ID: 1105966340

View in Genome Browser
Species Human (GRCh38)
Location 13:25388181-25388203
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13401
Summary {0: 1, 1: 18, 2: 223, 3: 2174, 4: 10985}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105966331_1105966340 14 Left 1105966331 13:25388144-25388166 CCTTATTTAGTGTCAGAATTAAG 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG 0: 1
1: 18
2: 223
3: 2174
4: 10985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr