ID: 1105966340 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:25388181-25388203 |
| Sequence | AAGGAGAGAAAGAAGGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 13401 | |||
| Summary | {0: 1, 1: 18, 2: 223, 3: 2174, 4: 10985} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105966331_1105966340 | 14 | Left | 1105966331 | 13:25388144-25388166 | CCTTATTTAGTGTCAGAATTAAG | 0: 1 1: 0 2: 0 3: 15 4: 197 |
||
| Right | 1105966340 | 13:25388181-25388203 | AAGGAGAGAAAGAAGGAGGAAGG | 0: 1 1: 18 2: 223 3: 2174 4: 10985 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105966340 | Original CRISPR | AAGGAGAGAAAGAAGGAGGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||