ID: 1105978265

View in Genome Browser
Species Human (GRCh38)
Location 13:25492833-25492855
Sequence AGGTGGGGCCCAGTTTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105978257_1105978265 3 Left 1105978257 13:25492807-25492829 CCCCTGCTGTTTGGAGTGTCTGA 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 170
1105978258_1105978265 2 Left 1105978258 13:25492808-25492830 CCCTGCTGTTTGGAGTGTCTGAG 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 170
1105978256_1105978265 9 Left 1105978256 13:25492801-25492823 CCGCAGCCCCTGCTGTTTGGAGT 0: 1
1: 0
2: 1
3: 30
4: 302
Right 1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 170
1105978259_1105978265 1 Left 1105978259 13:25492809-25492831 CCTGCTGTTTGGAGTGTCTGAGG 0: 1
1: 0
2: 1
3: 26
4: 332
Right 1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105978265 Original CRISPR AGGTGGGGCCCAGTTTCCTT TGG Intronic
900407846 1:2500258-2500280 AGCTGGGGCCCAGTGCCCTCTGG + Intronic
903219347 1:21860215-21860237 AGGTGTGGCCCAGGTTACGTGGG - Exonic
903732064 1:25503899-25503921 AGGTGGGGCCCAGCCTCACTTGG - Intergenic
905914711 1:41676687-41676709 AGTTGGGGGGCAGTTTCCTGAGG - Intronic
906037289 1:42759326-42759348 AGGTGGGGCACAGCTTCCTGTGG + Exonic
906632975 1:47387894-47387916 AGGAGGTGCCCAGTTTGCATTGG + Intergenic
908830411 1:68173027-68173049 CAGTGGGCCTCAGTTTCCTTAGG - Intronic
909434747 1:75627951-75627973 TGCTGGGCCTCAGTTTCCTTAGG - Intergenic
911392089 1:97258249-97258271 AAGTGGGGCTCTGTTTTCTTGGG - Intronic
922886588 1:229025183-229025205 TGGTGGGGCCCAGTGTCCTCGGG - Intergenic
1062803706 10:398912-398934 AGGTGGAGCACAGCTTGCTTTGG - Intronic
1064977319 10:21131820-21131842 AGCTGGGTCCCAGTGCCCTTGGG + Intronic
1065233435 10:23622151-23622173 AGGTTGGTCCCAGATTCCTGGGG + Intergenic
1067066315 10:43106018-43106040 CTGTGGGGCCCAGCTTCCTCAGG + Intronic
1067946862 10:50695197-50695219 AGATGGGGCACAGTCTCCTGAGG - Intergenic
1068228831 10:54143167-54143189 AGGTGGTGCTAAGTTTCCTTTGG + Intronic
1069899970 10:71701619-71701641 AGGTGGGACCCAGTTAGCTGGGG - Intronic
1070882172 10:79860190-79860212 AGATGGGGCACAGTCTCCTGAGG - Intergenic
1071572705 10:86706714-86706736 ACCTGTGGCCCAGTTACCTTGGG - Intronic
1071648741 10:87376501-87376523 AGATGGGGCACAGTCTCCTGAGG - Intergenic
1072238777 10:93475947-93475969 AGGGTGGGGCCACTTTCCTTAGG + Intronic
1073910255 10:108333853-108333875 AGGTTGAGCACAGTGTCCTTGGG + Intergenic
1074958116 10:118412311-118412333 AGGTGGGGGCGGGTGTCCTTTGG + Intergenic
1075099933 10:119499079-119499101 AGGTCAGGCTCAGTTCCCTTTGG - Intergenic
1077141469 11:1026733-1026755 AGCTGGTGCCCACTGTCCTTAGG + Intronic
1078403704 11:11049138-11049160 AGGTGAGGCCTCGGTTCCTTGGG - Intergenic
1078619897 11:12897620-12897642 AGACAGTGCCCAGTTTCCTTTGG + Intronic
1082838801 11:57671340-57671362 AGGTGGGGCTCAGTTACCTTAGG + Intronic
1083583638 11:63840445-63840467 CGGTGGGGCCAAGTGTCTTTGGG - Intronic
1083769319 11:64857569-64857591 AGGTGGGGCCCAGGGTACTTGGG + Intronic
1084154622 11:67306780-67306802 AGGTGGGGAGCAGGGTCCTTGGG + Intronic
1086311664 11:85542256-85542278 AGGTGGTGCCCCATTTCTTTTGG - Intronic
1089377234 11:118003124-118003146 GGGTGGGACCCAGCTTCCTAGGG - Intergenic
1091715707 12:2774780-2774802 AGTTGGGGCCTAGGTTCCTATGG - Intergenic
1092900897 12:13058449-13058471 AGGTGGGGACCTGTCTCCATTGG + Exonic
1095960147 12:47829155-47829177 AGCTGGGGCCCAGTCTGCGTGGG - Intronic
1099898735 12:88681449-88681471 ATGTGGGGACCAGTTTCCCTAGG - Intergenic
1101442198 12:104712215-104712237 ATGTGGGCCTCAGTTTCCTCAGG - Intronic
1102650159 12:114436206-114436228 ATGTGGGGCCAAGATTCCTGCGG - Intergenic
1103446767 12:120999814-120999836 AGGTGGGCCCCATCTTCCTGGGG - Intronic
1104044656 12:125153360-125153382 AGGCTGGGCCCACATTCCTTGGG + Intergenic
1104679482 12:130739643-130739665 AGGGGGTGCCCACTGTCCTTGGG + Intergenic
1105318468 13:19291212-19291234 AGGTGGAGGCCAGTTTACCTAGG - Intergenic
1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG + Intronic
1107703200 13:43070730-43070752 AGCTTGGGCCCAGATCCCTTAGG + Intronic
1107703882 13:43079470-43079492 AGGAGGAGCCCAGTTTAGTTTGG + Intronic
1108136877 13:47373939-47373961 AGGAGGGTCTCATTTTCCTTGGG + Intergenic
1108384661 13:49887929-49887951 AGGTGGTGTTCAGCTTCCTTTGG + Intergenic
1109126580 13:58525945-58525967 AGGTGGTGTTCAGCTTCCTTTGG + Intergenic
1112888315 13:104201179-104201201 AGGTGAGTCCCAGTTCCCATGGG - Intergenic
1113888135 13:113671699-113671721 GGGCGGGGCGCAGCTTCCTTGGG + Intronic
1115303404 14:31910299-31910321 AGGTGGAGCCCAGCCACCTTGGG - Intergenic
1118312292 14:64703190-64703212 AAGCGGGGCCCACATTCCTTAGG - Intergenic
1118822567 14:69354732-69354754 AGGTGGAGCCCAGGCTCCTGTGG + Exonic
1118912747 14:70075476-70075498 AGGTGGTGTCCAGTTTTCTCTGG + Intronic
1121407556 14:93728212-93728234 AGGTCGAGGCCAGTGTCCTTGGG - Intronic
1122146455 14:99691740-99691762 AGGTGGTTGACAGTTTCCTTCGG + Intronic
1122861509 14:104584614-104584636 AGCTGGGGCCCCGTCTCCTGGGG - Intronic
1123065701 14:105618193-105618215 GGGAGGGGCCCAATTTCCCTAGG + Intergenic
1123153442 14:106203760-106203782 AACTGGGGCCCAGATTCCTCAGG - Intergenic
1125040954 15:35186812-35186834 AACTGGGGCCCCTTTTCCTTTGG + Intergenic
1125715337 15:41816818-41816840 ATATGGGGCTCAGTTCCCTTGGG + Intronic
1126208327 15:46071766-46071788 ATTTGGAGCCCAGTTTCATTTGG + Intergenic
1129672675 15:77615966-77615988 AGGAGGGGCCCAGGTGGCTTGGG - Intronic
1129873904 15:78959762-78959784 AGGTGGGCCCAAGTTTGTTTTGG + Intergenic
1131378062 15:91941435-91941457 AGGTGGTGGCCTGGTTCCTTTGG + Intronic
1131422318 15:92317410-92317432 AGGTGGGCCACAGCTTCCATTGG + Intergenic
1132470481 16:100096-100118 ATGTGGGGCTGAGTGTCCTTGGG - Intronic
1133199523 16:4194633-4194655 AGCTGGGGCTCAGTTGTCTTTGG - Intronic
1136418078 16:30115529-30115551 AGGTGGGGCCATGATTGCTTTGG - Intronic
1139853407 16:69963591-69963613 CGGTGGGGCCCAGGGTCCTGAGG + Exonic
1139882376 16:70186500-70186522 CGGTGGGGCCCAGGGTCCTGAGG + Exonic
1140370133 16:74409004-74409026 CGGTGGGGCCCAGGGTCCTGAGG - Exonic
1140644004 16:77010358-77010380 AGGTGGGGGACAGTTTCCTAAGG - Intergenic
1142476850 17:193853-193875 GGGTGGGGCCCAGTATTCTGAGG + Intergenic
1159294890 18:66472317-66472339 TGGTGAGACCCTGTTTCCTTGGG + Intergenic
1160908077 19:1461035-1461057 AGGTGGTGTCCAGCATCCTTCGG + Exonic
1160945891 19:1643971-1643993 AGGCGGGGCCTAGTTGGCTTCGG - Intronic
1161460477 19:4393925-4393947 AGGTGGGGCCCAGGATCCCCCGG + Intronic
1162363295 19:10232144-10232166 AGGTGCTGCCCTGTTTCCCTTGG + Intergenic
1163371291 19:16902717-16902739 AGCTGGGGGCCAGTCTCCTCGGG + Exonic
1167656222 19:50766065-50766087 AGCTGGGGCCCTGTGTGCTTGGG + Intergenic
1168640878 19:58030691-58030713 AGATGGGGCCCAGTTCCATCTGG + Intergenic
925787644 2:7448421-7448443 AGGTGGGACCCAGCATGCTTAGG - Intergenic
926707778 2:15848820-15848842 GGTTGTGGCCCAGTTTCCTGAGG + Intergenic
926782994 2:16492627-16492649 AGCTGGGGGCCATTATCCTTAGG + Intergenic
927143282 2:20144163-20144185 AGTTTGGCCCCAATTTCCTTGGG - Intergenic
931392435 2:61855287-61855309 AGGTGTGGCCAAGTTTCCAGGGG + Intergenic
932437152 2:71708892-71708914 GGGTGGGGCCCTGATTCCATAGG - Intergenic
932760596 2:74436764-74436786 GGGTGGGAGCCAGTTTCCTAGGG - Intronic
935340735 2:102057812-102057834 ACGGAGGGCCCAGTTTCCTAAGG - Intergenic
936923204 2:117710164-117710186 AGGAGGGACCCAGTTTCCCTGGG + Intergenic
937047255 2:118858458-118858480 AGATGGGGGCCAGTTCCCTCAGG + Intergenic
942671166 2:178377642-178377664 TGCAGGGGCCCAATTTCCTTTGG - Intronic
1168936763 20:1672193-1672215 AAATGGGGCCCTGTTTGCTTTGG + Intergenic
1169150002 20:3282053-3282075 GGGTGGGACCTAGTGTCCTTAGG + Intronic
1171396001 20:24833611-24833633 ACGTGTGGCCCAGTTTACTGTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172714070 20:36950423-36950445 AGGTGGGGCCCTGTTTGGCTAGG - Intronic
1173758937 20:45542831-45542853 AGGCAGGGGCCAGTTTCTTTTGG + Exonic
1174506325 20:51020021-51020043 AGCTGGGGCCCAAGTTCCTGGGG + Intronic
1175608075 20:60327845-60327867 AGGGGCTGCCCACTTTCCTTGGG + Intergenic
1176042778 20:63073933-63073955 AGGTGGGGGACAGATTCCTGGGG - Intergenic
1178357930 21:31923850-31923872 AGTGGGGGCCAAGTTTCCCTAGG + Intronic
1180060802 21:45383908-45383930 AGGTGGGGCTCAACTTCCTCGGG + Intergenic
1181342586 22:22194554-22194576 AAATGGGTCCCAGTCTCCTTTGG - Intergenic
1181628806 22:24139677-24139699 AGCTGCTGCCCAGTCTCCTTGGG + Intronic
1181960020 22:26616236-26616258 AGGTGGGGCCCCCTTCCCCTTGG + Exonic
1183107796 22:35627400-35627422 GGGTGGAGACCAGTTTCCTTTGG + Intronic
1183364870 22:37401572-37401594 AGCTGGGGCCGTGTTTCCTGAGG - Intronic
1183715573 22:39531516-39531538 AGGTGGAGCCTAGTTTCTTGGGG - Intronic
1184524908 22:45016469-45016491 AGGTGGGTCCCAGTTAGCATGGG - Intergenic
954331041 3:49890422-49890444 GGGTGAGGCCCAGTGTTCTTGGG + Intronic
954860829 3:53689130-53689152 AACTGGAGCCCAGCTTCCTTGGG - Intronic
960151082 3:114249566-114249588 AGGTCATGCCCAGTTTTCTTGGG + Intergenic
961265491 3:125638450-125638472 GGTTGGGGTCCAGTTTCATTCGG - Intergenic
961870891 3:129987386-129987408 AACTGAGGCACAGTTTCCTTGGG + Intergenic
962257881 3:133884769-133884791 ATGTGGGGCCCCCTGTCCTTTGG - Intronic
967305918 3:188059409-188059431 AGCTAGGGCCCAGTATGCTTTGG + Intergenic
978384170 4:108164853-108164875 AGGTGGGTTCCAGATTCTTTGGG - Intronic
979963850 4:127053664-127053686 GGGTGAGGCCCAGTATCCTTGGG - Intergenic
981603957 4:146522602-146522624 AGGTCGGGCCCACCTTCCTTGGG - Intergenic
981812372 4:148790175-148790197 AGCTGGGGCTCAGCTGCCTTGGG + Intergenic
984207228 4:176799746-176799768 AGGTCGTGCCAAGATTCCTTGGG - Intergenic
986301947 5:6484332-6484354 AGGAGGGGCCCAGAATCCTCAGG - Intronic
988903773 5:35763128-35763150 AAGTGATGCCCAGTTTCGTTTGG + Intronic
992217194 5:74537766-74537788 AACTGTGGCCCAGTTTCCCTGGG + Intergenic
993330713 5:86596727-86596749 AGGTAAGGCCCTATTTCCTTGGG - Intergenic
994733981 5:103529231-103529253 AGGTGGAGGCCAGTATACTTAGG + Intergenic
994952921 5:106487951-106487973 AGGTGGGGCCCAGCATTCTGTGG + Intergenic
995531382 5:113095137-113095159 ACATGGGGGCCAGATTCCTTAGG - Intronic
995553365 5:113301735-113301757 AGGTGAAGCCCTGTTTCCCTAGG - Intronic
996875529 5:128236433-128236455 AGGTGTGGAGCAGGTTCCTTTGG - Intergenic
997042965 5:130278957-130278979 AGGTGGGGGACAGTTTCTCTGGG - Intergenic
997333076 5:133081491-133081513 AGGTAGGGCCCAGTTTGCTGTGG + Intronic
998428511 5:142050165-142050187 AGGTGAGGCTCTGTTTCCTGAGG - Intergenic
1001129602 5:169052961-169052983 AAATGTGGCCCACTTTCCTTTGG - Intronic
1002122184 5:177013771-177013793 AACTTGTGCCCAGTTTCCTTTGG - Intronic
1006679514 6:35787174-35787196 AGGGCGGGCCCAGATTCCTGGGG + Intronic
1006738564 6:36292111-36292133 AGGTAGGTCCCAGTGTCTTTCGG + Intronic
1007705939 6:43791479-43791501 AGGTGAGGCCCACTTTCTCTTGG - Intergenic
1008384743 6:50875933-50875955 AGGAAGGACCCAGTTTCCTTTGG + Intergenic
1008565625 6:52765458-52765480 AGGAGGGGCGCAGATTCCCTGGG - Intergenic
1008568432 6:52792042-52792064 AGGAGGGGCTCAGATTCCCTGGG - Intronic
1008569815 6:52805797-52805819 AGGAGGGGCGCAGATTCCCTGGG - Intergenic
1011949436 6:92946039-92946061 ATGTGAGGCCCAGTTTGCCTGGG - Intergenic
1012357379 6:98332305-98332327 AGCTTGGGCCAAGTGTCCTTGGG - Intergenic
1012619504 6:101323656-101323678 AGCTGGAGGCCATTTTCCTTAGG + Intergenic
1013170566 6:107634164-107634186 AAGTGGGGCCCAGGTTTCTGGGG - Exonic
1013469138 6:110445633-110445655 GGGTGTGGCCTTGTTTCCTTGGG + Intronic
1015326946 6:131933999-131934021 ATGTTGGGCCTAGTTTCCTTGGG - Intergenic
1015519210 6:134114543-134114565 AGGTGAGGCCCAGGTTCCCTGGG - Intergenic
1019745098 7:2695376-2695398 AGGTGGGGCCCTGCTTCCCATGG + Intronic
1022891022 7:34699699-34699721 GGGTGGGGCCCTGATTCCATAGG - Intronic
1023145424 7:37146234-37146256 AGGTGGGGCCCAGCAACCTGGGG - Intronic
1026601924 7:71784538-71784560 AGGTGGGGCGCAGCTTCTTTGGG + Exonic
1031083101 7:117277492-117277514 AGGTGGGGACGTGTGTCCTTTGG - Exonic
1031937695 7:127752514-127752536 AGGTAGTGCTCTGTTTCCTTTGG + Intronic
1032062131 7:128733763-128733785 AGGTGGGGCCCAGTTGGCCATGG - Intergenic
1032784834 7:135192832-135192854 AGGTGGTGCCCAGGTCCCCTGGG + Intronic
1032843465 7:135733275-135733297 AGATGGGGGACAGATTCCTTCGG - Intronic
1033450028 7:141454407-141454429 ACGTGGGGCCCAGTACCCTTTGG + Intronic
1037727401 8:21494426-21494448 AGGTGGGCCCCTTTTTCCTCAGG + Intergenic
1038494324 8:27990820-27990842 AGTTGAGGTCCAGTCTCCTTGGG - Intronic
1038687392 8:29730791-29730813 AGTTTGTGCCCAGTCTCCTTGGG - Intergenic
1039118270 8:34116700-34116722 AGCTGGAGCCCATTATCCTTAGG + Intergenic
1045474132 8:102538682-102538704 AGGCAGAGCCCAGTTTCCTAAGG + Intergenic
1045507746 8:102790654-102790676 AGGTGGGTCCCAGTGTTTTTGGG + Intergenic
1048326347 8:133442301-133442323 TGGTGGCCCCCAGTTTTCTTGGG + Intergenic
1048446388 8:134496539-134496561 TAGTGGGGCCCAGTTGCCCTGGG - Intronic
1049809022 8:144554990-144555012 AGGTGGTGACCAGTTTGCTGTGG - Intronic
1050832236 9:10028959-10028981 GGGTGGGGCCCAGGGTCCCTGGG + Intronic
1055288378 9:74755753-74755775 AGGTGGGACCCAGTGACCTGTGG - Intronic
1056767731 9:89455138-89455160 AGGGAGGGCCCAGTGCCCTTTGG + Intronic
1059559464 9:115319117-115319139 AGTTGGGGCTCATTTTCCTTAGG - Intronic
1059958391 9:119541980-119542002 AGAGTGGGCCCTGTTTCCTTGGG + Intergenic
1061095073 9:128451943-128451965 AGGCTGGGCCCCGCTTCCTTGGG - Intergenic
1061277435 9:129577404-129577426 AGGTGGAGCCCAGTGACCTGGGG + Intergenic
1061786302 9:133030613-133030635 AGGTGGGACCTAGCTTCCTCCGG + Intergenic
1062043929 9:134416559-134416581 TGGCAGGGCCCAGTGTCCTTGGG + Intronic
1062094935 9:134698258-134698280 ACCTGGGGCCCAGTCTCCTGTGG + Intronic
1062360479 9:136185770-136185792 AGGTGGGGCTCAGTCACCTGAGG - Intergenic
1186501026 X:10050623-10050645 AGATGTGGCCCAGATTCCTCAGG - Intronic
1187319677 X:18228170-18228192 CGCTGGGGCCCAGTCTCCTGGGG - Intergenic
1190148322 X:47919028-47919050 AGGTGTGGCTGAGGTTCCTTGGG - Exonic
1192861235 X:75073926-75073948 ATGCGGTGCCCAGTTTGCTTTGG - Exonic
1194039167 X:88918418-88918440 AGGTGTTGCCTAGTTTCTTTTGG + Intergenic
1198716005 X:139558377-139558399 TGCTGGGGCCCAGTGTCCTGTGG + Intronic
1199421547 X:147650257-147650279 AGGTGGGGAACAGTGTCCTAAGG - Intergenic