ID: 1105980944

View in Genome Browser
Species Human (GRCh38)
Location 13:25515497-25515519
Sequence CCTTCTGAGTATGAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105980944_1105980949 6 Left 1105980944 13:25515497-25515519 CCCTGCAGCTCATACTCAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1105980949 13:25515526-25515548 GGAGGCATGTTCAACTTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105980944 Original CRISPR CCTTCTGAGTATGAGCTGCA GGG (reversed) Intronic
901128858 1:6949653-6949675 CATTCAGAGAGTGAGCTGCAGGG - Intronic
902266591 1:15271341-15271363 TGTTCTGACTGTGAGCTGCAGGG - Intronic
904469569 1:30728111-30728133 CCTTCAGAGTCTGAGCTTCAGGG - Intergenic
905561809 1:38933271-38933293 CCTTGTGTGTATGAGTTGTAGGG - Intronic
908711280 1:67018382-67018404 ACTTCTGATTTTGAGCAGCATGG - Intronic
912391222 1:109304548-109304570 CCCTCAGAGTCTGAGCTCCACGG - Intronic
912391486 1:109306307-109306329 CCCTCAGAGTCTGAGCTCCACGG - Intronic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
915939464 1:160109579-160109601 CCTGCTGAGTGTGAGGAGCAAGG - Intergenic
1063123614 10:3122234-3122256 CCTTCTGATCCTGAGCTCCAAGG + Intronic
1064795769 10:19009714-19009736 CCCTAGGAGTTTGAGCTGCAGGG - Intergenic
1071334192 10:84588363-84588385 CCTGCTGAGTGGGGGCTGCAGGG - Intergenic
1071588872 10:86852442-86852464 CTTTCTGAGTAGGGGCTACAGGG - Intronic
1073182816 10:101595716-101595738 CCTCCTTATTATGAGCTGCTTGG + Intronic
1079401696 11:20111192-20111214 CCTTCTGACTGTGGGATGCAGGG - Intronic
1080652785 11:34235966-34235988 GCTTCTGAGTGTGGGCAGCAGGG - Intronic
1081201937 11:40227137-40227159 CATCCTGAGAATGAACTGCATGG + Intronic
1081462793 11:43287052-43287074 CCTTAGGGGTTTGAGCTGCAGGG + Intergenic
1084119545 11:67060849-67060871 CCTTCTTGATCTGAGCTGCAAGG - Intronic
1088027345 11:105201602-105201624 CCTACTGAGTATGAGACGAAAGG - Intergenic
1088184416 11:107149450-107149472 TCTTCTGAAGATGAGCTGGAAGG + Intergenic
1088239372 11:107758158-107758180 CCTTCTGACTATGATCATCATGG + Intergenic
1090571249 11:128049063-128049085 CCTTCTGAGTGTGAGCAGGATGG + Intergenic
1090859298 11:130638873-130638895 CTTTCTGTTTATGTGCTGCAAGG + Intergenic
1090955522 11:131510245-131510267 CCCGCTGCGGATGAGCTGCAAGG - Intronic
1091156460 11:133378855-133378877 CCTCCTGAATATGAGCAGCTAGG + Intronic
1094190823 12:27696649-27696671 CCTTCAGTTTCTGAGCTGCATGG - Exonic
1094873547 12:34614241-34614263 CAGTCTGAGTACAAGCTGCAAGG - Intergenic
1097960446 12:65527306-65527328 CCTTCTGGATATAAGCAGCACGG + Intergenic
1098384851 12:69907934-69907956 CCTTCCAAGTATGACCTGCAAGG + Intronic
1099675167 12:85751189-85751211 AATTCTGAGTCAGAGCTGCACGG + Intergenic
1103018247 12:117512888-117512910 CCTTCTGCCTATGGGCAGCAAGG - Intronic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1104739518 12:131163074-131163096 CCTTCCTTGTATGACCTGCATGG + Intergenic
1105353528 13:19637051-19637073 CCTTCTGAGTTTTAGGAGCATGG - Intronic
1105980944 13:25515497-25515519 CCTTCTGAGTATGAGCTGCAGGG - Intronic
1109189348 13:59306826-59306848 CTTTCAAAGAATGAGCTGCATGG + Intergenic
1110296272 13:73869896-73869918 CCTTCTGATTTTGAACTACAAGG - Intronic
1110419954 13:75296478-75296500 CCATTTGAGTATGTGCGGCAGGG - Intronic
1112235677 13:97634226-97634248 CCTTGTTAGTATGAACTGGAGGG - Intergenic
1114432889 14:22677769-22677791 CCATCTGAGATTGAACTGCAAGG - Intergenic
1121001067 14:90452495-90452517 CCTTCTGAGGATGAGAACCAAGG - Intergenic
1122660407 14:103291054-103291076 CCTTCTGAGTCTGAGGTGACAGG - Intergenic
1127819261 15:62640702-62640724 CTTTCTGAGGATGAGCTGTGAGG - Intronic
1132931538 16:2461344-2461366 GCTTCTGAGCATGAGCCTCAGGG - Intronic
1136193290 16:28631871-28631893 CCCTGTGAGTATTAGTTGCATGG - Intergenic
1141230327 16:82161278-82161300 CCTTCTGGGTCTGAGATGTAGGG - Intronic
1142205605 16:88781552-88781574 CCTTCTGAGCATCAGCTCCCTGG - Intronic
1142806823 17:2375764-2375786 CCCTCAAAGTGTGAGCTGCAGGG - Exonic
1144699185 17:17325689-17325711 CCTCCTGAGCATGACCTGCAGGG + Intronic
1144838603 17:18171764-18171786 GTTTCTGGGTAAGAGCTGCAGGG + Exonic
1151664005 17:75535189-75535211 CCATCAGAGTAGGAGGTGCAGGG + Intronic
1152556253 17:81054664-81054686 CTTTGTGAGAAGGAGCTGCAGGG - Intronic
1153772105 18:8424641-8424663 CCTGCTGTGTCTGGGCTGCAAGG + Intergenic
1153816237 18:8792761-8792783 CCTCCTGGGTAAGAGATGCAGGG + Intronic
1154200457 18:12296288-12296310 CCTGCCCAGTGTGAGCTGCAGGG - Intergenic
1154292878 18:13126073-13126095 CCTTCTGAGTATAAACTGAAAGG - Intergenic
1155808747 18:30205980-30206002 CCCTAGGAGTTTGAGCTGCAGGG - Intergenic
1159417548 18:68172924-68172946 CCTTAGGAGTTTGAGCAGCAGGG - Intergenic
1160566658 18:79790217-79790239 CCTTCCGAGGATGCGGTGCAAGG + Intergenic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1163241095 19:16064369-16064391 CCCTCTGGGCATGAGCTCCAGGG - Intergenic
926073277 2:9918724-9918746 CTTTATGAGAATGAGCAGCAAGG + Intronic
927982662 2:27384143-27384165 GATTCTGAGTATGAGCTGTGGGG - Intronic
929692528 2:44086722-44086744 CCTTTTGTGTATCATCTGCAGGG + Intergenic
932498660 2:72160661-72160683 CCCTATGAGTATAAGCTGCATGG - Intergenic
936342147 2:111643199-111643221 CCTTGTGAGTATGAGGAGCCTGG + Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
939087384 2:137737863-137737885 ACTTATAAGTATGAGCTGAATGG + Intergenic
942311269 2:174659222-174659244 CCTCCTGAGTGTGAGTAGCAAGG + Intronic
943591281 2:189799927-189799949 CCATCTCAGAATGAGCTTCATGG + Intronic
944002385 2:194855117-194855139 CAGTCTGAGATTGAGCTGCAAGG + Intergenic
947307500 2:228763825-228763847 CCTGCGGAGTGTGAGCAGCATGG + Intergenic
948903858 2:240968702-240968724 CCTTCTGTGTCTGAGCCACATGG - Intronic
948937663 2:241178099-241178121 CTGTCTGGGTGTGAGCTGCAAGG + Intronic
1170241882 20:14175167-14175189 CCATCTGAGTGGGAGCTGCAAGG + Intronic
1173301403 20:41806993-41807015 CAGTCTGAGATTGAGCTGCAAGG - Intergenic
1174199027 20:48794211-48794233 GCATCTGAGAATGAGGTGCAGGG - Intronic
1176109154 20:63403313-63403335 CCTGCTGAGTGTAAGCTGCCTGG - Intergenic
1177464949 21:21464904-21464926 CCTACTGATTAGAAGCTGCAAGG - Intronic
1179139041 21:38707173-38707195 CCTTCAGAGTCTGGGCTGCTAGG - Intergenic
1179707984 21:43193622-43193644 CCTCCTGAGGCTGGGCTGCATGG + Intergenic
1180061456 21:45387251-45387273 CCTTGTGTGTGAGAGCTGCATGG - Intergenic
1180568174 22:16692849-16692871 TGTGCTGAGAATGAGCTGCAGGG + Intergenic
1183888347 22:40903993-40904015 TGTTCTGATTATGAGATGCAGGG + Intronic
951226884 3:20130724-20130746 CCTTCTGAGTTTGTGATGCTTGG - Intronic
951262294 3:20524088-20524110 CTGTCTGAGTAGGAGCTGCAAGG + Intergenic
953112227 3:39953921-39953943 CCGTCTGAGATTGAACTGCAAGG + Intronic
953190413 3:40681348-40681370 CCTTCTGAGAATGAGCAAAAGGG + Intergenic
955075924 3:55613323-55613345 AGTTCTGATTGTGAGCTGCAAGG - Intronic
955808926 3:62765801-62765823 CCTGGGGAGTCTGAGCTGCAGGG - Intronic
956449963 3:69364256-69364278 TCTTCTGAGTTTGAGCTAAAAGG - Intronic
956941668 3:74169108-74169130 CCTTCTGAGTTTGTTCTTCAAGG + Intergenic
961689963 3:128662276-128662298 CCTTCTGACTAAGAGCTGCAGGG - Intronic
962002263 3:131310649-131310671 CCTTTTGAGTGTCAGCTGCAGGG + Intronic
965474348 3:169136116-169136138 CCTTGTGAGTATTAGCTGAATGG - Intronic
967223691 3:187271194-187271216 CCTTTTCACTATCAGCTGCAGGG + Intronic
971648731 4:29243062-29243084 CCTTCTGAGTATGATGTGCCAGG + Intergenic
973553413 4:52057805-52057827 CCTTCTGTGTCTGAGGTGCTGGG + Intronic
974179062 4:58360944-58360966 CCTTCTGAGTTGGAGGGGCAGGG - Intergenic
974967112 4:68773945-68773967 CATTCTGAGATTGAACTGCAAGG - Intergenic
978355130 4:107864026-107864048 TCTGCTGGTTATGAGCTGCAAGG - Intronic
978534437 4:109746032-109746054 CCTTCTGAGCATGGGGTGCTGGG + Intronic
980386779 4:132095911-132095933 TGTTCTGATTATGAGCTGCCAGG + Intergenic
983207782 4:164929612-164929634 CCTTCTGAGTTGGAGTTGCTTGG + Intergenic
985245595 4:187976970-187976992 CCTTATTAGTATGAGCTGACTGG - Intergenic
986423644 5:7609159-7609181 TCTTCTGAGTATAATTTGCATGG + Intronic
987024415 5:13909785-13909807 CTATCTGACTATGAGCTGCGAGG + Intronic
991488823 5:67164532-67164554 CCCTCCGAGTATAAGCTGGAAGG + Exonic
991636071 5:68707254-68707276 CCTTCTGAGAAGGAGATTCAGGG - Intergenic
995527326 5:113060451-113060473 CCTTCTAAAAATGAGCTGCTAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995748340 5:115427604-115427626 TCTTTTGAGAATGAGCAGCAAGG - Intergenic
996080356 5:119252409-119252431 GCTTCTGACTATGAGGTACAGGG - Intergenic
997384332 5:133460500-133460522 CTTTCTGTCTATGAGCTCCAGGG + Intronic
1002557282 5:180052656-180052678 CCCTGTTAGTGTGAGCTGCATGG - Intronic
1003182479 6:3804044-3804066 CCTTCTGAGTCTCAGCTGGGAGG + Intergenic
1003684742 6:8290924-8290946 AGTTCAGAATATGAGCTGCAAGG - Intergenic
1006434273 6:34018166-34018188 CTTTCTGACTATGAGGTGAAGGG - Intergenic
1008469592 6:51868794-51868816 CTTTCTAAGTATTAGCTGTAGGG + Intronic
1009608946 6:65912477-65912499 CCATCTGAGTGTGAGCAGCCTGG + Intergenic
1010518496 6:76803398-76803420 CCTTAGGACTATGGGCTGCATGG - Intergenic
1010675330 6:78736715-78736737 CATTCTGAGATTGAACTGCAAGG + Intergenic
1011072365 6:83399818-83399840 AATTCTGAGTAAGAGATGCATGG + Intronic
1011836819 6:91441522-91441544 CATTGTGAGGAAGAGCTGCAAGG - Intergenic
1012522784 6:100140457-100140479 CCTTCTGGATATGAACTGCTGGG - Intergenic
1012999545 6:106008662-106008684 CCTTCTGAGTGTGAGAGGGAGGG + Intergenic
1013599741 6:111692745-111692767 CCTTCTGAGTCTGAGGAGCTGGG + Intronic
1015989093 6:138916940-138916962 CCTTCTGACTCTAAGCTGCTTGG + Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1022025513 7:26444462-26444484 TGTCCTGAGGATGAGCTGCAGGG + Intergenic
1022414296 7:30164935-30164957 CCTTCTCAGCATGAGCTAAATGG - Intergenic
1023462902 7:40420126-40420148 CCTTCGGAGTATCAGCAGCTGGG + Intronic
1025738302 7:64174437-64174459 CCTCCTGAGTGTCAGCCGCATGG - Intronic
1026622702 7:71964224-71964246 CCTTAGGAGTTTGAGCAGCAGGG - Intronic
1027425279 7:78055756-78055778 CCTTATGATAATGAGCTGCCTGG + Intronic
1030005254 7:105112271-105112293 CCTGCTGAGTATTGGCTGGAAGG - Exonic
1031417027 7:121507273-121507295 CCAACTGGGCATGAGCTGCATGG - Intergenic
1033631823 7:143165936-143165958 CAGTCTGAGATTGAGCTGCAAGG - Intergenic
1034300399 7:150010283-150010305 GCTGCTGAGAATGAGGTGCAGGG - Intergenic
1034805654 7:154087025-154087047 GCTGCTGAGAATGAGGTGCAGGG + Intronic
1041856506 8:62461841-62461863 ACTTATGAGTATGAGCAGCAAGG - Intronic
1041957384 8:63571037-63571059 CTTTCTGAGAATGTGCTTCATGG - Intergenic
1042615907 8:70649011-70649033 CCTTCTCAGTATTGTCTGCAAGG - Intronic
1044049241 8:87479389-87479411 CCTTCTGAGGATGAATTGCCTGG + Intronic
1044620500 8:94186741-94186763 CACTCAGAGCATGAGCTGCAAGG - Intronic
1046900794 8:119521401-119521423 CATTCTGAGATTGAACTGCAAGG + Intergenic
1052211010 9:25903235-25903257 CTTTGTGACTATGAGCTTCAGGG - Intergenic
1052218311 9:25992534-25992556 CTTTCTGGCTCTGAGCTGCATGG + Intergenic
1053274325 9:36771710-36771732 CCCTATGAGTATGGGCTGCATGG + Intergenic
1057884758 9:98821932-98821954 CCCCCTGAATATGAGCTGCATGG + Intronic
1062143212 9:134971663-134971685 ACTTTTGAGTATGGGCTGCTGGG - Intergenic
1185674667 X:1839586-1839608 CTTTCTGAGTCTGTGCCGCAAGG + Intergenic
1191664112 X:63680789-63680811 CCTTAGCAGTATAAGCTGCAGGG - Intronic
1193770639 X:85583560-85583582 CAGTCTGAGTTTGAACTGCAAGG + Intergenic
1196901770 X:120390801-120390823 CAGTCTGAGATTGAGCTGCAAGG - Intergenic
1199972259 X:152870091-152870113 GGTTCTGAGGGTGAGCTGCAGGG - Intergenic
1200909042 Y:8514838-8514860 CCTTCTGTGTATGTCCAGCAGGG - Intergenic
1202253957 Y:22901719-22901741 CAGTCTGAGATTGAGCTGCAAGG - Intergenic
1202406947 Y:24535468-24535490 CAGTCTGAGATTGAGCTGCAAGG - Intergenic
1202463834 Y:25134613-25134635 CAGTCTGAGATTGAGCTGCAAGG + Intergenic