ID: 1105957926

View in Genome Browser
Species Human (GRCh38)
Location 13:25301571-25301593
Sequence TACGTGCGCGCGGCGAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105957917_1105957926 27 Left 1105957917 13:25301521-25301543 CCCACTCACGTACCAGGGCTCAT 0: 1
1: 0
2: 0
3: 10
4: 57
Right 1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1105957915_1105957926 29 Left 1105957915 13:25301519-25301541 CCCCCACTCACGTACCAGGGCTC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1105957920_1105957926 15 Left 1105957920 13:25301533-25301555 CCAGGGCTCATTGCGTGACGGTT 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1105957918_1105957926 26 Left 1105957918 13:25301522-25301544 CCACTCACGTACCAGGGCTCATT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 37
1105957916_1105957926 28 Left 1105957916 13:25301520-25301542 CCCCACTCACGTACCAGGGCTCA 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1105957926 13:25301571-25301593 TACGTGCGCGCGGCGAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105957926 Original CRISPR TACGTGCGCGCGGCGAGCGC CGG Exonic