ID: 1105947753

View in Genome Browser
Species Human (GRCh38)
Location 13:25203801-25203823
Sequence TTATCTGGTTACTTTAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105947753_1105947754 -9 Left 1105947753 13:25203801-25203823 CCTTACTTAAAGTAACCAGATAA 0: 1
1: 0
2: 0
3: 15
4: 273
Right 1105947754 13:25203815-25203837 ACCAGATAAGTACCTTTCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105947753 Original CRISPR TTATCTGGTTACTTTAAGTA AGG (reversed) Intergenic
900717660 1:4155600-4155622 TAATCTAGTTTTTTTAAGTATGG - Intergenic
903919105 1:26787163-26787185 TCATCTGTTTCCTTTAAGGAGGG + Intergenic
906934685 1:50202594-50202616 TTATTTGTTTACTTAAACTATGG + Intronic
911856927 1:102889750-102889772 TTTACTGCTTACTTTAAGTGAGG + Intronic
911892223 1:103385945-103385967 TTCTCTGATTTCTTTAAGCAAGG - Intergenic
912092127 1:106092157-106092179 TTATCTCAGTATTTTAAGTAAGG - Intergenic
913133802 1:115867618-115867640 TAATCAGTTTATTTTAAGTAAGG + Intergenic
917705743 1:177632859-177632881 TTATCTGTTTCCTTTCAGTTTGG + Intergenic
917909917 1:179633015-179633037 TTGTATGGGTACTTGAAGTATGG + Intronic
919443124 1:197664671-197664693 TTATTTGATTACTATAAGTTAGG - Intronic
919592508 1:199522009-199522031 TTATCTCTTTACTTTTAGTTGGG - Intergenic
919651753 1:200156377-200156399 TTGTATGGGTACTTGAAGTATGG - Intronic
920827785 1:209437883-209437905 TTAGCTGGATACTTAAAGGAGGG - Intergenic
922144066 1:222920658-222920680 TTTTTTGGTTACGTTAAGGAGGG + Intronic
923922434 1:238582885-238582907 TTATCTGCTAACTTTAAGATAGG + Intergenic
924187285 1:241506814-241506836 TTCTGTGGTTGCTTTAATTAAGG - Intronic
1064549953 10:16490245-16490267 TTCTCTTGGTACTTGAAGTACGG + Intronic
1064951937 10:20862082-20862104 TTATATGGGTACTTGAAGTATGG + Intronic
1065205267 10:23351354-23351376 TTATTTAGTTATTTTAACTAAGG + Intergenic
1065250754 10:23809924-23809946 TTGTATGGGTACTTGAAGTATGG - Intronic
1067399144 10:45955213-45955235 TTATCTGGTAAACTTAGGTAAGG + Intergenic
1067867464 10:49924429-49924451 TTATCTGGTAAACTTAGGTAAGG + Intronic
1068008915 10:51423025-51423047 TTATTTGGCTTCTATAAGTAAGG - Intronic
1070582366 10:77731846-77731868 TTATCCGGTTGCTTTAGGGATGG - Intergenic
1070857316 10:79616394-79616416 TTATATGTGTACTTGAAGTATGG + Intergenic
1072968598 10:99996590-99996612 CTAGCTGGTTATTTTAAGTAAGG - Intronic
1074466471 10:113686878-113686900 GTGTATGGTTACTTGAAGTATGG + Intronic
1075913705 10:126148040-126148062 TTATATTGTTACTTTTAATAAGG - Intronic
1076459511 10:130631510-130631532 TTATATGATTACTTTGAATAAGG + Intergenic
1076593814 10:131611596-131611618 TTTTCTGGTTCCTTCTAGTAAGG + Intergenic
1078127673 11:8584406-8584428 TTAACTGGATACATTAAGGATGG + Intronic
1080252321 11:30247575-30247597 ATATCTGCTGACTTTAAGTGTGG - Intergenic
1080869541 11:36225428-36225450 TTACCTGGGTGCTTGAAGTATGG + Intronic
1081478397 11:43459757-43459779 TTGTATGGGTACTTGAAGTATGG - Intronic
1084283417 11:68115033-68115055 TTGTATGTTTACTTGAAGTATGG - Intronic
1087080292 11:94163779-94163801 TTTTTTGAATACTTTAAGTAGGG + Intronic
1087532483 11:99402069-99402091 TTGTCTGGTTGCTCTAACTAGGG + Intronic
1093812423 12:23506710-23506732 TTATTTATTTACTTTAAGAAGGG + Intergenic
1095876459 12:47084306-47084328 TTGTATGGGTACTTGAAGTATGG + Intronic
1096825773 12:54276463-54276485 TTATGTGGATACTTGAAATATGG + Intronic
1096886019 12:54720047-54720069 TTATCAGATTACTCTAAATAAGG - Intergenic
1097555440 12:61131976-61131998 TTATCAATTTACTTCAAGTAAGG + Intergenic
1097908607 12:64945950-64945972 TTGTATGGGTACTTGAAGTATGG + Intergenic
1099498442 12:83380931-83380953 TTATAGGCTTACTTTAAGAAGGG + Intergenic
1100185281 12:92132191-92132213 TTATCTGGTTATTTTTAATTGGG + Intronic
1100829757 12:98506925-98506947 ATATCTGTTTACTTTTATTATGG + Intergenic
1103825039 12:123731264-123731286 TTATCTGGTAACTTTTACTCAGG + Intronic
1104692306 12:130836173-130836195 GTATCTGGTAACTTTAAGATGGG + Intronic
1105248760 13:18676472-18676494 TTTTATAGATACTTTAAGTATGG + Intergenic
1105924197 13:24992011-24992033 TTATCTTTTTTATTTAAGTAAGG + Intergenic
1105947753 13:25203801-25203823 TTATCTGGTTACTTTAAGTAAGG - Intergenic
1106041939 13:26101991-26102013 TTATCTTTTTTATTTAAGTAAGG - Intergenic
1107672122 13:42756878-42756900 TTGTATGGGTACTTGAAGTATGG - Intergenic
1109711818 13:66171264-66171286 TTTTATGGTTGCTTTAATTAAGG - Intergenic
1110006317 13:70275551-70275573 TGAACTGGTTTCTTTAAGTTTGG + Intergenic
1110032513 13:70634073-70634095 TTATCAGGATAATTTAAGAAAGG + Intergenic
1110538056 13:76675233-76675255 TAATCAGTTGACTTTAAGTAAGG + Intergenic
1113031925 13:106002892-106002914 TTATTTAGTTGCTTTAAGCAAGG + Intergenic
1114010070 14:18357173-18357195 CAATCTGGATACTTTAAGTCTGG - Intergenic
1114875455 14:26711848-26711870 TTATCTTATTTCTTTAACTAAGG + Intergenic
1115725310 14:36208496-36208518 TTATCTGCATAATTTAAGTGAGG - Intergenic
1115730491 14:36263979-36264001 TTATCTTGTTATTTTAAGCATGG - Intergenic
1115903112 14:38176262-38176284 TTATATGAGTACTTGAAGTATGG + Intergenic
1117470883 14:56043398-56043420 TTGTATGGGTACTTGAAGTATGG + Intergenic
1117515615 14:56498346-56498368 TAATCAGTTTACTTTAAGTAAGG - Intronic
1117839885 14:59849132-59849154 TGATTTGGTTAATCTAAGTAGGG - Intronic
1121167259 14:91816566-91816588 TTATCTTTTTACTTTGATTATGG + Intronic
1121770153 14:96527280-96527302 TTGACTGGTAATTTTAAGTAAGG + Intronic
1125266529 15:37887898-37887920 TTGTATTGTTACTTGAAGTATGG + Intergenic
1126501268 15:49348086-49348108 TTATCTGGAAAATTTAATTATGG + Intronic
1127351558 15:58157969-58157991 TTTTCTGGTAACAATAAGTATGG - Intronic
1129624010 15:77177623-77177645 TTTACTTCTTACTTTAAGTAAGG + Intronic
1129714961 15:77841795-77841817 TCATCAGGTTACCTTAAATAGGG + Intergenic
1131877102 15:96819707-96819729 TTATATGGGTATTTGAAGTATGG - Intergenic
1132275691 15:100561633-100561655 TTTTCTGGTTATTTTAAAGAGGG - Intronic
1133927924 16:10208609-10208631 TTGTATGGATACTTTTAGTACGG - Intergenic
1135501049 16:22996083-22996105 TTGTGTGGATACTTGAAGTATGG + Intergenic
1138238448 16:55406234-55406256 TAATCAGTTGACTTTAAGTAAGG + Intronic
1138841522 16:60514301-60514323 TTATCTAGTTACTTCAAGTTTGG + Intergenic
1139934483 16:70559250-70559272 TTCTTTGCTTACTATAAGTACGG + Intronic
1143788104 17:9271910-9271932 TTCTCTGGCGACTATAAGTACGG + Intronic
1146435344 17:32840918-32840940 TTTTATGGGTACTTGAAGTATGG - Intronic
1148943189 17:51233710-51233732 TTATATGGTCTCTTTAAATATGG - Intronic
1149026823 17:52036476-52036498 TTACCTGGTTTCTTGAAGGAGGG + Intronic
1149461966 17:56835580-56835602 TTATCTCCTTATTTTAAATAAGG + Intronic
1150599703 17:66640139-66640161 TTCTGTGGTTACTATAAATAAGG - Intronic
1150901926 17:69288791-69288813 ATAACTGGTTACTTTTAGGAAGG - Intronic
1151466357 17:74288150-74288172 TTGTATGGGTACTTGAAGTACGG - Intronic
1154027319 18:10720759-10720781 TTATCTGGTTACCCTATCTAAGG + Intronic
1154351689 18:13589098-13589120 TTATTTGTTTATTTTCAGTAGGG + Intronic
1154440410 18:14384170-14384192 TTTTATAGATACTTTAAGTATGG - Intergenic
1155435214 18:25805595-25805617 GTATGTGTTTACTTTACGTAAGG + Intergenic
1156814533 18:41294031-41294053 TTACCTGGTTTCTTCAGGTATGG - Intergenic
1159582038 18:70244368-70244390 TCATATGGCTATTTTAAGTATGG + Intergenic
925764155 2:7214767-7214789 TAAGTTGGTTACTTTAAGGAAGG + Intergenic
925936655 2:8769520-8769542 TTACCTGTTTACATTAAATAGGG + Intronic
928519421 2:32074108-32074130 TTATTTGGTGATTTTAAGGAGGG + Intronic
928602048 2:32913267-32913289 TTGTATGGGTACTTGAAGTACGG + Intergenic
932639750 2:73432459-73432481 ATATCTTAGTACTTTAAGTATGG + Intronic
932918976 2:75888197-75888219 TTACTTGGTTACTTAAATTAAGG - Intergenic
933885647 2:86717932-86717954 TTGTCTTGTTACTTGAAGAAAGG + Intronic
934034348 2:88076676-88076698 TTATCTGGGTACTTGAGGGATGG + Intronic
934878812 2:97954092-97954114 TTTTCTAGTTTCTTAAAGTAGGG - Intronic
935583373 2:104779129-104779151 TCATCTTGTTACTTCAGGTATGG - Intergenic
936962699 2:118092842-118092864 TCATCTGGTTGCTTTTAGCAAGG - Intronic
936962703 2:118092914-118092936 TAATCTGGTTGCTTTTAGCAAGG - Intronic
936962711 2:118092986-118093008 TCATCTGGTTGCTTTTAGCAAGG - Intronic
936962733 2:118093271-118093293 TCATCTGGTTGCTTTCAGCAAGG - Intronic
936962755 2:118093559-118093581 TCATCTGGTTGCTTTCAGCAAGG - Intronic
936962764 2:118093634-118093656 TCATCTGGTTGCTTTTAGCAAGG - Intronic
936962782 2:118093831-118093853 TCATCTGGTTGCTTTCAGCAAGG - Intronic
936962791 2:118093906-118093928 TCATCTGGTTGCTTTTAGCAAGG - Intronic
936962807 2:118094072-118094094 TCATCTGGTTGCTTTCAGCAAGG - Intronic
936962816 2:118094147-118094169 TCATCTGGTTGCTTTTAGCAAGG - Intronic
938131243 2:128717399-128717421 TTTTCTGTTTCCCTTAAGTAAGG - Intergenic
939018365 2:136928304-136928326 TTGTATGGTTACTTGAAGTGTGG + Intronic
939103136 2:137918798-137918820 TTTTATAGATACTTTAAGTATGG + Intergenic
940740450 2:157501892-157501914 TTATGTTGTTCCTTTAACTATGG + Intergenic
940793432 2:158052178-158052200 TTATCTGGTAACTCTAGGTAAGG + Intronic
941228401 2:162877987-162878009 TTTTATGGGTACTTGAAGTATGG + Intergenic
943530357 2:189072092-189072114 TTTTCTGGTTTCTTTTAATAGGG - Exonic
947270982 2:228335145-228335167 TTATCTGCTTTCTCTAAGAAGGG + Intergenic
1168742944 20:210081-210103 TTGTATGGGTACTTGAAGTATGG + Intergenic
1169274373 20:4223664-4223686 TTCTTTGGGTACTTGAAGTATGG - Intronic
1169528879 20:6462168-6462190 TTTTCTGGTTACTTTAATATAGG - Intergenic
1169625959 20:7569729-7569751 TTATTTGGTTGCTTCAAGTTTGG - Intergenic
1176455630 21:6907000-6907022 TTTTATAGATACTTTAAGTATGG + Intergenic
1176833802 21:13772048-13772070 TTTTATAGATACTTTAAGTATGG + Intergenic
1178091862 21:29172256-29172278 TTTTTTGGTTTCTTTAAATACGG + Intronic
1178104373 21:29301141-29301163 TTATTTTGTTCCTTTAAGTCTGG + Intronic
1178161675 21:29924454-29924476 TTCTATGGTTACTGTAAGAAAGG + Intronic
1178565858 21:33683952-33683974 TTATCTGGTAGCTTTACTTAGGG - Intronic
1179056009 21:37935118-37935140 TAATCAGTTGACTTTAAGTAGGG + Intergenic
1180434568 22:15287982-15288004 CAATCTGGATACTTTAAGTCTGG - Intergenic
949413438 3:3791545-3791567 TTATCTAGTTACTAGAAGCAAGG - Intronic
950732252 3:14970920-14970942 TTATATAGGTACTTGAAGTATGG - Intronic
950913470 3:16618558-16618580 TTATTTGATTACTTTTAGTTAGG - Intronic
951104663 3:18728909-18728931 TTCTCTGGTGACTGAAAGTATGG + Intergenic
951507518 3:23464707-23464729 TTCTCTAGTTACTGTAATTATGG + Intronic
952673980 3:36004486-36004508 TAATCAGGTAACTTTAAGTAAGG + Intergenic
953029497 3:39169232-39169254 TTGTATGGGTACTTGAAGTACGG + Intergenic
953204963 3:40818103-40818125 TTGTCTTTTTACTTTAATTAGGG + Intergenic
954719272 3:52546467-52546489 GTATCTAGATACTTTAAATATGG - Intronic
955894137 3:63680824-63680846 TTATCTGTTTATTTTTAGTGTGG - Intergenic
958086401 3:88813686-88813708 GTATCTGGTTAGTATGAGTAAGG - Intergenic
958573708 3:95920315-95920337 TTATCTGGGAACTTTAAGAAGGG + Intergenic
959161380 3:102729157-102729179 TTATCTGGTTTCTTTTTCTAGGG - Intergenic
959461824 3:106636329-106636351 TTGTATGGATACTTGAAGTATGG - Intergenic
959732009 3:109614954-109614976 TTATATGGGTACTAGAAGTATGG + Intergenic
959738106 3:109684654-109684676 TTGTATGGGTACTTAAAGTATGG + Intergenic
959838122 3:110944408-110944430 TTCTCTGGTTCCTTGAAGGATGG - Intergenic
960001700 3:112738645-112738667 TTATCTGCTTGCTTCAAATAAGG - Intergenic
960156413 3:114301170-114301192 TTATGTGGTGACTTGAATTAAGG - Intronic
960675261 3:120187461-120187483 TTGTATGGGTATTTTAAGTATGG + Intronic
962689048 3:137874849-137874871 TTATCTGATTACTCTAGTTAGGG - Intergenic
963160618 3:142148215-142148237 TTATTTGCTTTCTTTCAGTAAGG - Intronic
964248864 3:154686913-154686935 TTGTCTACTTACTTTTAGTAAGG + Intergenic
964708937 3:159650867-159650889 TTTTCTGGTTGGTTTATGTAAGG - Intronic
965687967 3:171325659-171325681 TTATCTGGCAACTTTAATTGTGG + Intronic
966121572 3:176527735-176527757 TTATTTGTTTACTTTCATTAAGG - Intergenic
967772015 3:193344417-193344439 TTATTTGGGCAATTTAAGTAAGG - Intronic
969381673 4:6803439-6803461 TTATCTGGTTACTGGTAGTTAGG + Intronic
970188795 4:13490738-13490760 TTTTCTGGTTACATTAAGACGGG - Intergenic
970627585 4:17906284-17906306 TGATCTTGTTACTTTCAGTCTGG + Intronic
971063784 4:23003879-23003901 GTATCTGGTTAGTTTAATCAGGG - Intergenic
972064679 4:34926272-34926294 TTCTCTGGTTATTTTATGTTTGG + Intergenic
972146552 4:36034305-36034327 TTCTCTGATTCCTTTAAGCAGGG + Intronic
973213410 4:47641501-47641523 ATTTCTGTTTACTCTAAGTAAGG - Intronic
973289630 4:48457860-48457882 TAATCAGTTGACTTTAAGTAGGG - Intergenic
975852192 4:78583847-78583869 TTATCGATTCACTTTAAGTAAGG - Intronic
975964907 4:79961260-79961282 TTTTTTGGTTACTTTATGTATGG - Intronic
976585256 4:86790265-86790287 TTATCAGGGTAATTTAATTATGG + Intronic
976962412 4:90994424-90994446 TTATATGGGTACTCAAAGTATGG + Intronic
977552018 4:98452301-98452323 ATATCTGATCTCTTTAAGTATGG - Intergenic
979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG + Intergenic
979646434 4:123075575-123075597 TCATCTAGTTAATTTAAGAATGG - Intronic
979648170 4:123096596-123096618 TTATTTGGGTACTTTTAGTACGG + Intronic
981571065 4:146151078-146151100 TTGTATGGATACTTGAAGTATGG - Intergenic
982469002 4:155763446-155763468 TTATCTGATTTATTTAAGTCAGG - Intronic
983824632 4:172243242-172243264 TGATCTGGTGACCTTAAGGAAGG - Intronic
984473217 4:180203675-180203697 TCATGGGATTACTTTAAGTAAGG + Intergenic
984843152 4:184086939-184086961 TTGTTTGTTTACTTTAAGTTCGG + Intergenic
986337279 5:6765051-6765073 TTGTATGGGTACTCTAAGTATGG + Intergenic
986650015 5:9954035-9954057 TTATTTGGTTCCTTGAAGAAAGG - Intergenic
987523123 5:19013116-19013138 TTGTATGGGTACTTGAAGTATGG - Intergenic
987810751 5:22832297-22832319 TAATATGTTTACTTTATGTAAGG - Intronic
988195303 5:27997422-27997444 TTTTCTGGTCACCTTAAGCAAGG - Intergenic
988397703 5:30715724-30715746 TTATAAGGATACTTGAAGTATGG - Intergenic
989038970 5:37207120-37207142 TTATCAAGTTACTTCAATTAGGG - Intronic
989131664 5:38113161-38113183 TTATCTGGTGACTATAAATAGGG - Intergenic
989611011 5:43291568-43291590 TTATCTGCTTACTACAAGTTTGG - Intronic
989691966 5:44155057-44155079 CTATGAGGTTACTTTTAGTAAGG + Intergenic
989706099 5:44332751-44332773 GTATATAATTACTTTAAGTAAGG + Intronic
990978838 5:61583539-61583561 TTGTATGGGTACTTGAAGTACGG + Intergenic
991513924 5:67412953-67412975 TTGTATAGTTACTTAAAGTACGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993581928 5:89673403-89673425 TTAGGTAGTTACTTTAAGCAAGG - Intergenic
995139300 5:108716640-108716662 TTATCTGGTTACATTTAATTTGG + Intergenic
995235048 5:109819072-109819094 TTGTATGGGTACTTGAAGTACGG - Intronic
995558440 5:113355161-113355183 TTCTCTGGATGCTTTAACTAAGG - Intronic
995777617 5:115741542-115741564 TTCTCTGATTACTCTAACTAGGG + Intergenic
995790965 5:115885920-115885942 TTATGTGGGTGCTGTAAGTATGG + Intronic
996598702 5:125235622-125235644 TTAACTGGCTACTTTCAGAATGG + Intergenic
996604945 5:125310829-125310851 TTGTATGGGTACTTGAAGTATGG + Intergenic
999589480 5:153129308-153129330 TTAGCTGGTGACCTTCAGTAGGG + Intergenic
1000248940 5:159474791-159474813 TTATATGGGTACTTGAAGCATGG - Intergenic
1000924637 5:167178889-167178911 TTTTCTTGTTACCTTAAGAAAGG + Intergenic
1002966087 6:1967875-1967897 TTTTCTGTTTCCTTTAAGAAAGG - Intronic
1004034620 6:11911269-11911291 TTGTGTGGGTACTTGAAGTAAGG - Intergenic
1004450963 6:15745940-15745962 TTACCTGGTTGCTCAAAGTATGG - Intergenic
1005739762 6:28779756-28779778 ATCTCTGGTTCCTTTTAGTAGGG - Intergenic
1005785251 6:29238437-29238459 TTCTCTGATTTCTTTAAGCACGG + Intergenic
1006525599 6:34602153-34602175 TTATTTTGTTACTTGAAATATGG - Intronic
1007866619 6:44977193-44977215 TTTTGTGGTTACTTTATTTAAGG - Intronic
1007983394 6:46182761-46182783 TTGTATGGGTACTTGAAGTATGG + Intergenic
1008168777 6:48175825-48175847 TTGTATGGATACTTGAAGTATGG + Intergenic
1008917908 6:56809992-56810014 TTAACTGTTTACTGAAAGTACGG - Intronic
1009043546 6:58211029-58211051 TTATTTGGTCACTTTACATATGG - Intergenic
1009219384 6:60965290-60965312 TTATTTGGTCACTTTACATATGG - Intergenic
1009381282 6:63033777-63033799 TGATCAGTTGACTTTAAGTAAGG + Intergenic
1010026708 6:71227085-71227107 TTACCTAGTTACTTTAGTTATGG - Intergenic
1010118530 6:72344271-72344293 TTCTCTGGTAATTTTAAGTCTGG + Intronic
1010496793 6:76542966-76542988 TTTACTAGTTAGTTTAAGTAAGG + Intergenic
1011471107 6:87708706-87708728 TTATCTGGCAACCCTAAGTAAGG + Intergenic
1012522527 6:100137911-100137933 TTTTGTGGTTATTTTAACTAAGG - Intergenic
1013997594 6:116326208-116326230 TCTTCTGGTTACTATAATTAAGG - Intronic
1014152521 6:118074626-118074648 TTATCCAGTTACTTTAAGACAGG + Intronic
1014407292 6:121067667-121067689 TTATCTGGTGAGTTTAAACAGGG - Intergenic
1016095946 6:140037358-140037380 TAATCAGTTGACTTTAAGTAAGG + Intergenic
1016167213 6:140961483-140961505 TTATCTGTTTATTATAAATAAGG - Intergenic
1016236076 6:141868508-141868530 TTGTATGGGTACTTGAAGTATGG - Intergenic
1016360615 6:143263834-143263856 TTATTTTGCTACTGTAAGTAGGG + Intronic
1016793602 6:148093496-148093518 TTCTCTGGTTTCTTAAAGTTAGG - Intergenic
1018228255 6:161651347-161651369 TAATATGGTTTCTTCAAGTATGG + Intronic
1020394427 7:7698285-7698307 TTCTCTAGTTACTTCAAGAATGG - Intronic
1020878073 7:13723225-13723247 TTGTATGTTTACTTTAAGTCTGG - Intergenic
1021407307 7:20286962-20286984 TTTTCTAGTTAGTTTGAGTAGGG - Intergenic
1021480943 7:21116164-21116186 TTATCTCTTTACTGTAAATACGG + Intergenic
1021742956 7:23706147-23706169 TTTTCTAGTTACTTAAGGTAAGG - Intergenic
1022412475 7:30149628-30149650 TTATCTGTTTGTTTTACGTAAGG + Intronic
1024450776 7:49540204-49540226 TTCTCTGGTCTCTTTATGTAAGG - Intergenic
1030271385 7:107671984-107672006 TTGTATGGTTACTTAAAGTATGG + Intronic
1030302127 7:107984923-107984945 TTATCTGGTAAGCTTAATTATGG + Intronic
1032112144 7:129085134-129085156 TTATCTGCTTTCTGTAATTATGG + Intergenic
1035817747 8:2559450-2559472 TTATTTGGTTACTGTTGGTATGG - Intergenic
1035974420 8:4292022-4292044 TTACCTAGTTACTTTAATAATGG + Intronic
1036736214 8:11319219-11319241 TTTTCTAGTTTCTTTAAGAAAGG - Intronic
1037460227 8:19101361-19101383 TTACATGGTTACTTGGAGTATGG + Intergenic
1038214760 8:25551337-25551359 TAATCAGCTGACTTTAAGTAAGG + Intergenic
1038667462 8:29551940-29551962 TCATCTGGTTAAGTTGAGTAAGG + Intergenic
1041039314 8:53830462-53830484 TTAACTGTTTACATTCAGTATGG - Intronic
1045778006 8:105829089-105829111 TCTTCTGGTTACTCTAAGGAAGG + Intergenic
1045957756 8:107928967-107928989 TTATATGGTTGGTTTAAGGAAGG - Intronic
1046409774 8:113826476-113826498 TTATTTTCTAACTTTAAGTATGG - Intergenic
1048081283 8:131130521-131130543 TCATCTAGTTACTTTATGCATGG - Intergenic
1051576042 9:18616483-18616505 TTATTTTGGTACTTTAATTATGG + Intronic
1051794607 9:20851572-20851594 ATATCTGGTAACTGAAAGTATGG + Intronic
1051925644 9:22321750-22321772 TTATCTATTGACTTCAAGTAAGG + Intergenic
1051950416 9:22624151-22624173 TTGTATGGGTACTTGAAGTAAGG + Intergenic
1052599885 9:30613155-30613177 TTATCTCTTCACTTTATGTATGG - Intergenic
1053705551 9:40749512-40749534 CAATCTGGATACTTTAAGTCTGG + Intergenic
1054415628 9:64873119-64873141 CAATCTGGATACTTTAAGTCTGG + Intergenic
1055982703 9:82020838-82020860 TTGTATGGGTACTTGAAGTACGG - Intergenic
1057688481 9:97260584-97260606 TACTCTGGTTACTTTAAGGCTGG - Intergenic
1058600497 9:106664619-106664641 CTATCTTGCTACTTAAAGTAGGG + Intergenic
1059464113 9:114456023-114456045 TTGTATGGGTACTTGAAGTATGG + Intronic
1060337606 9:122741235-122741257 TTATATAGGTACTTGAAGTACGG + Intergenic
1186250290 X:7658681-7658703 TTATCTGCTTAGTTTAAAAATGG + Intergenic
1186319744 X:8411509-8411531 TAATCAGTTGACTTTAAGTAAGG - Intergenic
1186361669 X:8848854-8848876 TAATCAGCTGACTTTAAGTAAGG + Intergenic
1187003233 X:15204041-15204063 TTTGCTGGTTACTTTAGGTTTGG - Intergenic
1187040005 X:15583970-15583992 TTTTCTAGTTCCTTTAAGTGTGG + Intronic
1187283031 X:17876470-17876492 TTAGCTGCTTACTTTTAGCAGGG + Intergenic
1188842029 X:35028070-35028092 TTATCTTGTTACTTTTAGACTGG + Intergenic
1188907612 X:35807067-35807089 TTTTCTCATTACTTTAGGTAAGG - Intergenic
1189121688 X:38401880-38401902 TAAACTGGTTATTTAAAGTAGGG + Intronic
1189707251 X:43771216-43771238 TTGTATGGGTACTTGAAGTATGG - Intronic
1189956861 X:46284460-46284482 TTATCTGGTTTCTATAACTATGG - Intergenic
1190944512 X:55078243-55078265 TCATGTAGTTGCTTTAAGTAGGG - Intronic
1190945755 X:55092176-55092198 TCATGTAGTTGCTTTAAGTAGGG - Intronic
1190964307 X:55283567-55283589 TTATGTAGTTGCTTTAAGTAGGG - Intronic
1192017692 X:67349409-67349431 TTATGTGGCTTCTTTCAGTATGG - Intergenic
1192271825 X:69588059-69588081 TAATCAGTTAACTTTAAGTAAGG + Intergenic
1194402152 X:93451538-93451560 TTCTCTAGTTTCTTTAAGTACGG + Intergenic
1195381334 X:104273798-104273820 TAATCAGTTGACTTTAAGTAAGG + Intergenic
1195459868 X:105112437-105112459 TTTTCTGGATAATTAAAGTAGGG + Intronic
1195837005 X:109127494-109127516 TTGTATGGCTACTTGAAGTATGG - Intergenic
1196688706 X:118535694-118535716 TTAGCCGTTTACTTTAAGAAAGG + Intronic
1198682554 X:139198300-139198322 TTTTGTGGTTCCTGTAAGTAGGG - Intronic