ID: 1105975377

View in Genome Browser
Species Human (GRCh38)
Location 13:25468500-25468522
Sequence CTGTTCCTAAGGAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105975370_1105975377 30 Left 1105975370 13:25468447-25468469 CCATCTCCTTCTGCGGTGGCTGC 0: 1
1: 0
2: 0
3: 25
4: 329
Right 1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG 0: 1
1: 0
2: 3
3: 22
4: 156
1105975371_1105975377 24 Left 1105975371 13:25468453-25468475 CCTTCTGCGGTGGCTGCTTGCAG 0: 1
1: 0
2: 1
3: 11
4: 176
Right 1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG 0: 1
1: 0
2: 3
3: 22
4: 156
1105975375_1105975377 -8 Left 1105975375 13:25468485-25468507 CCATTGCTGCTGTCTCTGTTCCT 0: 1
1: 1
2: 6
3: 59
4: 613
Right 1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG 0: 1
1: 0
2: 3
3: 22
4: 156
1105975374_1105975377 -7 Left 1105975374 13:25468484-25468506 CCCATTGCTGCTGTCTCTGTTCC 0: 1
1: 0
2: 1
3: 29
4: 313
Right 1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG 0: 1
1: 0
2: 3
3: 22
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105975377 Original CRISPR CTGTTCCTAAGGAAGATCAA AGG Intronic
900313588 1:2046508-2046530 CTCTTCCTAAGGAAAATCACAGG + Intergenic
903663771 1:24994708-24994730 CTGGTCTTAAGGAAGCACAATGG + Intergenic
905785598 1:40754563-40754585 TTGTTCTGAAGGAAGATAAATGG - Intronic
906186446 1:43865699-43865721 TTTTTCCTAAGGTAGATCACTGG + Intronic
907950405 1:59178077-59178099 ATGTTCTTAAGGGAGAACAATGG - Intergenic
908784068 1:67717761-67717783 CTGTACCAAAGGAATATCACTGG - Intronic
909110184 1:71465800-71465822 CTGTACTTTAGGAAGATGAATGG + Intronic
909275360 1:73678206-73678228 TTGTTCCTAAGGAACATCATAGG + Intergenic
911263554 1:95716454-95716476 CATTTCCTAAGGCAGTTCAATGG - Intergenic
912091630 1:106083298-106083320 CTGTTCCTAAGGGAAATGCAGGG + Intergenic
912450935 1:109767310-109767332 CTGTTCATAAATAAGTTCAAGGG - Intronic
915932232 1:160067936-160067958 CTGGTCCCAAGGAAGGTCAAGGG + Intronic
917005932 1:170417394-170417416 CTGTTCCTAGAACAGATCAATGG - Intergenic
918241446 1:182623697-182623719 CTGTACCTAAGGGAGCACAATGG - Intergenic
920291097 1:204923656-204923678 CAGTTCCTAATGAAGCTCCATGG - Intronic
1064865156 10:19871176-19871198 CTGTTCTTTAGGAAGAAAAATGG - Intronic
1065952123 10:30661712-30661734 CTGTTTCTCAGAAAGCTCAATGG - Intergenic
1066668545 10:37812345-37812367 TTGTTACTAAGGAAGAGAAATGG + Intronic
1066975633 10:42365748-42365770 CTGTGCCTAGGGAAGATAAAAGG + Intergenic
1068942325 10:62692002-62692024 CTGCTCCTGAGGAACATCACTGG - Intergenic
1069003830 10:63295770-63295792 CTGTTCTTAAGGAAAATACAAGG + Intronic
1069650687 10:70045447-70045469 TTGTTCCAAAGGCAGATAAATGG + Intergenic
1072217501 10:93299946-93299968 GGGGTCCTGAGGAAGATCAAAGG - Intergenic
1075391970 10:122098729-122098751 CTATTCTTAAGGTAGATTAATGG + Intronic
1075590439 10:123687312-123687334 GTGTTCCTAAGGAAGTTGCATGG - Intronic
1080143462 11:28950765-28950787 CTGTTTCCAAGGAAGAAGAATGG + Intergenic
1088081907 11:105927623-105927645 TTGTTCCGATGGAAGGTCAAAGG - Intronic
1088505624 11:110524163-110524185 TTGTTCCTAAGGGAGATACAGGG + Intergenic
1091268381 11:134288355-134288377 TTGTTGCAAAGGAAGGTCAAAGG + Intronic
1091578066 12:1757863-1757885 CTGTTCCTTAGGAATATGATGGG + Intronic
1092107687 12:5934288-5934310 CTGTGCAAAAGGAAGATAAATGG + Intronic
1094064538 12:26349360-26349382 CAGTTCACAAGGAAGATCCAGGG - Intronic
1094352216 12:29539840-29539862 CTGCTCCTAAGCAAAAACAAGGG + Intronic
1098369546 12:69742010-69742032 CTGTTCTTAAGGAATATGGAAGG + Intronic
1098810251 12:75079250-75079272 GTGTTCTTATGAAAGATCAAAGG - Intronic
1098833338 12:75390570-75390592 CTGTCCCTGAGGAAAATAAAAGG + Intronic
1099346111 12:81501855-81501877 TTGTTGCTAAGAAAGATCAAAGG + Intronic
1100167713 12:91937090-91937112 CTATTCCTAAGGGAGATCTTTGG + Intergenic
1101545712 12:105710531-105710553 ATGTTCTGAAGGAAGATCCATGG - Intergenic
1101718726 12:107333039-107333061 CGGTTGTTAAGGAAGAACAAGGG + Intronic
1102292025 12:111708672-111708694 CTGTTCTTAGGGCAGATCAGAGG + Intronic
1102491698 12:113293252-113293274 ATGTTGCTAAGGAAGAGCAGAGG - Exonic
1103411906 12:120718223-120718245 CAGTGCCTAAGGGAGATAAAAGG + Intronic
1105266469 13:18822239-18822261 CTGTTCCTAGGGAAGCTGAGGGG + Intergenic
1105458349 13:20561492-20561514 CTGTACCTGATGAAGATCAGTGG + Intergenic
1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG + Intronic
1107211135 13:37855596-37855618 CTGTTCCTGAGAATGATCCATGG - Intronic
1107297492 13:38926174-38926196 CTGTTCCCAAGGAAACTGAAAGG + Intergenic
1108580267 13:51822285-51822307 CTGATCCTCAGGAAGCTCAGTGG + Intergenic
1109030567 13:57183271-57183293 CAGTTCTTAAGGAAAATTAAGGG - Intergenic
1109421940 13:62124876-62124898 ATTTTCCAAAGGAAGAACAAAGG - Intergenic
1113150962 13:107263133-107263155 CTGTTCCTGACCAAGATCATTGG + Intronic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1114997442 14:28373880-28373902 CTGTTTCTAAGAAATAGCAAAGG + Intergenic
1115668417 14:35580415-35580437 CTCTTCCTGAGGAAGATTGATGG - Intronic
1115787357 14:36841513-36841535 ATGTTTGAAAGGAAGATCAATGG - Intronic
1116797305 14:49405656-49405678 CTGTTCTTATGAAAGATCACTGG + Intergenic
1117215934 14:53551782-53551804 CTATTCATAAGTAAGATCAATGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117964547 14:61193204-61193226 CTTTCCCAAAGGAAGATAAATGG + Intronic
1118825500 14:69376695-69376717 CTGTTCCTGAGGAAACACAATGG + Intergenic
1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG + Exonic
1202832059 14_GL000009v2_random:45843-45865 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
1128342632 15:66833423-66833445 CTGTCCTTAAGGAGGATCTAAGG - Intergenic
1128411863 15:67407477-67407499 CTGTGCCTGAGGAAGATGACAGG + Intronic
1130438957 15:83931651-83931673 CTGTTCCAAATACAGATCAATGG + Intronic
1131641381 15:94297826-94297848 CTGTTCTTCAGTATGATCAAGGG - Intronic
1131680486 15:94716871-94716893 CTTTTGCTAAGTAAGGTCAAGGG - Intergenic
1134228055 16:12407249-12407271 TTTTTCCTAAGAAAGATCAGAGG - Intronic
1137444543 16:48523770-48523792 ATGCTCCTAAGGAAGGTCACAGG - Intergenic
1140698019 16:77554282-77554304 CTGTTCTTAAGGAAGATGAATGG - Intergenic
1143271389 17:5678114-5678136 CTGTTCCTAAAGAACTTTAAGGG + Intergenic
1150281200 17:63930626-63930648 CTCTTCCAAAGGAAAATCGAAGG - Intronic
1154421943 18:14239241-14239263 CTGTTCCTAGGGAAGCTGAGGGG - Intergenic
1159002408 18:62986157-62986179 CTGTTCATAAGGAAGAAGTATGG - Intergenic
1162284473 19:9727916-9727938 CAGTTCCTCAGGAAGAATAATGG - Intergenic
1162668534 19:12235922-12235944 CTGTGCCTAGGGAAGATAAAAGG + Intronic
1162700683 19:12512659-12512681 CTGTGCCTAGGGAAGATGAAAGG + Intronic
1163893578 19:20038160-20038182 CTGTGCCTAGGAAAGATTAAAGG + Intronic
1163983649 19:20924829-20924851 CTGTGCCTAGGGAAGATAAAAGG - Intronic
1164042699 19:21507503-21507525 CTATGCCTAGGGAAGATAAAAGG - Intronic
1164054851 19:21614066-21614088 GTGTGCCTAGGGAAGATAAAAGG + Intergenic
1164055394 19:21617887-21617909 TTGTGCCTAGGGAAGATAAAAGG - Intergenic
1202640625 1_KI270706v1_random:81908-81930 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
925700324 2:6630274-6630296 CTTTTCCTGAAGAAGGTCAATGG + Intergenic
926345417 2:11940539-11940561 CTGATACTAAGGAAGATGTAGGG + Intergenic
928169805 2:28995995-28996017 CTGTTCCTAGGGAAGCTGCAGGG + Intronic
930228905 2:48823862-48823884 TTTTCCCTAAAGAAGATCAATGG + Intergenic
934496189 2:94801893-94801915 CTGTTCCTAGGGAAGCTGAGGGG + Intergenic
934894415 2:98101594-98101616 CTGGTACTAAGGAAGATCTAGGG + Intronic
935647085 2:105346904-105346926 GTGTTTCTAAGCAAGAGCAAAGG + Exonic
937793695 2:125991389-125991411 CTGTTCCTGCGGAAATTCAAAGG - Intergenic
941439380 2:165514408-165514430 ATGTACCTCAGGAAGATTAAGGG - Intronic
943439497 2:187909456-187909478 CATTTCCTAAGGTAGTTCAAAGG - Intergenic
943536860 2:189162931-189162953 CTGTGCTCAAGGAATATCAATGG + Intronic
944107686 2:196097079-196097101 CTGTCCCTCAGGAAAATCCAAGG - Intergenic
946611951 2:221468211-221468233 CACTTCCTAGGGAAGATCAGAGG + Intronic
1171887510 20:30668654-30668676 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
1173164555 20:40677742-40677764 ATGTTCCTAAGAACGATAAATGG - Intergenic
1175030611 20:55950171-55950193 TTGTTCCTAAGGAAGCTCGTGGG - Intergenic
1176851540 21:13920719-13920741 CTGTTCCTAGGGAAGCTGAGGGG + Intergenic
1176918856 21:14661976-14661998 GTGTTGCTAATTAAGATCAAGGG - Intergenic
1176980449 21:15375619-15375641 CTGTTCCTAATTAGGATCATGGG - Intergenic
1183640514 22:39089850-39089872 CTGTTCCTGGGTAAGACCAAGGG + Intergenic
949179393 3:1110078-1110100 CTGTTCCTAAAGAAGGACATTGG - Intronic
950956752 3:17062030-17062052 CTGTTCCTAGGGAAAAGCAGTGG - Intronic
953240951 3:41149009-41149031 CTTTTCCTAAGGAACAATAAAGG - Intergenic
953290155 3:41652276-41652298 TTATTCATAAGGAAGATCAAAGG - Intronic
955119788 3:56046383-56046405 CTGTTCTTAAGGAAGGTGCAAGG - Intronic
955519587 3:59762025-59762047 CTGTTATTAAGGAAAATGAAGGG + Intronic
959746618 3:109782612-109782634 ATGTTCCAAAGGAAAGTCAAAGG - Intergenic
961656364 3:128444422-128444444 CTGTTTCTAAGGAAGAAAAGGGG + Intergenic
962238488 3:133729916-133729938 TTGATCTTAAGGAAGATCAGTGG - Intergenic
965136452 3:164777499-164777521 TTGTTCCTAAGGGAGATATAGGG + Intergenic
965295450 3:166939757-166939779 GTGTTCCTGATGAAGATCACTGG - Intergenic
966939776 3:184738473-184738495 CTGTTCCTGAGGGAAATGAAAGG - Intergenic
1202737929 3_GL000221v1_random:25478-25500 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
971069051 4:23069942-23069964 CTGGTCCTAAGGTAGAGGAAGGG - Intergenic
973384139 4:49492442-49492464 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
976052095 4:81021513-81021535 CAGATCCTAAGCAAGACCAAGGG - Intergenic
976242031 4:82967825-82967847 CTGATCAGAAGGAAGATTAAAGG - Intronic
977868550 4:102060978-102061000 CTCTCACTAAGGAATATCAAGGG - Intronic
980094070 4:128471796-128471818 CTGTCCTTAAGGAAGACCCAGGG - Intergenic
982388290 4:154836703-154836725 CTGTTACTAAGGAACCTCACTGG + Intergenic
984081625 4:175254702-175254724 CAGTACTTAAGGCAGATCAAGGG + Intergenic
985207821 4:187559376-187559398 CTGATCATATGTAAGATCAAAGG + Intergenic
985372936 4:189306308-189306330 CTGTTCATTACGAAGATCATTGG + Intergenic
1202767994 4_GL000008v2_random:167767-167789 CTGTTCCTAGGGAAGCTGAAGGG + Intergenic
987243379 5:16024035-16024057 CTTTCCCTAAGGAGTATCAAGGG - Intergenic
988332804 5:29864586-29864608 CTGTTCCTCAGAATAATCAAAGG + Intergenic
989181081 5:38577724-38577746 CTGTTACCAATGAAGATCAAGGG - Intronic
992686258 5:79202339-79202361 CTGTTTTGAAGGAAGAACAATGG - Intronic
997082828 5:130760895-130760917 CTGGTCCCAAGGAAGAATAAGGG + Intergenic
998881585 5:146650757-146650779 CTTTTCCTATGGAAGATCTTTGG - Intronic
999774499 5:154801439-154801461 CTGTTACTTAGGGAGCTCAATGG - Intronic
1000253621 5:159517921-159517943 CTGTATCAAAGGAATATCAAAGG - Intergenic
1002278818 5:178119309-178119331 CTGAGTCTAAGGAAGAGCAATGG - Intronic
1004617116 6:17301129-17301151 CTCTACTTAAGGAAGAGCAATGG - Intergenic
1006683222 6:35812161-35812183 CTTCTCCTAAAAAAGATCAAAGG + Intronic
1011469888 6:87697819-87697841 CAATTCCTAAGGCAGATTAATGG + Intronic
1011760189 6:90555711-90555733 CTGCTCCTAAGGAAAATACAGGG + Intronic
1011855492 6:91684360-91684382 CTTTTCCAAAGGAAAAACAATGG - Intergenic
1012542134 6:100373333-100373355 GTGTTGATAAGGAAGACCAATGG - Intergenic
1012988572 6:105900752-105900774 TTGTTCCTAAGCTAGCTCAAGGG + Intergenic
1014847983 6:126303407-126303429 AAGATGCTAAGGAAGATCAATGG - Intergenic
1023654662 7:42407349-42407371 CTTTTACCAAGGAAGAACAAAGG - Intergenic
1024483516 7:49890106-49890128 CTGTTCCTAAAGGAGATGTATGG - Intronic
1024828108 7:53416285-53416307 CTGTTCCTAAGGAAGAGCTGAGG - Intergenic
1025238659 7:57253075-57253097 CTGTACCTAGGGAAGATCAAAGG + Intergenic
1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG + Intronic
1025788670 7:64667449-64667471 CTGCGCCTAGGGAAGATAAAAGG - Intronic
1029738700 7:102479242-102479264 CGTTTCCAAAGAAAGATCAAGGG - Intergenic
1030135948 7:106248122-106248144 CTTTTACTAAGGAAGAACACTGG - Intergenic
1030917944 7:115340175-115340197 CAGTTCTGAAGGACGATCAAGGG + Intergenic
1030973077 7:116086106-116086128 CTTTTCCTAATGAAAATTAAAGG + Intronic
1031472985 7:122189967-122189989 TTGTTTGTAAGGAAGATAAAGGG + Intergenic
1033637127 7:143222463-143222485 CTCTTCATCAGGAAGAACAAAGG - Exonic
1034380365 7:150687041-150687063 CTGTTTCTCAGGAACACCAATGG + Exonic
1037278378 8:17206428-17206450 CTGCTCCTAGGGAAGATACAGGG - Intronic
1037354975 8:18008716-18008738 CTGTACCTAAGTCAGATCAGGGG - Intronic
1039110430 8:34035658-34035680 CTGGTCCAAAGGCAGTTCAAAGG - Intergenic
1045710796 8:104981520-104981542 CTGGTCCTAAGGAAGACCAAGGG + Intronic
1048316403 8:133366151-133366173 CCATTCCTCAGGAAGAACAATGG - Intergenic
1049334011 8:142072574-142072596 TTATTCCTAAGGAAGAACCAGGG - Intergenic
1050073411 9:1839850-1839872 CTTTTCATAGGGAAGATGAAGGG - Intergenic
1051333764 9:16048176-16048198 TTGCTCCAAAGGAAGCTCAAGGG - Intronic
1053094184 9:35309962-35309984 CTGTACCTTAGGATGAGCAAAGG - Intronic
1054361950 9:64131452-64131474 CTATTCCTAGGGAAGCTGAAGGG - Intergenic
1060132682 9:121119792-121119814 CTGCTCTTAAGAAAGATGAAGGG - Intronic
1060911135 9:127352041-127352063 CTGTTCCTATGTAAAATGAAGGG + Intronic
1203692403 Un_GL000214v1:56673-56695 CTCTTCCTAGGGAAGCTGAAGGG + Intergenic
1203706655 Un_KI270742v1:55922-55944 CTGTTCCTAGGGAAGCTGAAGGG - Intergenic
1203556589 Un_KI270744v1:3565-3587 CTCTTCCTAGGGAAGCTGAAGGG + Intergenic
1203643892 Un_KI270751v1:47518-47540 CTCTTCCTAGGGAAGCTGAAGGG - Intergenic
1186491868 X:9980048-9980070 CGCTTCTTAAGGAAGAGCAAGGG - Intergenic
1188471652 X:30547272-30547294 CTATACCTGAAGAAGATCAAAGG + Intergenic
1189339059 X:40190719-40190741 CTTTTCTTCTGGAAGATCAATGG + Intergenic
1193820126 X:86150638-86150660 CTTTTCTTAAGGAAGATAGATGG + Intronic
1195274564 X:103268940-103268962 ATGTTCCCAGGGAAGATCAGTGG - Intergenic
1198792307 X:140358663-140358685 ATGTTCATAAGTAACATCAAAGG + Intergenic
1201069178 Y:10128741-10128763 CTCTTCCTTAGGATGGTCAAAGG - Intergenic
1202105765 Y:21363344-21363366 CTGGTCTTACGGAAGATCCAGGG + Intergenic