ID: 1105949129

View in Genome Browser
Species Human (GRCh38)
Location 13:25213809-25213831
Sequence AATGCCTGCACTCACCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105949129_1105949132 -2 Left 1105949129 13:25213809-25213831 CCAGCATGGTGAGTGCAGGCATT 0: 1
1: 1
2: 0
3: 18
4: 125
Right 1105949132 13:25213830-25213852 TTCCTGAGACATCTTGCATGGGG 0: 1
1: 0
2: 0
3: 17
4: 149
1105949129_1105949135 30 Left 1105949129 13:25213809-25213831 CCAGCATGGTGAGTGCAGGCATT 0: 1
1: 1
2: 0
3: 18
4: 125
Right 1105949135 13:25213862-25213884 ACATTCCTGAGTGCGTGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 94
1105949129_1105949130 -4 Left 1105949129 13:25213809-25213831 CCAGCATGGTGAGTGCAGGCATT 0: 1
1: 1
2: 0
3: 18
4: 125
Right 1105949130 13:25213828-25213850 CATTCCTGAGACATCTTGCATGG 0: 1
1: 0
2: 0
3: 5
4: 138
1105949129_1105949131 -3 Left 1105949129 13:25213809-25213831 CCAGCATGGTGAGTGCAGGCATT 0: 1
1: 1
2: 0
3: 18
4: 125
Right 1105949131 13:25213829-25213851 ATTCCTGAGACATCTTGCATGGG 0: 1
1: 0
2: 0
3: 13
4: 176
1105949129_1105949134 1 Left 1105949129 13:25213809-25213831 CCAGCATGGTGAGTGCAGGCATT 0: 1
1: 1
2: 0
3: 18
4: 125
Right 1105949134 13:25213833-25213855 CTGAGACATCTTGCATGGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105949129 Original CRISPR AATGCCTGCACTCACCATGC TGG (reversed) Intergenic
900933716 1:5752542-5752564 AGTGCCTGCTGTCACCTTGCAGG + Intergenic
901322497 1:8348384-8348406 CATTCCTACACTCACCAGGCTGG + Intergenic
901868786 1:12125505-12125527 CATGCCTGCCCTCATCAAGCAGG + Intronic
906810527 1:48822722-48822744 AAGGCCTGCAGTCAGCAAGCTGG - Intronic
907443779 1:54494606-54494628 AATGCCTTCTCTCAGCATGATGG - Intergenic
912018765 1:105076420-105076442 AATTACTGCAAGCACCATGCAGG - Intergenic
913152958 1:116063864-116063886 TATGCCTGCACTCCCCATAAAGG + Intronic
921988185 1:221335096-221335118 GATTCCTGCTGTCACCATGCTGG - Intergenic
1065617925 10:27547707-27547729 ATTCCCTGAACTCACCAAGCAGG - Intergenic
1067717041 10:48697810-48697832 AATGCCAGGTCTAACCATGCTGG + Intronic
1069825465 10:71252756-71252778 AATGCCTTCCCTCTCCTTGCAGG - Intronic
1071801769 10:89071152-89071174 AATTTCTGCACTCAACATGGTGG - Intergenic
1074405692 10:113178604-113178626 AATTACTGCACTAGCCATGCAGG + Intergenic
1075543404 10:123335066-123335088 AATGCCTGCAGTACCCATGCAGG + Intergenic
1075996003 10:126876795-126876817 AATGCCTGCTCTCATGATGTGGG + Intergenic
1076396690 10:130143652-130143674 CATGCCTGTACTCAGCATTCTGG - Intronic
1084970352 11:72768151-72768173 AGGCCCTGCCCTCACCATGCTGG + Intronic
1090762976 11:129853468-129853490 AATGTCCCCACTCACCATTCAGG + Intronic
1091708959 12:2723817-2723839 AAGGCCAGCAGGCACCATGCGGG - Intergenic
1094640315 12:32268279-32268301 AATGCAGGCACTCTCCATCCTGG - Intronic
1096233505 12:49910546-49910568 AAAGCCTGCCATCACCCTGCAGG + Intergenic
1096754388 12:53786606-53786628 AATGCCTGCTGTGCCCATGCTGG + Intergenic
1102197207 12:111034109-111034131 AATGGCTGCACTCAATATCCGGG - Exonic
1102482928 12:113236334-113236356 AATGCCTACAGGCACCAGGCAGG - Intronic
1104322417 12:127764260-127764282 AAAGCCTTCACTGACCAGGCAGG + Intergenic
1105686660 13:22789933-22789955 GATTCCTGTCCTCACCATGCTGG - Intergenic
1105949129 13:25213809-25213831 AATGCCTGCACTCACCATGCTGG - Intergenic
1106665807 13:31848936-31848958 AATCCCTGAATTCTCCATGCAGG + Intergenic
1109380534 13:61553175-61553197 ACTGCCTGCACTCCTGATGCAGG + Intergenic
1111314522 13:86535628-86535650 ATTGCCTGCTCTCATAATGCTGG - Intergenic
1111600470 13:90467774-90467796 AATTCCTGAATTCACAATGCAGG + Intergenic
1112259779 13:97867724-97867746 AGTCCCTGCATTCACCATCCTGG + Intergenic
1115224388 14:31087995-31088017 AATGCCTGCCCTTCCCATGGAGG - Intronic
1118053401 14:62053444-62053466 AAGGTCTGCAGTCAGCATGCTGG - Intronic
1119182882 14:72616120-72616142 AATACCTGCAAAGACCATGCTGG + Intergenic
1122048485 14:99039687-99039709 GATGCCTGCTCTCTCCTTGCTGG + Intergenic
1122249585 14:100428420-100428442 AATGGCTGCCCACACCAGGCTGG - Intronic
1124542269 15:30597884-30597906 AATGCCTGCTCTGACGATGCAGG - Intergenic
1124548973 15:30659989-30660011 AATGCCTGCTCTGACGATGCAGG - Intronic
1125066557 15:35493549-35493571 AATGCCTGAAATGACCATTCTGG - Intronic
1125087753 15:35751158-35751180 AATGCCTTTAGTCACAATGCTGG + Intergenic
1130132121 15:81152915-81152937 AATGACTGCACACAGCACGCAGG - Intergenic
1130321739 15:82848032-82848054 AAAGCCCCCACTCACCTTGCGGG + Intronic
1130860300 15:87880143-87880165 AATGCCTGCATTCACTCTGCTGG + Intronic
1131932144 15:97454760-97454782 AATGCTTGCAATCACCCTTCAGG - Intergenic
1132775877 16:1593751-1593773 AATGCCGGCAGTGACAATGCCGG - Intronic
1139231350 16:65285474-65285496 AATGCCTGCACTCCCCAACCTGG + Intergenic
1143171460 17:4932946-4932968 ACTGCCTGCTCTCACCGTCCTGG + Exonic
1143511595 17:7398646-7398668 AAGGCCTGCACTGGCCATCCGGG - Intronic
1152334831 17:79694898-79694920 AATTCCTACACCCACAATGCAGG + Intergenic
1152687177 17:81700470-81700492 CATGTAGGCACTCACCATGCTGG - Exonic
1153920797 18:9787705-9787727 AATGCTTGAACTCACGATGAAGG - Intronic
1155327241 18:24677028-24677050 AATGCCAGCATTCACAATGGTGG - Intergenic
1159366906 18:67478238-67478260 AATATCTGCATTCAGCATGCTGG + Intergenic
1159633351 18:70775871-70775893 AATGTCTGCAGTAAACATGCGGG - Intergenic
1160159453 18:76460214-76460236 TCTGCCTGCACTCACCGTCCAGG + Intronic
1160691885 19:464038-464060 CCTGCCTGCCTTCACCATGCTGG - Exonic
1164254404 19:23514741-23514763 AATGCCTTCACTCAGCATGAAGG - Intergenic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
925292206 2:2755489-2755511 ACTGCCTGCCTCCACCATGCAGG + Intergenic
927060309 2:19412456-19412478 CATCCCTGCCCTCACCAAGCTGG - Intergenic
927183901 2:20468380-20468402 AAGGCCTGTACCCAGCATGCTGG + Intergenic
928786574 2:34893824-34893846 AATGAATGCAATCACCATACTGG - Intergenic
929375701 2:41284250-41284272 AATCCCTGCAGTCAGCATGATGG - Intergenic
930930689 2:56878148-56878170 AATGCCTGCTCTCACCATGCCGG + Intergenic
932927538 2:75994289-75994311 AGTGTCTGCTCTCACCATGAGGG - Intergenic
937334595 2:121054254-121054276 AATGCCTCCACTCCCCACTCAGG - Intergenic
937363894 2:121247063-121247085 CAGGCCTGCACTGACCAAGCAGG - Intronic
938050039 2:128161077-128161099 GCTGCCTGCACTCAGCAAGCTGG - Intronic
938298734 2:130195261-130195283 AAGGCCTGTACTCACCAAGATGG + Intronic
938457987 2:131479252-131479274 AAGGCCTGTACTCACCAAGATGG - Intronic
938825958 2:135005501-135005523 AATGACTGCAGTCACCATCTTGG + Exonic
939576623 2:143902928-143902950 AATGCCTGCTCTAGGCATGCAGG + Intergenic
940072330 2:149702676-149702698 AGTGCCTGCATTCTCCAGGCAGG - Intergenic
942580062 2:177408599-177408621 AGTGGCAGCACTCACCATGTGGG - Intronic
945305045 2:208252043-208252065 AATGCTAGCACTCACCATTCTGG - Intronic
945317047 2:208380617-208380639 AATGGCTGCACCCACCAGGCAGG - Intronic
946972823 2:225114543-225114565 AATGCATGCACTGACCCTGCAGG + Intergenic
1170430280 20:16269298-16269320 CATGCGTGCACTTACCATCCGGG - Intergenic
1170885951 20:20340060-20340082 GAGCCCTGCCCTCACCATGCAGG + Intronic
1177578570 21:22990508-22990530 ATTGCATGAACTCACCATGTAGG + Intergenic
1178884704 21:36476065-36476087 AGAGCCTGCACTCAGCAGGCAGG - Intronic
1182046812 22:27281271-27281293 AATGCCTGATCTAACCTTGCTGG - Intergenic
1183139026 22:35918567-35918589 AATGCCAGCACTCAACAAACTGG + Intronic
953311321 3:41882705-41882727 AATGCCTGCTCTGACGATGCAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954315448 3:49798955-49798977 CATGCCTGCCCCCACCCTGCCGG + Intronic
960807351 3:121597038-121597060 ACTGCCTGCACACACCTCGCTGG + Intronic
962084368 3:132174487-132174509 GGTGCCCGCACTCACCATGGGGG + Intronic
962372672 3:134833812-134833834 AATCTCAGCACACACCATGCTGG - Intronic
964409194 3:156380605-156380627 AATGGCTTCACTAAACATGCTGG - Intronic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
965859670 3:173133396-173133418 AATACCTGCACTGACTGTGCGGG - Intronic
966296342 3:178427804-178427826 AGTGCCTGCATGCACCATCCAGG - Intronic
970415252 4:15850669-15850691 AATCCCTGGACTGACCATGGTGG - Exonic
970784690 4:19782218-19782240 AATGCATGCCCTCACTATTCTGG + Intergenic
977322267 4:95532534-95532556 AATTCCTGTACTCATCATGCTGG + Intronic
985434706 4:189917379-189917401 AATCCCTGCGCTGACCCTGCCGG + Intergenic
993012390 5:82498484-82498506 AAAGCCTGAACTGACCATGTGGG - Intergenic
993131660 5:83905805-83905827 AATGCCTACACTAAGCATGGAGG - Intergenic
994289319 5:98009467-98009489 AGTGCCTGCACTTACCATTTAGG + Intergenic
995944916 5:117633251-117633273 AATGCCTGCATATACCACGCAGG - Intergenic
997658643 5:135573686-135573708 CATGCATGCACACACCATGCAGG - Intronic
1005679171 6:28188617-28188639 AAAGCCTTCACTCAGTATGCCGG + Intergenic
1006699291 6:35958695-35958717 AATGCCTCCACCCGCCATGCAGG - Intronic
1007963668 6:45984345-45984367 TATCCCTGGACTCACCATGTTGG + Intronic
1008007854 6:46431109-46431131 CATGCATGCACACACAATGCTGG - Intronic
1013375073 6:109507047-109507069 AATTTCTACACTCAGCATGCTGG + Intronic
1017012109 6:150069907-150069929 GATGGCTGCAGTCACCATCCAGG - Intergenic
1018022989 6:159779880-159779902 AATGACTGTTCTTACCATGCTGG + Exonic
1018153367 6:160961523-160961545 AATGCCTGCTCTCATCACTCAGG + Intergenic
1020258001 7:6513032-6513054 AACCCCTGCACTCAGCATGCAGG - Intronic
1022195486 7:28062521-28062543 AAGGCCTGCATGCAGCATGCAGG - Intronic
1023897006 7:44442417-44442439 CTTGCCTGCAGTCTCCATGCTGG - Intronic
1025018734 7:55464172-55464194 AGTGCCTGCACACACCATCGTGG - Intronic
1028111103 7:86942453-86942475 ATAGCTTGCATTCACCATGCAGG + Intronic
1029107853 7:98193191-98193213 ACTCCCTACACTCACCCTGCTGG - Exonic
1033923896 7:146432842-146432864 AAAGCCTGCATTCTCCGTGCCGG + Intronic
1034267336 7:149787558-149787580 CCCGCCTGCACTCACCGTGCAGG - Intergenic
1035081792 7:156222310-156222332 AATTCCTTCTCTCACCATCCTGG - Intergenic
1035472019 7:159116392-159116414 CATGCGGGCACTGACCATGCCGG - Intronic
1035774789 8:2179962-2179984 ACTGCCGGCACTCACCACGGAGG - Intergenic
1036101477 8:5791124-5791146 AATACCTCCACACACAATGCAGG - Intergenic
1036465299 8:8991849-8991871 AGTACCTCCACACACCATGCCGG - Intergenic
1037366661 8:18129392-18129414 AATGTCTGCAGTGACCATGCAGG + Intergenic
1040077878 8:43258509-43258531 AATGCCTGCTATCACTGTGCAGG - Intergenic
1045962861 8:107989110-107989132 AATGCAGGCACTCTCCATACTGG + Exonic
1048247769 8:132827409-132827431 CATTCCTGCACTGACAATGCAGG - Intronic
1048681264 8:136843803-136843825 GGTGCCTGCACTCACCATTTGGG + Intergenic
1050201808 9:3153053-3153075 AATGCCTCCAGTGACCACGCAGG + Intergenic
1051140991 9:13978778-13978800 AATGCCTCCTCTCACTATGCTGG - Intergenic
1053030919 9:34777316-34777338 AATGCCAGCACACACCAACCAGG - Intergenic
1054971604 9:71094217-71094239 GATGCCTGCACACAACGTGCAGG - Intronic
1056784724 9:89582191-89582213 AGTGCCTGCTCCCACCAGGCAGG + Intergenic
1057889905 9:98862035-98862057 AACTCCTGCACTCTCCAAGCAGG - Intergenic
1060113913 9:120926283-120926305 AAAGCCTTCAGTCACCATCCAGG - Exonic
1061331275 9:129895465-129895487 AAAGCCGGCACGCATCATGCAGG - Intronic
1061544907 9:131298909-131298931 AATGTCTGAACCCCCCATGCAGG - Intronic
1185978842 X:4752916-4752938 AATGCATGCACTCAGCAAGCAGG + Intergenic
1187088086 X:16062955-16062977 AAGACCTGCAGTCACCAAGCTGG - Intergenic
1187681037 X:21768246-21768268 AATGACACCACACACCATGCAGG + Intergenic
1188483267 X:30655373-30655395 AATGCCTGCAGGGACCAGGCAGG + Intronic
1193269911 X:79516617-79516639 GATGCCTGCAGTCACCATTCGGG + Intergenic
1193958587 X:87894885-87894907 AATGCCTGCAAGGACCAAGCTGG - Intergenic
1200207504 X:154327951-154327973 AATGCCCACACACACCTTGCGGG - Exonic