ID: 1105964592

View in Genome Browser
Species Human (GRCh38)
Location 13:25372574-25372596
Sequence GGGCGCACGGGCACGCGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105964592_1105964602 12 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964602 13:25372609-25372631 GCGGCTCAGGGATGCGACCTAGG 0: 1
1: 0
2: 0
3: 11
4: 94
1105964592_1105964605 30 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964605 13:25372627-25372649 CTAGGCGGCAGTCACCGCGATGG 0: 1
1: 0
2: 0
3: 1
4: 38
1105964592_1105964603 15 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964603 13:25372612-25372634 GCTCAGGGATGCGACCTAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 78
1105964592_1105964596 -7 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964596 13:25372590-25372612 TGCGCCCCTACGCGCGGATGCGG 0: 1
1: 0
2: 0
3: 0
4: 18
1105964592_1105964601 0 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964601 13:25372597-25372619 CTACGCGCGGATGCGGCTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 14
1105964592_1105964600 -1 Left 1105964592 13:25372574-25372596 CCTGTGCGCGTGCCCGTGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1105964600 13:25372596-25372618 CCTACGCGCGGATGCGGCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105964592 Original CRISPR GGGCGCACGGGCACGCGCAC AGG (reversed) Intronic