ID: 1105957706

View in Genome Browser
Species Human (GRCh38)
Location 13:25300291-25300313
Sequence TCACCTTGGTGGGTCGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105957706_1105957711 7 Left 1105957706 13:25300291-25300313 CCATGGGCGACCCACCAAGGTGA 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105957711 13:25300321-25300343 TAAATTGAATTACCTCCCAAAGG 0: 1
1: 5
2: 19
3: 211
4: 1024

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105957706 Original CRISPR TCACCTTGGTGGGTCGCCCA TGG (reversed) Intergenic