-3323658 AGCCTGTGAGAACAGTGTGGTGG + Intergenic
1092185914 12:6478316-6478338 TGCTTGTGGTGCCAGTACGGCGG - Intergenic
1092317951 12:7439829-7439851 GGCCTTTGGCGACAGTGAGGAGG - Intronic
1092735687 12:11580407-11580429 TGCATGTGGGGGCAGTGTTGTGG - Intergenic
1094063032 12:26334756-26334778 TGCATGTGGGGGCAGTGTGGTGG - Intergenic
1094207179 12:27852978-27853000 TGACTGTTGTGGGAGTGTGGGGG - Intergenic
1095957943 12:47817364-47817386 TTCCTGTGGTGATGGTGAGGAGG - Intronic
1096861656 12:54533097-54533119 TGACTGTGGGGGCAGTGAGGGGG + Intronic
1098733926 12:74072822-74072844 GGCCTGTGGTGCCAGTAAGGAGG - Intergenic
1099159141 12:79218527-79218549 TGGCTGTGGTGATTGTGGGGAGG - Intronic
1099707279 12:86172005-86172027 TGCCTGTGGTGAGTATGAGGAGG + Intronic
1100884771 12:99057718-99057740 TGCGTGAAGTGTCAGTGTGGTGG + Intronic
1102317427 12:111900569-111900591 TGCCTGTGGAAATGGTGTGGTGG + Intergenic
1102745581 12:115246128-115246150 TGCATATGGTGGCAGGGTGGGGG - Intergenic
1104052979 12:125208894-125208916 TGCCTGTGGTGACGGCATGAAGG - Intronic
1104259984 12:127173397-127173419 TGACTGTGGTTAGAGTGGGGAGG + Intergenic
1104914851 12:132259380-132259402 TGCATGGGGTGACATTGTGGGGG + Intronic
1105353151 13:19633886-19633908 GGCCTTTGGCGACAGTGAGGAGG + Exonic
1105947520 13:25202462-25202484 TGCCTGTGGTGACAGTGTGGTGG - Intergenic
1106254865 13:28012851-28012873 TGCTTGAGCTCACAGTGTGGAGG + Intronic
1107601341 13:42016025-42016047 AGCCTGTGGCCACAATGTGGTGG + Intergenic
1108530913 13:51326180-51326202 TGACTCTGGTGGCAGTGGGGTGG - Intergenic
1110368783 13:74718188-74718210 TGGCAGTGGTGACAGCGTGCTGG + Intergenic
1110828894 13:80007120-80007142 TGTCAGTGATGACAGTGTGAAGG + Intergenic
1112435776 13:99390335-99390357 TGTCTGTGGTGACAGCCAGGTGG - Intergenic
1112623965 13:101081323-101081345 TGCCTGTGTGAAGAGTGTGGGGG + Intronic
1112903943 13:104394215-104394237 TGACTGTGGTGACAGTATCATGG - Intergenic
1113943804 13:114032862-114032884 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943827 13:114032951-114032973 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943849 13:114033040-114033062 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1113943927 13:114033335-114033357 GGGGTGTGGTGTCAGTGTGGGGG - Intronic
1115035799 14:28854881-28854903 TGACTGTGGTGATAGTTTGTTGG - Intergenic
1122073074 14:99217805-99217827 AGCCTGTGGGGACGGGGTGGTGG - Intronic
1122089726 14:99330363-99330385 TGCCAGGGGTGACAGTGTGATGG - Intergenic
1123626062 15:22227609-22227631 GCCCTGTGGTCACAGTGTAGAGG + Intergenic
1126144667 15:45463724-45463746 TGGTGTTGGTGACAGTGTGGTGG - Intergenic
1126448733 15:48781722-48781744 TGCCGGTGGTGAAAAGGTGGAGG + Intronic
1126811645 15:52412325-52412347 TGCCTCTTCTCACAGTGTGGTGG - Intronic
1127785101 15:62348849-62348871 TGCCTGTCTTCACTGTGTGGCGG - Intergenic
1128786795 15:70403542-70403564 TCCATATGGTGACAGTGTGGGGG - Intergenic
1129773574 15:78218312-78218334 TGCCAGTGGAGGCATTGTGGGGG + Intronic
1130791486 15:87160473-87160495 TCCCAGTGGGGACTGTGTGGGGG - Intergenic
1131225921 15:90624336-90624358 TCACTGTGGTTCCAGTGTGGAGG - Intronic
1131819797 15:96260743-96260765 TGCCTGTGTTGGCAGTTTGGTGG - Intergenic
1131900391 15:97081782-97081804 TTGCTGTGATGAAAGTGTGGGGG - Intergenic
1132674782 16:1117108-1117130 GGCCTGTGGGGACAGGGTGAGGG - Intergenic
1133321230 16:4914916-4914938 TGACTGGGGTGGGAGTGTGGGGG - Intronic
1133841337 16:9412504-9412526 TGCCTGAGGCGACAGTGTATGGG - Intergenic
1134220394 16:12348938-12348960 GGGCGATGGTGACAGTGTGGAGG - Intronic
1134356807 16:13489935-13489957 TGCCTGTGTTGACACTGCAGTGG + Intergenic
1137393823 16:48103057-48103079 TTGCTGTGGCCACAGTGTGGAGG - Intronic
1137444524 16:48523645-48523667 TCCCCTTGGTGACATTGTGGTGG - Intergenic
1137622941 16:49888485-49888507 TGTCTGTGTTGACAGTTTTGTGG + Intergenic
1137756515 16:50906492-50906514 TGCCTGTGGTTTCCGTTTGGGGG + Intergenic
1138140167 16:54561155-54561177 TGTGTGTGGTGTAAGTGTGGAGG - Intergenic
1139196527 16:64925313-64925335 AGCCTGTTGGGACAGTGTGGGGG - Intergenic
1139459670 16:67111513-67111535 TGTCTGTGGAGACAGTGTGTTGG + Intronic
1141705020 16:85660034-85660056 TGCCTGCGGGGACAGTGGGGAGG + Intronic
1142222897 16:88864205-88864227 TGCCTGTGGGGGCAGCCTGGGGG - Intronic
1142287888 16:89178875-89178897 TGCCTGTGGGCACAGTGGGCTGG - Intronic
1142858212 17:2744941-2744963 TGCCTGTGGTCCCAGCGTGGAGG + Intergenic
1143190065 17:5034282-5034304 TGCTGGTGGTGACCCTGTGGAGG - Exonic
1143524206 17:7462926-7462948 TGCTGGAGGTGCCAGTGTGGGGG - Exonic
1144054427 17:11526403-11526425 TGTCTGTGGGGACAGTCTGCAGG - Intronic
1144604465 17:16652841-16652863 TGCCTGTGGTCACAGTTTTACGG - Intronic
1146267743 17:31464196-31464218 GACCTGTGCTGTCAGTGTGGGGG + Intronic
1146625888 17:34435111-34435133 TGAATGTGGGGACAGGGTGGGGG + Intergenic
1148356861 17:46981133-46981155 TTCCAGTGGTGACAGTGAAGTGG + Intronic
1149363021 17:55913863-55913885 TGCTGGTGGCAACAGTGTGGTGG + Intergenic
1150149278 17:62795915-62795937 TGGCTATGGTGACTTTGTGGTGG - Intronic
1150347484 17:64415345-64415367 TGCTAGAGGTGACAGTGGGGAGG - Intergenic
1152092730 17:78256141-78256163 TGCCTGTGCTCCCTGTGTGGGGG - Intergenic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1152658535 17:81531113-81531135 GGACGGTGGTGACAGTGTGGTGG + Intronic
1155132775 18:22954684-22954706 TCCCAGTGGGGACTGTGTGGAGG + Intronic
1157475197 18:48019611-48019633 AGCCTGAGGGGACAGTGTAGGGG + Intergenic
1159705451 18:71680032-71680054 TTCCAGTGGGGACTGTGTGGGGG - Intergenic
1160948504 19:1654553-1654575 TGCCTGAGGTCACAGTGAGGTGG - Intergenic
1161992493 19:7692576-7692598 TGTTTGTGGTGACAGTGTTAGGG - Intronic
1162038562 19:7955628-7955650 GGCCTGTGGTGAGAGCATGGGGG + Intergenic
1163675090 19:18651693-18651715 TGCCAGTGGAGGCAGTGGGGTGG + Intronic
1164671447 19:30074374-30074396 TGCCTGAGGTGCCTGTGTGTGGG - Intergenic
1164784117 19:30916308-30916330 TGCCCGTGTTGCCAGGGTGGGGG + Intergenic
1165494726 19:36145799-36145821 TGCCTGTGGTGTCGCTCTGGTGG - Exonic
1166667434 19:44689500-44689522 TGCCTGCCGTGAGAGTGGGGAGG - Intergenic
1166695981 19:44851597-44851619 TTCCTGTGGTGGCAGAGTGGAGG - Intronic
1166997646 19:46727412-46727434 TGCCAATGGGGACAGTGTGGGGG + Intronic
1167483515 19:49746903-49746925 CGCCTGTGGGGACAGTATGTTGG + Intronic
925581649 2:5417188-5417210 TGCCCGTGGTGGCAGCATGGAGG + Intergenic
925835617 2:7943486-7943508 TTCCAGAGGTGAGAGTGTGGGGG + Intergenic
926283580 2:11469749-11469771 TTCCTGTGGGGAAAATGTGGAGG - Intergenic
933680468 2:85095378-85095400 TGCCTGTAGTTCCAGTGAGGTGG - Intergenic
933988225 2:87611896-87611918 AGCCTGTGATGGCAGAGTGGAGG + Intergenic
934619435 2:95795047-95795069 TGCTTGTGGAGACACTGAGGAGG + Intergenic
934641455 2:96029510-96029532 TGCTTGTGGAGACACTGAGGAGG - Intronic
934658747 2:96132029-96132051 TGCCAGTGGTGCCAGTGAGCAGG - Intronic
936305615 2:111338912-111338934 AGCCTGTGATGGCAGAGTGGAGG - Intergenic
936953059 2:117997667-117997689 TGCCTGAGGTCACTGTTTGGGGG - Intronic
937334394 2:121052611-121052633 GGCCAGTGGGGACAGGGTGGGGG - Intergenic
937444934 2:121949808-121949830 TCCCTGAGGTGACTGTCTGGTGG - Intergenic
937603054 2:123762388-123762410 TGCCATAGGTGTCAGTGTGGAGG + Intergenic
939529788 2:143343554-143343576 TCACTGTGTTGGCAGTGTGGGGG + Intronic
942147315 2:173039578-173039600 TCCCTGTGGTTGGAGTGTGGAGG - Intronic
944134404 2:196382974-196382996 TGGCTCTGGTGGCAGTATGGGGG + Intronic
945914896 2:215693290-215693312 TTCCTTTGGTGATAGCGTGGAGG + Intergenic
947697211 2:232201670-232201692 TGACTGTGGTGTTAGTGTTGTGG + Intronic
947698191 2:232210579-232210601 TTCCTGTGGTGACATTGGTGAGG + Intronic
947835093 2:233169535-233169557 TGCCTTTGATGAGACTGTGGTGG - Intronic
1169376647 20:5071890-5071912 TGGGTGTGGTGGCAGCGTGGTGG - Intronic
1170089098 20:12570362-12570384 TGATTGTGGTGACAGAGTGGGGG - Intergenic
1170261004 20:14408406-14408428 TTCCTTGGGTGGCAGTGTGGAGG + Intronic
1171346875 20:24471721-24471743 TGCAGGTGGTGACTGGGTGGGGG - Intronic
1172189947 20:33055924-33055946 GGCCTGTGGTGACAGTCTCAGGG + Intronic
1173669033 20:44784851-44784873 AGCCTTTGGTGTCTGTGTGGAGG - Intronic
1175567405 20:59991360-59991382 TGTCTTTTGTGACAGGGTGGAGG + Intronic
1175734403 20:61375316-61375338 TGATGGTGGTGACAGTGGGGAGG + Intronic
1175746032 20:61457921-61457943 TGGCAGTGCTGACACTGTGGTGG + Intronic
1175996423 20:62814116-62814138 TGCCTGTGGGGGCAGAGTGGTGG + Intergenic
1176245161 20:64093845-64093867 AGTGTGTGGGGACAGTGTGGGGG + Intronic
1176245191 20:64093929-64093951 AGTGTGTGGGGACAGTGTGGGGG + Intronic
1177808939 21:25903960-25903982 AGCCTGTGGTGGAAGTGTGAGGG + Intronic
1178609610 21:34069401-34069423 GGCCAGTGGTGACAGTGTGAGGG + Intergenic
1178807361 21:35850864-35850886 TGGCTGAGCTGACAGTGTGCAGG - Intronic
1178949274 21:36973102-36973124 TGCCTGTGGTGACAGCTTCTCGG + Intronic
1179500992 21:41808491-41808513 TGCCTCAGGTGTCAGTCTGGTGG - Intronic
1179614470 21:42572929-42572951 TCTCTGTGGGGACAGTGTGCTGG + Intronic
1180759967 22:18193893-18193915 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
1180770279 22:18378192-18378214 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
1180775701 22:18430807-18430829 TGCCCGTGGTCACAGTGGGTAGG - Intergenic
1180776051 22:18484474-18484496 TGCCCGTGGTCACAGTGGGTAGG - Intergenic
1180808774 22:18741844-18741866 TGCCCGTGGTCACAGTGGGTAGG - Intergenic
1180828220 22:18881148-18881170 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
1181061134 22:20282571-20282593 TGCCAGAGGTGGGAGTGTGGAGG + Intronic
1181071703 22:20346818-20346840 TGCCCGTGGTCACAGTGGGTAGG - Intergenic
1181194772 22:21175760-21175782 TGCCCGTGGTCACAGTGGGTAGG - Intergenic
1181214673 22:21317010-21317032 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
1183031291 22:35108368-35108390 TACCTTGGGTGTCAGTGTGGGGG - Intergenic
1183450788 22:37893819-37893841 GGCCTGTTTAGACAGTGTGGAGG + Intergenic
1184259317 22:43305654-43305676 GGCCTGTGTTGCCATTGTGGGGG - Intronic
1184513595 22:44946838-44946860 AACCTTTGGTGACACTGTGGAGG + Intronic
1185037428 22:48486799-48486821 GGGCTGTGGTGACAATGGGGTGG - Intergenic
1185426174 22:50772516-50772538 TGCCAGCGGTTACAGGGTGGTGG - Intronic
1203232111 22_KI270731v1_random:119376-119398 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
1203278316 22_KI270734v1_random:107150-107172 TGCCCGTGGTCACAGTGGGTAGG + Intergenic
950414144 3:12858763-12858785 GGCCTGTGTTGACACTGTAGGGG - Intronic
950538775 3:13597573-13597595 TGCACGTGGTGGCAGTGAGGTGG + Intronic
950542750 3:13621977-13621999 GGCATGTGGCCACAGTGTGGTGG - Intronic
953193532 3:40711734-40711756 TGTATGTGGGGAGAGTGTGGGGG - Intergenic
954371290 3:50170800-50170822 TCACTGTGGAAACAGTGTGGGGG - Intronic
954933519 3:54305613-54305635 TGCCTGTCCTGACACTGTGTAGG + Intronic
955874495 3:63475719-63475741 AGCCTGAGGGGACAGTGTGAGGG - Intronic
956289607 3:67647719-67647741 GGCCTGAGGTGGCAGTGGGGAGG - Intronic
960263037 3:115589904-115589926 TGCATGAGGTGACATTGCGGGGG - Intergenic
961413440 3:126740352-126740374 TGCCTTGGGTGAATGTGTGGAGG + Intronic
961426342 3:126851549-126851571 TGCCTTTTGTGACTGTATGGAGG - Intronic
961511843 3:127408255-127408277 TGCCCATGAGGACAGTGTGGAGG + Intergenic
966252961 3:177887452-177887474 TCTCTGTGGTGGCAGAGTGGAGG - Intergenic
966527219 3:180932449-180932471 TGCCTATGGTTACACAGTGGTGG + Intronic
967512085 3:190323547-190323569 TGTGTGTGGTGCGAGTGTGGTGG + Intronic
967878201 3:194281004-194281026 TCCCTGGGGTGCCTGTGTGGAGG + Intergenic
969278794 4:6155087-6155109 TACTTCTGGTGACAGTGTTGGGG + Intronic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
969408343 4:7010469-7010491 TGGCTGGGGTGGCAGAGTGGTGG + Intronic
969511201 4:7618921-7618943 TGCCTGTGTGCACAGTGCGGGGG + Intronic
970476748 4:16431422-16431444 TCCATGGGGTGACAGAGTGGAGG - Intergenic
971584806 4:28392013-28392035 AGTGTGTCGTGACAGTGTGGTGG + Intronic
971886165 4:32451157-32451179 TACCTGTGGTGACAGTACCGTGG + Intergenic
976155657 4:82141648-82141670 TTCCAGTGTTGACACTGTGGTGG + Intergenic
976172874 4:82322789-82322811 TCACTCTGGTGCCAGTGTGGAGG - Intergenic
979200508 4:117972386-117972408 TCCAGGTGGTGACAGTGAGGAGG - Intergenic
984461449 4:180041736-180041758 TACCTGTGCTGGCAATGTGGTGG - Intergenic
984988020 4:185350301-185350323 TGCCTCTGATGACAGAGTGTGGG - Intronic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
986230299 5:5858316-5858338 TGCCTGGGGATTCAGTGTGGAGG + Intergenic
987647801 5:20698345-20698367 TGAGTGTGGTGACAGTATTGGGG - Intergenic
988645665 5:33092814-33092836 TGCCAGTGGTGGCAGTATGATGG + Intergenic
988748535 5:34170512-34170534 TGAGTGTGGTGACAGTATCGGGG + Intergenic
988998374 5:36736292-36736314 TGACTATGGAGACAGCGTGGAGG - Intergenic
991640468 5:68746686-68746708 TGTGTGTGGTGAAAGTGAGGTGG + Intergenic
993377726 5:87169327-87169349 TGTCTGTTATGACAGTGTAGAGG - Intergenic
994060560 5:95472173-95472195 TGCCAGTGGTGAGAGTGGGTTGG - Intronic
994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG + Intergenic
996949569 5:129109600-129109622 TGCCTGGGGTTAAAGTGTTGAGG + Intronic
998344526 5:141450157-141450179 TGGGTGTGGTGGGAGTGTGGTGG - Intronic
1001422850 5:171600372-171600394 AGCCTGTGGGGAGAGTGTGTGGG + Intergenic
1002256367 5:177961210-177961232 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256376 5:177961253-177961275 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256481 5:177961770-177961792 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256490 5:177961813-177961835 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256499 5:177961856-177961878 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256508 5:177961899-177961921 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256517 5:177961942-177961964 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256526 5:177961985-177962007 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256535 5:177962028-177962050 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256544 5:177962071-177962093 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256553 5:177962114-177962136 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1002256562 5:177962157-177962179 TGGCCGTGGTGACACTGAGGAGG + Intergenic
1004290677 6:14364082-14364104 TACCTGTGGTGTCTGTGTCGGGG + Intergenic
1005546111 6:26873612-26873634 TGACTGTGGTGACAGTATCGGGG + Intergenic
1007397013 6:41583655-41583677 TGCATGGGGTCACAGAGTGGAGG + Intronic
1009016820 6:57914404-57914426 TGAGTGTGGTGACAGTATCGGGG + Intergenic
1011441266 6:87390105-87390127 TGCATGTGGAGACAAAGTGGAGG - Intronic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1013017995 6:106178613-106178635 TGACTCTGGTGGCAGTGTGCAGG - Intergenic
1013480583 6:110549601-110549623 TCCCTGTGGTGACCCCGTGGTGG - Intergenic
1013524126 6:110958870-110958892 TGCCTGTGCTGGCTGTGTGTGGG + Intronic
1013780970 6:113727955-113727977 TGCCTGTCATTCCAGTGTGGAGG - Intergenic
1013854809 6:114559653-114559675 TGACTTTGGTTATAGTGTGGAGG - Intergenic
1016384102 6:143514224-143514246 TGACTGTGGTGACAATGCAGCGG + Intergenic
1019216563 6:170447619-170447641 TCCTTGTGGAGTCAGTGTGGAGG - Intergenic
1019256777 7:57397-57419 TGCCTATGGGGGCTGTGTGGAGG - Intergenic
1019339937 7:504228-504250 TGCCTGTGGTGGGTGGGTGGTGG - Intronic
1019485440 7:1287275-1287297 TGGCTATGGTTACAGCGTGGCGG + Intergenic
1019723915 7:2590179-2590201 TGCCTGTGGGGACACTGGCGGGG - Intronic
1019723930 7:2590235-2590257 TGCCTGTGGGGACACTGGCGGGG - Intronic
1023473635 7:40552674-40552696 TGCCTATGGGGAAAGTGTGATGG - Intronic
1023796019 7:43792948-43792970 TATCTGTGTTTACAGTGTGGGGG - Intronic
1024134265 7:46390536-46390558 TGCCTGTGATGAGAATGTGCAGG + Intergenic
1024158263 7:46648213-46648235 TGCCTGTGGGGACTCTGTGTGGG + Intergenic
1025993174 7:66511461-66511483 TGCCTGTGGGGAGAGTGGGCTGG + Intergenic
1026942785 7:74297347-74297369 TGCCTGTAGTGCCACTGGGGTGG + Intronic
1026989480 7:74575561-74575583 CGCCTGTGGCGGCAGTGGGGTGG + Intronic
1028673304 7:93429786-93429808 AGATTGTGGTGACAGTGTGAAGG - Intronic
1030232083 7:107219188-107219210 AGATTGTGGTGAGAGTGTGGGGG + Intronic
1031928415 7:127660386-127660408 AGACTGTGGTGGGAGTGTGGGGG + Intronic
1033871106 7:145753272-145753294 TGCCTGTGGTGTCGCGGTGGAGG + Intergenic
1036422834 8:8613924-8613946 TGGCTCTGGTGCCATTGTGGAGG - Intergenic
1037764963 8:21767045-21767067 TGCCTGTGATGCGTGTGTGGTGG - Intronic
1037886958 8:22600236-22600258 TGGCGGAGGTGACAGTGAGGGGG + Intronic
1040630610 8:49205776-49205798 TACCTGTGGTCACTGGGTGGAGG - Intergenic
1040887029 8:52276020-52276042 TGCATGTGGTGTGTGTGTGGGGG - Intronic
1041119117 8:54568784-54568806 CCCCTGTGGTGACTATGTGGAGG - Intergenic
1041454189 8:58039913-58039935 TGCCTGTGGAGACAGTGGTGTGG + Intronic
1041660641 8:60397838-60397860 TGCCTGTGGTGGAAGAATGGGGG + Intergenic
1042364199 8:67917672-67917694 GGCCAGTGGTGACAATGTGGTGG - Intergenic
1042485598 8:69342341-69342363 CGCCTGTGGGGCCTGTGTGGAGG - Intergenic
1044011834 8:87003781-87003803 TGGCTGTGGTAACAGTGGGCTGG + Intronic
1045287374 8:100803803-100803825 TGGCTGTGGTCACCATGTGGAGG - Intergenic
1045312936 8:101018970-101018992 TGACTGTGGTGAAAGTGGTGAGG + Intergenic
1049174640 8:141184346-141184368 TGCCTGTGGTCCCAGTGAGGTGG + Intronic
1049389572 8:142360866-142360888 GGGCTGTGGGGCCAGTGTGGGGG + Intronic
1049834075 8:144722171-144722193 TGACTGTGGTGACTGTGGGAAGG - Exonic
1052662327 9:31449809-31449831 TGCCTGTGGTGTGTGTGTGTGGG - Intergenic
1053363285 9:37504727-37504749 TGTCTGTGGTGACAAAGTGGTGG - Intergenic
1053462286 9:38280329-38280351 TGCCTGTGGTGACACTGGGAAGG - Intergenic
1054974526 9:71126808-71126830 TGCCTGTGGTGACAGAGAGTGGG + Intronic
1056705422 9:88948612-88948634 TGTCTGTGCGCACAGTGTGGGGG + Intergenic
1057950436 9:99365462-99365484 TGCCTGTGGTGGCAGTGATTGGG + Intergenic
1058111207 9:101032295-101032317 TGACTGTGACTACAGTGTGGAGG + Intronic
1060138328 9:121180150-121180172 TCCCTGTGTTCACAGTGTGAGGG - Exonic
1060960248 9:127675753-127675775 TCTCTCTGGTGACAGTGTGGAGG - Intronic
1060964816 9:127706614-127706636 GGCCTGGGGTGACAGTGTCCTGG - Intronic
1061946527 9:133911519-133911541 TGACTGTGTTGACAGTGTCACGG - Intronic
1062036293 9:134384133-134384155 CCCCGGGGGTGACAGTGTGGAGG - Intronic
1062036343 9:134384278-134384300 TCCCTGGGGTGACAGCGAGGAGG - Intronic
1062163120 9:135090632-135090654 AGCCTGTGGTGACAGGGGGCAGG - Intronic
1062333537 9:136055047-136055069 TGGCTGTGGTGTCGGAGTGGGGG + Intronic
1062403406 9:136382292-136382314 TGCCTGTGGAGACCGTGCTGAGG - Exonic
1186935859 X:14449717-14449739 TGGCTGTGCTGACAGGATGGGGG - Intergenic
1188898563 X:35699524-35699546 TGCCTGTGTTTATAATGTGGTGG + Intergenic
1189102177 X:38202069-38202091 ACCCTGTGGTGACAGTGGGCAGG + Intronic
1191852998 X:65599838-65599860 GGCTTGTGATGACAGTGAGGAGG + Intronic
1192570913 X:72203680-72203702 TCCCTGTGGTGACATGGTTGGGG - Intronic
1195365174 X:104117565-104117587 TGCCTGTGGTGAGATGGAGGTGG - Intronic
1199856923 X:151766858-151766880 AGGCTGGGGTGACAGTGTGGGGG + Intergenic
1200101874 X:153692364-153692386 TGACTCTTGTGACAGTCTGGTGG + Intronic
1200256639 X:154585995-154586017 TGCCTGGGGAGACAGCCTGGGGG + Intronic
1200261130 X:154618408-154618430 TGCCTGGGGAGACAGCCTGGGGG - Intronic
1200295347 X:154913926-154913948 CCCCAGTGGTGACTGTGTGGGGG + Intronic
1200780016 Y:7206275-7206297 TGCCTTAGGTGTCAATGTGGGGG - Intergenic
1201774488 Y:17648467-17648489 TGCCGATGGTGACAGTGAGAGGG - Intergenic
1201827068 Y:18257522-18257544 TGCCGATGGTGACAGTGAGAGGG + Intergenic