ID: 1105957706 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:25300291-25300313 |
| Sequence | TCACCTTGGTGGGTCGCCCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 75 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 68} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105957706_1105957711 | 7 | Left | 1105957706 | 13:25300291-25300313 | CCATGGGCGACCCACCAAGGTGA | 0: 1 1: 0 2: 1 3: 5 4: 68 |
||
| Right | 1105957711 | 13:25300321-25300343 | TAAATTGAATTACCTCCCAAAGG | 0: 1 1: 5 2: 19 3: 211 4: 1024 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105957706 | Original CRISPR | TCACCTTGGTGGGTCGCCCA TGG (reversed) | Intergenic | ||