ID: 1105969910

View in Genome Browser
Species Human (GRCh38)
Location 13:25419083-25419105
Sequence GTGTGTGCACGCACGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105969909_1105969910 13 Left 1105969909 13:25419047-25419069 CCATGTGTGTGCATATGTGTGTG 0: 1
1: 38
2: 199
3: 2421
4: 3465
Right 1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG 0: 1
1: 0
2: 4
3: 46
4: 253
1105969908_1105969910 19 Left 1105969908 13:25419041-25419063 CCAGGGCCATGTGTGTGCATATG 0: 1
1: 0
2: 1
3: 30
4: 266
Right 1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG 0: 1
1: 0
2: 4
3: 46
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105969910 Original CRISPR GTGTGTGCACGCACGTGTTG AGG Intronic
900215585 1:1479875-1479897 GCGTGTGCATGCCCGTGTGGGGG - Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900464640 1:2819573-2819595 GTGTGTGCACACAGGTGTGTGGG - Intergenic
900563654 1:3321224-3321246 ATGTGTGCACACACGCGTGGGGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901804620 1:11730391-11730413 GCGTGTGCACGCACATGTGCAGG - Intergenic
902074955 1:13777067-13777089 CTGTGTGCATGTGCGTGTTGTGG - Intronic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
903974319 1:27139158-27139180 GTATGGGCAGGCACCTGTTGGGG - Intronic
905174384 1:36126716-36126738 GTGTGTGCGCGCATGGGTGGGGG + Intergenic
905948262 1:41921899-41921921 GTGTGTGTGCGCACTTTTTGGGG - Intronic
907460166 1:54601147-54601169 GTGTGTGCATGCATGTGTGTGGG + Intronic
908628252 1:66072082-66072104 GTGTGTACATGTACGTGTGGTGG - Intronic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
913235558 1:116778407-116778429 ATGTGAGCAAGCACATGTTGGGG - Intergenic
915549912 1:156625778-156625800 GTGTGTGCACGCTCATGTCGGGG + Intergenic
918691147 1:187480806-187480828 GTGTGTGCACTCAAGAGTCGGGG - Intergenic
921566016 1:216721297-216721319 GTGTATACACACACGTGATGGGG + Intronic
921874703 1:220181393-220181415 GTGTATGCATGCATGTGTAGGGG + Intronic
921939264 1:220823271-220823293 GTGTGTGCATGCATGTGTGGGGG + Intergenic
921960524 1:221029062-221029084 GTGTGTGCATGTACATGTTCGGG - Intergenic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1063061323 10:2557099-2557121 GTGTGTGTGCACACGTGTGGGGG + Intergenic
1063177845 10:3568293-3568315 GTCTGTGCACACAGGTGGTGTGG - Intergenic
1063261970 10:4399851-4399873 CTGTCTGCACACACGTGTAGAGG - Intergenic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1065063019 10:21927709-21927731 GTGTGTGTGCGTATGTGTTGTGG + Intronic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1067222771 10:44355974-44355996 GTGTGTGCACGCTAGGGGTGGGG + Intergenic
1068189447 10:53631613-53631635 GTGTGTGCAGGCAGGGTTTGGGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1070802688 10:79252723-79252745 GTGTGTGCAGGCATCTGCTGGGG + Intronic
1070938587 10:80322092-80322114 GTGTGTACACGTAGGTGTTTCGG - Intergenic
1071953600 10:90732813-90732835 GTGTGTGCATGCACATGTATAGG + Intergenic
1072202778 10:93176190-93176212 GTGTGCGCGCACACATGTTGAGG + Intergenic
1073035726 10:100562988-100563010 GTGGGTGGACGGGCGTGTTGAGG + Intergenic
1073042071 10:100614639-100614661 GGCTGTGCACGCACATGTTGGGG + Intergenic
1073082670 10:100869728-100869750 GTGTGTGCATGCATGTGTGTAGG + Intergenic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1073586966 10:104719838-104719860 GTGTGTGAATGTATGTGTTGGGG + Intronic
1074550096 10:114434753-114434775 TCATATGCACGCACGTGTTGGGG + Intronic
1075476926 10:122743979-122744001 GTGTGCACATGCACGTGCTGCGG - Intergenic
1075654938 10:124155074-124155096 GAGTGTGCATGCATGTGTGGGGG - Intergenic
1076253207 10:128999250-128999272 GTGTGTGTGCGCATGTGTTTAGG - Intergenic
1077441597 11:2571568-2571590 GTGGGTGCAGGCAAGTGTGGAGG + Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078065928 11:8079652-8079674 GTGTGTGCATGCATGTGTGTAGG + Intronic
1078955482 11:16189433-16189455 GTGTGTGTACACATATGTTGGGG + Intronic
1079076216 11:17386879-17386901 GTGTGTACACACGCGTGTGGGGG + Exonic
1080018556 11:27533851-27533873 GTGTGTGCATGCATGTAATGAGG + Intergenic
1080999416 11:37650038-37650060 GTGTGTGTATGCATGTGTAGGGG - Intergenic
1082923204 11:58518288-58518310 GTGTGACCACGCACGAGCTGGGG - Intergenic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1086539116 11:87886329-87886351 GTGTGTGCATGCACATGTGCAGG + Intergenic
1089257109 11:117199837-117199859 GTGTGTGAACGCACCTGTGTTGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092255326 12:6923972-6923994 GTGTGTGCACGCGCATTTTGGGG + Intergenic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092571430 12:9727266-9727288 GTATGTGCAAGCACAGGTTGGGG - Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1095692845 12:45110218-45110240 GTGTGTGCGCGCACGGGGGGTGG - Intergenic
1100719226 12:97339663-97339685 GTGTGTGCACGCACGTGTGCAGG + Intergenic
1100813257 12:98361312-98361334 GTGTGTTCACACATGTGGTGGGG + Intergenic
1100813270 12:98361471-98361493 GTGTGTTCATGCATGTGGTGGGG + Intergenic
1101966339 12:109284781-109284803 GTGTGTGTGCGCACATGCTGTGG + Intronic
1103291671 12:119851278-119851300 GTGAGTGCACGCACATGTGTAGG + Intronic
1103919478 12:124392044-124392066 GTGTGTACACACGCGTGTGGAGG + Intronic
1104000373 12:124856395-124856417 GTGTTTGCACACACGTGTGTTGG - Intronic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106843045 13:33707391-33707413 GGGTGTGCTGGCATGTGTTGTGG - Intergenic
1107934436 13:45333426-45333448 GTGTGTGCACACAGGTGGAGTGG - Intergenic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1109024304 13:57140366-57140388 GTGGGTGCACTCACGGGTGGAGG - Intergenic
1109025209 13:57146471-57146493 GTGGGTGCACTCACGGGTGGAGG - Intronic
1109026199 13:57153044-57153066 GTGGGTGCACTCACGGGTGGAGG - Intronic
1109027191 13:57159615-57159637 GTGGGTGCACTCACGGGTGGAGG - Intergenic
1109028177 13:57166180-57166202 GTGGGTGCACTCACGGGTGGAGG - Intergenic
1109029164 13:57172751-57172773 GTGGGTGCACTCACGGGTGGAGG - Intergenic
1110798483 13:79668184-79668206 ATGTGTGCAGGCAAGTATTGAGG + Intergenic
1113349672 13:109516790-109516812 GTGTGTGCGCGCACATGTGCAGG + Intergenic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1118607039 14:67512159-67512181 GTGTGAGAATGCATGTGTTGGGG - Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1119695932 14:76713477-76713499 GTGTGTGCACGGATGTGTGCTGG - Intergenic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1123682463 15:22772599-22772621 GTGTGTGTACGTACGTATTATGG - Intergenic
1124334213 15:28845111-28845133 GTGTGTGTACGTACGTATTATGG - Intergenic
1126419531 15:48456866-48456888 GTGTGTGCGTGCATGTGTTGGGG + Intronic
1127333003 15:57956805-57956827 GCTTCTGCACGCACTTGTTGGGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1131784842 15:95901279-95901301 GTGTGTGCGCACACGCGTGGGGG + Intergenic
1132548307 16:543732-543754 GCCTGTGCATGCACGTGGTGGGG - Intronic
1132649271 16:1013161-1013183 GGGTGTGCACGCATGTGTCCTGG - Intergenic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1134329265 16:13235493-13235515 GTGTGTGGACGCATGTATTAGGG - Exonic
1135656415 16:24254374-24254396 GTGTATGCATGCACGTGTGTAGG - Intergenic
1135830028 16:25764871-25764893 GTGTGTGCATGAACTTGCTGTGG + Intronic
1136690410 16:32024496-32024518 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136790999 16:32968060-32968082 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1136878814 16:33885872-33885894 GTGTGTGCACGTATGTGTGCTGG + Intergenic
1141304749 16:82851695-82851717 GTGTGTGCATGCACATGTCCTGG + Intronic
1141636063 16:85314513-85314535 ATGTGTGCACACACGTGTAGGGG - Intergenic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1142410585 16:89913953-89913975 GTGTGTGTGCGCATGTGGTGTGG + Intronic
1203093206 16_KI270728v1_random:1229517-1229539 GTGTGTGCACGTATGTGTGCTGG - Intergenic
1143461555 17:7107601-7107623 GTGTGTGTATGCATGTGTGGTGG - Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147045894 17:37751856-37751878 GTGTGTGCCCCCACCTGTTTCGG - Intergenic
1147585528 17:41652191-41652213 GTGTGTGCATGCATGTGTGTTGG - Intergenic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1149001875 17:51765729-51765751 GTGTGTGCATGCATGTGTTTAGG + Intronic
1149806325 17:59620602-59620624 GTGTCTGCACCCAGGAGTTGTGG + Intronic
1151379061 17:73712279-73712301 GTGTGTGCGTGCACATGTGGGGG + Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1152048121 17:77952153-77952175 GTGCATGCATGCATGTGTTGGGG - Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1152575499 17:81138952-81138974 GGGTGCGCGCGCACGTGTGGGGG - Intronic
1152733454 17:81984975-81984997 GGGTGTGCACGCAGGTGTGTGGG - Intronic
1154050466 18:10951470-10951492 TTTTGTGCACATACGTGTTGGGG - Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1158379901 18:56917545-56917567 GTGTGTGCATGCATGTGTGTGGG + Intronic
1160968055 19:1755203-1755225 GTGTGAGCGCGCGCCTGTTGGGG + Intronic
1165159237 19:33806104-33806126 GTGTGTGTATGCCTGTGTTGTGG + Intronic
1165898679 19:39158247-39158269 GTGTGAGCATGCATGTGTTGCGG + Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167112215 19:47469148-47469170 GTGTGTGCAGGCAAGGGTGGGGG + Intronic
924991805 2:318909-318931 GTGTGTGCGGGCACGTGTGCAGG + Intergenic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926164606 2:10513274-10513296 GTGTGTGCACACAAATGTGGGGG - Intergenic
926435795 2:12836256-12836278 GTGTGTGCGCACACGCGCTGAGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927917106 2:26944387-26944409 GTGTGTGCATGCATGTGTATGGG - Intronic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
930003444 2:46877553-46877575 GTTTGTGCACGCGCGTGTCTGGG - Intergenic
931262592 2:60633068-60633090 GTGCGTGCATGCACGTATTTGGG + Intergenic
931473807 2:62567771-62567793 GTGTGCGCATGCATGTGGTGAGG + Intergenic
931716259 2:65031403-65031425 GTGTGGGCAAGCACCTGCTGCGG - Intergenic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
937090805 2:119205077-119205099 GTGTGTGCAAGCCCCTGATGGGG - Intergenic
937244877 2:120486219-120486241 GTGTGAGCAGGCATGTGTTGGGG - Intergenic
937804392 2:126121423-126121445 GTGTGTGCAAGCAAGTGTAGGGG - Intergenic
938083866 2:128385470-128385492 GTGTGTGCACACACAGGTCGGGG + Intergenic
939075702 2:137600092-137600114 GTGTGTGCATGCATGTGTGCAGG - Intronic
939862333 2:147435191-147435213 GTGTGTACACACACATGTTTTGG - Intergenic
941547057 2:166864660-166864682 GTGTGTGCATGCACATTTTGGGG + Intergenic
945906798 2:215603315-215603337 GTGTGTGCCTGGATGTGTTGGGG - Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947461655 2:230309035-230309057 GTATTTGCATCCACGTGTTGTGG - Intronic
1169580516 20:7018044-7018066 GTGTGTGTATGCATGTGTTTTGG + Intergenic
1170933238 20:20787825-20787847 GTGTGTGCACGCCTGTGTGTGGG - Intergenic
1171249053 20:23634977-23634999 GTGTGTGCACATATGTGTGGGGG - Intronic
1174361619 20:50032265-50032287 GTTTTTGCACACACGTGGTGGGG + Intergenic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1175073371 20:56353495-56353517 GTGTGTGCATGCATGTGTGCGGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175760801 20:61561130-61561152 GTCTGTGCACCCAGGTCTTGGGG - Intronic
1175778503 20:61667661-61667683 GAGTGTGCATGCACGTGTGCAGG - Intronic
1175952942 20:62593139-62593161 GTGTGTGCATGCATGTATGGGGG + Intergenic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1176196771 20:63840504-63840526 CTGTGTGCACCCATGTGTAGTGG + Intergenic
1177756345 21:25352834-25352856 GTGTGTGCATGCATGTGTGAAGG - Intergenic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1182303154 22:29350021-29350043 GGGCGGGCACGCACTTGTTGGGG + Exonic
1183614874 22:38937936-38937958 GTGTGTGTAGGCATGTATTGAGG + Intergenic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184400210 22:44269463-44269485 GTGTGTGTGTGCGCGTGTTGTGG - Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
951218185 3:20043351-20043373 GTGTGTGTATGCATGTGTTGGGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953284480 3:41593389-41593411 GTGTGTGCATGCATGTGTGTAGG - Intronic
953384811 3:42500515-42500537 GTGTGTGTATGTATGTGTTGAGG + Intronic
954679962 3:52339824-52339846 GTGTGTGTACACACGTGCTGGGG + Intronic
955151472 3:56371555-56371577 GTGTGTGCATGCATGTGGTTGGG - Intronic
955456781 3:59130293-59130315 GTGTGTGCGCGCTTGTGTTCAGG + Intergenic
956897257 3:73675471-73675493 GTGTGTGCACCCACGCGTGGTGG + Intergenic
960988140 3:123293561-123293583 GTGTGTGCACACAGGTGAGGAGG + Intronic
961214385 3:125148291-125148313 GTGTGGGCACCTATGTGTTGGGG + Intronic
961638841 3:128352106-128352128 GTGTGTGCATGCATGTGTGATGG - Intronic
964812887 3:160684549-160684571 GTGTGTGTGCGCATGTGTAGCGG - Intergenic
964824253 3:160808315-160808337 GTGTGTGCGTGCATGTGTGGTGG + Intronic
965132474 3:164719047-164719069 GTGTGTGCATGCATCTGTTGTGG + Intergenic
965350319 3:167603902-167603924 GTGTGTGCATGCACTGGTAGTGG + Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
966711655 3:182979359-182979381 GTGTGTGCGCGCCTGTGTTAAGG - Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967460858 3:189744394-189744416 GTGTGTGCGGGCACTGGTTGTGG - Intronic
967778281 3:193407257-193407279 GTGTGTGCACGCATGTGTGTAGG - Intronic
968107701 3:196014131-196014153 GGGTGTGGACTCAGGTGTTGTGG + Intergenic
968107712 3:196014175-196014197 GGGTGTGGACTCAGGTGTTGTGG + Intergenic
968107741 3:196014291-196014313 AGGTGTGCACTCAGGTGTTGTGG + Intergenic
968959330 4:3734975-3734997 GTGTGTGAAGGCGCGTGGTGTGG + Intergenic
969698076 4:8747280-8747302 ATGTGTGAACGCATGTGTGGCGG - Intergenic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976906131 4:90238653-90238675 GTGTATGTGCGCACGAGTTGAGG - Intronic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
981316432 4:143344249-143344271 GTGAGTGCCAGCTCGTGTTGGGG + Intronic
982917979 4:161238036-161238058 GTGTGTGCACTCATGTGTGCCGG + Intergenic
985795716 5:1960478-1960500 ATGTGTGCACGTGCATGTTGAGG - Intergenic
986719993 5:10554143-10554165 GTGTGTGCATGCAGGTGTGCTGG + Intergenic
987794535 5:22609054-22609076 TTGTGTGCATGCATGTGTTGAGG + Intronic
988126714 5:27049036-27049058 GTGAGTGCATGAAGGTGTTGGGG - Intronic
988563261 5:32299780-32299802 GTGTGTGCACACATGTGTGATGG - Intronic
990978257 5:61578069-61578091 GTGTGTGCATACACATGTTGGGG - Intergenic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001182539 5:169533952-169533974 GTGTACGCACACACATGTTGAGG + Intergenic
1003009512 6:2413629-2413651 GTGTTTGCATGCACGTGCTCAGG - Intergenic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1006597279 6:35202674-35202696 GTGTGTGTGTGTACGTGTTGGGG + Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007574600 6:42916748-42916770 ATGTGTGCATGTACGTGGTGGGG + Intronic
1008797402 6:55321004-55321026 GTGTGTGCAAGCACTTTTTCAGG - Intergenic
1010373742 6:75141745-75141767 GTGTGTGCATGTATGTGTAGTGG - Intronic
1012606904 6:101168615-101168637 GTGTGTGCACGCATGCTGTGTGG + Intergenic
1013697054 6:112716024-112716046 CTGTGTGCACTCCCGTGTTAAGG + Intergenic
1014189915 6:118483420-118483442 GTGTGTGCATGCATGTGTATGGG + Intronic
1014432960 6:121390767-121390789 CTGTGTGCAGGCCTGTGTTGGGG - Intergenic
1015594904 6:134857190-134857212 ATTTGTGCATGCATGTGTTGAGG - Intergenic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018187096 6:161274695-161274717 GTGTGTGCACGCCTGTGCAGTGG - Intergenic
1018197783 6:161369657-161369679 ATGTGTGTACGCACGCGTGGTGG + Intronic
1019127906 6:169853544-169853566 GTGTGTGCACACACGTGCCCTGG + Intergenic
1019407805 7:892971-892993 GTGTTTGCAGGTAAGTGTTGGGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1023369750 7:39501366-39501388 GTGTGTGTACACACAAGTTGGGG + Intergenic
1023867761 7:44246567-44246589 ATGTGTGCATGCACGTGTGTGGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1032552436 7:132797040-132797062 GTGTGTGCAGGCAGGAGTAGAGG - Intronic
1034071248 7:148187978-148188000 GTGTGTGCACGCATGTATGCGGG - Intronic
1034269832 7:149798117-149798139 GTCTGTGCACACACCTGTCGGGG - Intergenic
1034491052 7:151393294-151393316 GTGTGTGCACACAGGTGTGTGGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035226125 7:157433297-157433319 GTGTGTGCAGGCATGTGTGAGGG - Intergenic
1036044942 8:5129345-5129367 GTGTGTGCATGCATGTGTTATGG + Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1038088824 8:24230700-24230722 GTGTGTGCACAGAGGTGGTGAGG + Intergenic
1038644714 8:29351930-29351952 GTTTGTGCACGCACGCGGTGGGG + Intergenic
1039466466 8:37788513-37788535 ATGCGTGCATGCACGTGTTGGGG - Intronic
1039466477 8:37788589-37788611 GTGCGTGCATGCACATGTTGGGG - Intronic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1043128279 8:76428088-76428110 GTGTGTGCATGCACAGATTGGGG - Intergenic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1047866889 8:129034688-129034710 CTCTGTGCAAGCATGTGTTGGGG - Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1048468705 8:134688333-134688355 GTGTATGTACACACGTTTTGCGG - Intronic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050485880 9:6134247-6134269 GTGTGTGCATGCACGTGTGACGG + Intergenic
1051642046 9:19231827-19231849 TTGTGTGCAAACCCGTGTTGAGG + Intronic
1053386295 9:37692926-37692948 GTGTGTGTAGGTACATGTTGGGG - Intronic
1057457549 9:95228117-95228139 CTGTGTACAAGCAGGTGTTGGGG - Intronic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1060826870 9:126692814-126692836 GTGTGTGCATGCCTGTGCTGTGG + Intronic
1062010150 9:134262500-134262522 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1062010154 9:134262536-134262558 GTGTGAGCACGCACATGTTGGGG - Intergenic
1062010163 9:134262644-134262666 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1186349949 X:8731234-8731256 GTGCGTGTATGCGCGTGTTGGGG - Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188536114 X:31198885-31198907 GTGTGTGCATGTATGTGTTTTGG + Intronic
1189364221 X:40375836-40375858 GTGTGTACACGCATGTGTGTGGG + Intergenic
1189761351 X:44324553-44324575 GTGTGTGTATGCAGGGGTTGGGG - Intronic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1196195496 X:112834731-112834753 GTGTGCGCATGCACGTTTTAAGG - Intronic
1198135733 X:133748571-133748593 GTGTGTGAATACATGTGTTGGGG - Intronic
1198671802 X:139089146-139089168 GTGTGTGCACGCATGTGTGTTGG + Intronic
1199904623 X:152212464-152212486 ATGTGTGTACACACGAGTTGTGG + Intronic
1199942448 X:152638817-152638839 GCGCGTGCATGCATGTGTTGAGG + Intronic