ID: 1105974724

View in Genome Browser
Species Human (GRCh38)
Location 13:25463563-25463585
Sequence CCTGCTCCCCTGACAATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105974719_1105974724 30 Left 1105974719 13:25463510-25463532 CCATGGAATTTGTTTATGCAATG 0: 1
1: 1
2: 1
3: 23
4: 244
Right 1105974724 13:25463563-25463585 CCTGCTCCCCTGACAATGTAAGG 0: 1
1: 0
2: 1
3: 22
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105974724 Original CRISPR CCTGCTCCCCTGACAATGTA AGG Intronic
901636312 1:10671881-10671903 CCTGCTCCCGTGAAAAGGCAGGG - Intronic
903058975 1:20656231-20656253 CCTGCTCCTCTGACACTGGCAGG + Intronic
904394924 1:30213698-30213720 CCAGCTCCCATGACACTCTAGGG - Intergenic
906562850 1:46771934-46771956 CCTGCTTCCATGACGATGGAAGG + Intronic
907420475 1:54343520-54343542 CCTGCTCCCCTGCCACTGGGTGG - Intronic
908514149 1:64875190-64875212 CCACCTCCCCTGGCAATGGAGGG - Intronic
908702096 1:66913020-66913042 CCTGCTTCCGTGACGATGGAAGG + Intronic
911159322 1:94668771-94668793 CCTGTTTCCATGACAATGGATGG - Intergenic
912979897 1:114361906-114361928 CCTGTTTCCATGACAATGGAAGG + Intergenic
913149127 1:116022865-116022887 CCTGCACCCAGGACAAAGTAAGG + Intronic
914199261 1:145470307-145470329 CGTGCTCCCCCAAAAATGTATGG + Intergenic
914478375 1:148043443-148043465 CGTGCTCCCCCAAAAATGTATGG + Intergenic
914502480 1:148259366-148259388 CATGCTCCCCTGAAAATGTTTGG - Intergenic
916366794 1:164038039-164038061 CCTGCTCCCATCACAATGCTTGG + Intergenic
919594968 1:199549787-199549809 CATGTTCCCCTGAGAATTTAAGG - Intergenic
921253026 1:213314915-213314937 CCTCCTCTCCTGACCCTGTATGG + Intergenic
923321980 1:232843435-232843457 CCTCCTCCCTTCACAATGCACGG - Intergenic
1063316909 10:5015615-5015637 CTGGGTCCCCAGACAATGTAAGG + Intronic
1063394848 10:5677292-5677314 ACTGCTCCCCTAAATATGTACGG - Intergenic
1071422095 10:85510941-85510963 CCTGCTCCCTTCATAATGGAAGG - Intergenic
1075922963 10:126228123-126228145 CCTGCACCCCTAACAATGCTTGG + Intronic
1075934076 10:126324675-126324697 CCTTCTCCCCTGAAATAGTAAGG - Intronic
1077195748 11:1279163-1279185 CCTGCTCTGCTGACAATGAGGGG + Intronic
1077534135 11:3111277-3111299 CCTGCTTCCATGACGATGGAAGG + Intronic
1078442997 11:11383049-11383071 CCTGATCTCCTGACATTGGAGGG + Intronic
1081911366 11:46701700-46701722 CCTCCGCCCTTGAAAATGTAGGG + Intronic
1082689752 11:56285600-56285622 CCTGTTCCCCAAAAAATGTATGG + Intergenic
1083055571 11:59815999-59816021 CCTGCTTCCATAACAATGGAAGG - Intergenic
1084213706 11:67635479-67635501 CTTGCTCCCCAGAGAATGTTTGG + Intronic
1084443168 11:69187524-69187546 CCTGCTCTTCTTACAAAGTAAGG + Intergenic
1085573145 11:77577111-77577133 CCTGCTTCCATGACAATGGAAGG + Intronic
1085717935 11:78889617-78889639 TCTGCACCCCTGACACTGCAAGG - Intronic
1087625634 11:100592870-100592892 GCAGCTTCCCTGACAATGTTAGG + Intergenic
1089819043 11:121205243-121205265 CCTGATCCTTTGAAAATGTATGG - Intergenic
1091298372 11:134489270-134489292 GCTCCTCCCCTGACAACCTAAGG + Intergenic
1091669470 12:2442534-2442556 CCTGCTCCTCTGACAGTGGGTGG - Intronic
1092008189 12:5087271-5087293 CCGGCTTCCCTGTCAATGTCTGG + Intergenic
1093708601 12:22303370-22303392 CCTGCTTCCTTGGCAATGGAAGG + Intronic
1096413906 12:51396336-51396358 CAGGCTCCCCTGACAAACTATGG - Intronic
1101874819 12:108591268-108591290 ACAGCTCCCCTGACAAAGTGAGG - Exonic
1103713953 12:122932314-122932336 CCTTCTCCCCTGTCTCTGTATGG + Exonic
1104030661 12:125063898-125063920 CCTGCTTCCATGACAATGGAAGG - Intergenic
1105974724 13:25463563-25463585 CCTGCTCCCCTGACAATGTAAGG + Intronic
1108509329 13:51140711-51140733 CCTGCTTCCATGACGATGGAAGG + Intergenic
1109078082 13:57864165-57864187 CCAGCCCCCATGACAATGTCTGG + Intergenic
1112447331 13:99476166-99476188 CCTGCTTCCATGACAACGGAAGG + Intergenic
1122739938 14:103866409-103866431 CCTTCTCCCCTGACGATGACGGG + Intergenic
1124336929 15:28864348-28864370 CCAACTCCCATGACAAGGTATGG - Intergenic
1128289919 15:66470482-66470504 CCTGCTTCCGTGACAATGGAAGG - Intronic
1131000786 15:88938280-88938302 CCTGCTTCCATGATAATGGAAGG + Intergenic
1132290789 15:100702113-100702135 ACTGTTACCCTGGCAATGTATGG + Intergenic
1135229170 16:20689170-20689192 CCTACTCCCATGACATTATAAGG - Intronic
1137465600 16:48706054-48706076 CCTGGTCCCCTGATAGTGCAGGG + Intergenic
1137960717 16:52879395-52879417 CATGGTCCCCTTACAAAGTAGGG - Intergenic
1140419687 16:74807995-74808017 CCTGTTTCCATGACAATGGACGG + Intergenic
1141962827 16:87421016-87421038 CCTGCTCCCATGACAAGCCAGGG + Intronic
1154491553 18:14925862-14925884 CCTGCTCCCCTTACAGGGTCAGG - Intergenic
1156229252 18:35138046-35138068 CCTGCTCCCCTGAGCATGTATGG + Intronic
1157912485 18:51630272-51630294 CCTGCTTCTATGACAATGAAAGG + Intergenic
1159821163 18:73146356-73146378 ACTGCCCCCCTAAAAATGTAAGG + Intergenic
1163916313 19:20243722-20243744 ACTAATCCCCTGACACTGTAAGG + Intergenic
925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG + Intergenic
925530213 2:4850957-4850979 CCTGCAGCCCTGACGATGCACGG + Intergenic
926454363 2:13046064-13046086 CCTTCTATCCTGACATTGTAAGG + Intergenic
929534806 2:42774531-42774553 CCTGCTTCCATGACAATGGAAGG + Intronic
931187658 2:59969131-59969153 CCAGCTCCCCACACAATGTTGGG - Intergenic
933178322 2:79201494-79201516 CCTGCTTCCACGACAATGGAAGG - Intronic
933718757 2:85383014-85383036 CCTGTTTCCATGACAATGGAAGG - Intronic
935234079 2:101123547-101123569 CCTGCCCCCGTGACAATCTGTGG + Intronic
936477224 2:112849820-112849842 CCTGCTTCCCTGATGATGGAAGG + Intergenic
938641172 2:133281983-133282005 CCTGCTCCTCTGAGGATGGATGG - Intronic
938779311 2:134570757-134570779 CTTCCTCCCCTGATACTGTAAGG + Intronic
940988278 2:160071855-160071877 TCTGCTTCCATGACAATGGAAGG - Intergenic
945868864 2:215205367-215205389 CCTGCTTCCCTGATGATGGAAGG + Intergenic
947736814 2:232459444-232459466 CCTGCACCCCAGACAATAAAGGG + Exonic
948654176 2:239466461-239466483 GCTGCTCCCCTGATAATGAGGGG - Intergenic
949029597 2:241786554-241786576 CCTGCTTCCATGACGATGGAAGG - Intronic
1175693619 20:61084603-61084625 CCTGCACCCCTGTCAGTGTGAGG + Intergenic
1176200369 20:63857723-63857745 CTCCCTCCCCTGACAATGCAGGG + Intergenic
1180256591 21:46634146-46634168 CCTGCTTCCATGACAATGGAAGG - Intergenic
1185363634 22:50424174-50424196 GCTGCTCCCCTGAGAACGAAGGG + Intronic
954114352 3:48457098-48457120 ACTGCTCCTCTGACAAAGAATGG + Intronic
954650168 3:52156391-52156413 CCTGCTTCCCTGACGATGGAAGG + Intergenic
956179458 3:66503570-66503592 TCTGCTCCCCATACCATGTATGG + Intergenic
957459478 3:80497825-80497847 CCTGGGCCCCTGACAGTGAAGGG + Intergenic
959110319 3:102115201-102115223 CCAGATCCCCTGGCAATGTGTGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962431415 3:135323949-135323971 CCTGCTCCCATGACCCGGTATGG + Intergenic
963896378 3:150689245-150689267 CCTGCTTCCATGACAATAGAAGG + Intronic
967822569 3:193851890-193851912 CCTGCTCAAATGACATTGTATGG + Intergenic
969269923 4:6092465-6092487 CCTGCTCCTCTGGGAATGCACGG + Intronic
972853764 4:43081636-43081658 CCTGCTTCCATGACAATGGAAGG - Intergenic
974686914 4:65242520-65242542 CCTGGGCCCCTGACAATACAGGG + Intergenic
974948101 4:68552892-68552914 CCTGTTTCCATGACAATGGAAGG + Intronic
974957168 4:68656157-68656179 CCTGTTTCCATGACAATGGAAGG + Intronic
976021803 4:80638573-80638595 CATGCTTCCCTGAGAATATAAGG + Intronic
976941497 4:90707017-90707039 CCTGCTCCCCTCATAATTTTTGG + Intronic
977345383 4:95810691-95810713 CCCCCTCCCCTGAAAATGTATGG - Intergenic
977354255 4:95925639-95925661 CCTGCTTCCATGACAATGGAAGG + Intergenic
980270201 4:130574448-130574470 CCTGTTTCCATGACAATGAAAGG - Intergenic
980985768 4:139692681-139692703 CCTGCTGCCCTCACAAGCTAGGG - Intronic
981292435 4:143091325-143091347 CCTGCTTCCATGACAATGGAAGG + Intergenic
982197041 4:152927090-152927112 CCTACTTCCATGACAATGGAAGG - Intergenic
984031246 4:174606549-174606571 CCTGCTTCCATGACAATGGAAGG + Intergenic
985763413 5:1763593-1763615 CCTGCTCCAGTGAAAATGGACGG + Intergenic
998507522 5:142683981-142684003 GCTGCTCCACTGACAGAGTAGGG - Intronic
1001905421 5:175468360-175468382 CCTGCTTCCCTGACAGAGCATGG - Intergenic
1002703475 5:181143731-181143753 CCTGCTTCCCTGAAGATGGAAGG + Intergenic
1004035474 6:11918948-11918970 CCTGCTCCTTTGAAAATGTGAGG + Intergenic
1006485088 6:34333110-34333132 CCTGTTCCCCTAACCCTGTAAGG + Intronic
1008930467 6:56933496-56933518 CCTGCTCACCTGGCACGGTAAGG - Intronic
1010630630 6:78193136-78193158 CCTCCTGCTCTGACCATGTAAGG - Intergenic
1014947776 6:127516934-127516956 CCTGCTACCATGAGAATGTAAGG - Intronic
1017090217 6:150752720-150752742 CCTCCTCCCCTTACAGAGTAAGG - Intronic
1021550045 7:21861373-21861395 CCTACTCCCCCAAAAATGTATGG + Intronic
1022677750 7:32515516-32515538 CCTGCTTCCATGACAATAGAAGG + Intronic
1026110790 7:67457509-67457531 CCTACTGTCCTGACATTGTAGGG - Intergenic
1026468092 7:70671716-70671738 CCTGCCTCACTGACACTGTACGG - Intronic
1026505226 7:70976816-70976838 CCTGGTCACCTGACCATGCAAGG - Intergenic
1028880880 7:95878188-95878210 CCTGCTTCCCTGCCTGTGTAGGG - Intronic
1039792706 8:40888293-40888315 CCTGCTGCCCTTACAAACTAAGG + Intronic
1040603426 8:48906913-48906935 CCTGCTTGCCTGAGAATGCAAGG - Intergenic
1041510722 8:58652382-58652404 CCTGGTCCCCTGACCATGCCAGG + Intronic
1043247961 8:78029873-78029895 GCTACTCCACCGACAATGTAGGG + Intergenic
1044677882 8:94748091-94748113 TCTCTTCCCCTGACAATGTGTGG - Intronic
1045338598 8:101231841-101231863 CCTGCTCCTCTGCCACTGTCAGG - Intergenic
1046427451 8:114073529-114073551 CCTGCTCCTTTCACAATGTTAGG - Intergenic
1046606329 8:116375445-116375467 CCTTCTCCCCTGACATTGTGAGG - Intergenic
1048694120 8:137005013-137005035 CCTCCAACCCTGACAATCTAGGG + Intergenic
1049456140 8:142690530-142690552 CCTGCTTCCGTGATAATGGAAGG - Intergenic
1049745118 8:144260041-144260063 CCGGCTGCCCTGACAAGGTGGGG + Exonic
1057327557 9:94079812-94079834 CCTGCTCACCTTGCAAAGTAGGG - Intronic
1057575677 9:96240518-96240540 CCTCCTCCCCTCAGAAAGTAAGG - Intronic
1057790534 9:98121864-98121886 TCTGCTGCCCTGACAATGCCTGG + Exonic
1061047679 9:128175947-128175969 CAGGCTCCCATGACAATGAAAGG + Intronic
1185684194 X:1914630-1914652 CCTCCTCCTCTGACAATGCTGGG - Intergenic
1187139298 X:16577147-16577169 CCTGTTTCCATGACAATGGAAGG + Intergenic
1187260983 X:17685022-17685044 GCTGCTCCACTGCCATTGTAAGG - Intronic
1187616195 X:20995896-20995918 CCTGCTTCCATGACAATGGAAGG + Intergenic
1187925467 X:24245730-24245752 CCTACTTCCCAGACAATGCAAGG + Intergenic
1188302632 X:28524468-28524490 GCTGATCCTCTGACAATGTCAGG - Intergenic
1188904886 X:35780020-35780042 CCTGCTTGCATGACAATGGAAGG - Intergenic
1189140437 X:38599684-38599706 CCTGCTGCCAAGAAAATGTAGGG - Intronic
1191740060 X:64426813-64426835 CCTGCTTCCATGACAATGGAAGG + Intergenic
1192261232 X:69506751-69506773 TCTTCTCCCCTGACAAAGGAAGG + Intronic
1193555111 X:82944639-82944661 CCTGCTCCCCTGAGATCGTGGGG - Intergenic
1193642049 X:84021366-84021388 CCTGCTTCCATGATAATGGAAGG - Intergenic
1193974356 X:88099219-88099241 CCTGCTTCCATGACAATGGAAGG - Intergenic
1194211554 X:91076217-91076239 ACTGCTTCCCAGACAATGTAAGG - Intergenic
1194234230 X:91362259-91362281 CCTGCTTCCATGACAATGGAAGG - Intergenic
1194534006 X:95084118-95084140 TCTGCTTCCATGACAATGGAAGG - Intergenic
1195734733 X:108000766-108000788 CCTGCTCCCCTGAGATTGTGGGG + Intergenic
1196382727 X:115109726-115109748 CCTGCTTCCATGACAATGGAAGG - Intergenic
1196884416 X:120229169-120229191 CCTGCTTCCATGACGATGGAAGG + Intergenic
1197042622 X:121957849-121957871 CCTGCTTCCATGACAATAGAAGG + Intergenic
1198854014 X:140996554-140996576 CCTGCTTCCATCACAATGGAAGG + Intergenic
1198877999 X:141248552-141248574 CCTGCTTCCATGTCAATGGAAGG - Intergenic
1199251304 X:145665229-145665251 CCTGCTTCCATGACGATGGAAGG + Intergenic
1200285793 X:154821087-154821109 CCTGCTTCCATGACAATGAAAGG - Intergenic
1200769867 Y:7113675-7113697 ACTTTTCCCCTGAAAATGTAGGG + Intergenic