ID: 1105964465

View in Genome Browser
Species Human (GRCh38)
Location 13:25372119-25372141
Sequence CGCCGCCCGAGGACCATGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105964465_1105964479 23 Left 1105964465 13:25372119-25372141 CCACCCATGGTCCTCGGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1105964479 13:25372165-25372187 TAGCCTCCGTCTCTCGCCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1105964465_1105964478 22 Left 1105964465 13:25372119-25372141 CCACCCATGGTCCTCGGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1105964478 13:25372164-25372186 GTAGCCTCCGTCTCTCGCCCGGG 0: 1
1: 0
2: 1
3: 85
4: 2665
1105964465_1105964477 21 Left 1105964465 13:25372119-25372141 CCACCCATGGTCCTCGGGCGGCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1105964477 13:25372163-25372185 CGTAGCCTCCGTCTCTCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105964465 Original CRISPR CGCCGCCCGAGGACCATGGG TGG (reversed) Exonic