ID: 1105981304

View in Genome Browser
Species Human (GRCh38)
Location 13:25519080-25519102
Sequence TTTACTCTCCCTCCTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105981301_1105981304 -9 Left 1105981301 13:25519066-25519088 CCCAAATTGGGCTCTTTACTCTC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 163
1105981299_1105981304 1 Left 1105981299 13:25519056-25519078 CCTCCGTTTGCCCAAATTGGGCT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 163
1105981302_1105981304 -10 Left 1105981302 13:25519067-25519089 CCAAATTGGGCTCTTTACTCTCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 163
1105981296_1105981304 4 Left 1105981296 13:25519053-25519075 CCACCTCCGTTTGCCCAAATTGG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 163
1105981300_1105981304 -2 Left 1105981300 13:25519059-25519081 CCGTTTGCCCAAATTGGGCTCTT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105981304 Original CRISPR TTTACTCTCCCTCCTACAGG TGG Intronic
900160326 1:1220232-1220254 TTGACTCTCCCTGATCCAGGAGG - Intronic
900285273 1:1896076-1896098 TTTCCTCTCCCTGCTAGAGTTGG + Intergenic
902767165 1:18625029-18625051 TTTCCTCTCCCACATGCAGGAGG - Intergenic
903479045 1:23639810-23639832 CTGAGTCTCCCTCCTAGAGGTGG + Intronic
903677834 1:25075794-25075816 TTTATTCTACCTGCTACAGCAGG - Intergenic
903998728 1:27325024-27325046 CTTTCTCTCCCTCCTGCTGGAGG - Intronic
905773459 1:40653317-40653339 TGGACTCTCCCTCCTTCAGTTGG - Intronic
912035125 1:105302449-105302471 CTTGCTCTGCCTCCTCCAGGGGG + Intergenic
912160896 1:106983678-106983700 TTAACTTTCTCTCCTAGAGGCGG + Intergenic
922122126 1:222681852-222681874 ACCACTCTCCCTCCTACAGCTGG + Intronic
922876518 1:228943733-228943755 TGTACTCCCCCTCCCACAAGGGG + Intergenic
924520478 1:244802035-244802057 GTTTCTCTCCCTCCGCCAGGGGG - Intergenic
1063629265 10:7719071-7719093 TTTACTCTCCCATCTGCCGGGGG - Intronic
1068483686 10:57628602-57628624 TTTGCTCTCCTTCCTAATGGAGG - Intergenic
1068736160 10:60415492-60415514 TTTATCCTCCCTCCCACAGGTGG - Intronic
1073268494 10:102242400-102242422 TGTGCTCTCCCTCCTTCAGCAGG + Intergenic
1073455908 10:103636630-103636652 ATTATTCTCCCTCCTTAAGGAGG - Intronic
1076526562 10:131115936-131115958 CTTCCTCTCCCTCCCACAGCTGG - Intronic
1077693990 11:4376899-4376921 TTTCCTCTTCCTCCTGCTGGAGG - Intergenic
1079677832 11:23253466-23253488 TATACTCTCCCTCCTCTAGCTGG + Intergenic
1079944284 11:26722221-26722243 TTCACTCTCCCTTCTTCAAGAGG - Intronic
1081941331 11:46944726-46944748 TTTATTATCCCTCCTTTAGGAGG - Intronic
1083311829 11:61787754-61787776 TTTGTTCTCCCTCCCACTGGGGG + Exonic
1084049510 11:66590639-66590661 TTAACTCTATCTCCTCCAGGAGG + Exonic
1085947072 11:81284816-81284838 CCTTCTCCCCCTCCTACAGGGGG + Intergenic
1086480245 11:87228102-87228124 TTTACACTTCATCCTATAGGTGG - Intronic
1088643706 11:111898501-111898523 TTTACTCTCCCTCCACCAAGAGG + Intergenic
1089132726 11:116224931-116224953 TTTTCTCCCCCTCCTGCGGGGGG - Intergenic
1089270176 11:117296605-117296627 CTTCCTTTCCCTCCCACAGGAGG + Intronic
1090994650 11:131854613-131854635 TCTACTCTCCCTCCCACACTGGG - Intronic
1092217763 12:6694850-6694872 TCTGCTCGCCCTCCTGCAGGTGG - Exonic
1094720359 12:33056472-33056494 TATACTCTTCCTCCTACAGCAGG - Intergenic
1095564431 12:43605322-43605344 TTTACATTCCCACCAACAGGTGG + Intergenic
1096688748 12:53306661-53306683 TATGCTCTCCCTCTTTCAGGTGG + Exonic
1097036225 12:56126251-56126273 TTTACTCTCTCTCCTCCTGTAGG + Exonic
1097277830 12:57825208-57825230 GTGACTCTCCCTCCTAGAGTAGG + Intronic
1097624339 12:61981829-61981851 TTTACACTCCCACCAACAGTGGG - Intronic
1099329350 12:81262968-81262990 TTTATTGTTCCTCCTAGAGGTGG + Intronic
1099530979 12:83781100-83781122 TTAACTGTATCTCCTACAGGTGG - Intergenic
1099874725 12:88390705-88390727 ATTTCTCTCTCTGCTACAGGAGG + Intergenic
1101876556 12:108599924-108599946 CTTACTACCCCTCCTTCAGGGGG - Intergenic
1103158857 12:118710672-118710694 CTTTCTCTCCCTCCTTCATGTGG + Intergenic
1104430581 12:128712857-128712879 TTTAATCTTCCTCCTTAAGGGGG + Intergenic
1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG + Intronic
1106169513 13:27276846-27276868 TTTACTCTCTCTCCAAAAGGTGG + Intergenic
1107976665 13:45694812-45694834 TTTACATTCCCTCCAACAGAAGG - Intergenic
1110313439 13:74077249-74077271 TTTACACTCCCACCAACAAGGGG + Intronic
1110716676 13:78713127-78713149 TGTCCTCTCCCTCCCACAGCTGG + Intergenic
1110822177 13:79928961-79928983 GTTACACTCTCTCCTCCAGGAGG - Intergenic
1111022271 13:82467410-82467432 TTTACCCTCCATAATACAGGTGG - Intergenic
1111396699 13:87675362-87675384 TTTTCTCTCTCCCTTACAGGAGG + Exonic
1111549753 13:89791467-89791489 TTTTCTCTTCCTCCTCCTGGAGG - Intergenic
1113104295 13:106756598-106756620 TTCACTCTCCCCCCTCCAAGCGG + Intergenic
1116939180 14:50773348-50773370 TTTACTCACACTCCTACAATAGG + Intronic
1118822285 14:69353313-69353335 ATTCCCCTCCCTACTACAGGAGG + Exonic
1119639224 14:76302243-76302265 TTAAGTCTCCCTTCTACATGTGG - Intergenic
1120202864 14:81556587-81556609 TTTACTTTTCCTCCTTCAGTGGG - Intergenic
1121945690 14:98119573-98119595 TTCACTGTCCCTCCCAAAGGAGG + Intergenic
1122033964 14:98934145-98934167 TCAACTCTCCATCCTCCAGGAGG + Intergenic
1126596435 15:50388408-50388430 TTTACTCTCTCTTCTGCAGAAGG - Intergenic
1128262409 15:66241537-66241559 TTTCCTCTGCCTCCCACTGGAGG - Intronic
1130940097 15:88500629-88500651 CTTACTCTCCCACCAACAGTGGG + Intergenic
1131305847 15:91242481-91242503 TAGCCTCTCCCTCCAACAGGTGG - Intronic
1133300955 16:4782553-4782575 TTTACTTTCCCTCCAGCAGTAGG + Intronic
1135791187 16:25397730-25397752 ATTACTGTCCCTCCTACATCTGG - Intergenic
1138925786 16:61589805-61589827 GTTTCTCTCCCTCCTACAACTGG - Intergenic
1139486513 16:67259810-67259832 GCCACTCTCCCTCCTGCAGGAGG - Exonic
1139753552 16:69124345-69124367 TTAACTTTCCATACTACAGGTGG - Intronic
1144056035 17:11541405-11541427 CTTCCTCTGCCTCCTTCAGGTGG - Intronic
1148236941 17:45975312-45975334 TTTCCTTTCCCTCCTAAAGATGG + Intronic
1150284007 17:63945359-63945381 CTACCTCTCCCTCCTGCAGGTGG - Exonic
1150621046 17:66807891-66807913 CTTCCTCTCCCTCCTACTGCAGG - Exonic
1151450742 17:74196880-74196902 CCTCCTCTCCCTCCTGCAGGGGG + Intergenic
1153804655 18:8701969-8701991 CTTACTCTCTCTGCTGCAGGCGG - Intergenic
1156575517 18:38310999-38311021 TTTATTATCCCTCCAACAGTTGG + Intergenic
1157663879 18:49469193-49469215 GTTATTTTGCCTCCTACAGGTGG + Intergenic
1158277284 18:55781791-55781813 TTTTCTCCCCCTCTTACAGAAGG - Intergenic
1158834627 18:61317487-61317509 TTTTTTCTCCTTACTACAGGTGG + Intergenic
1160327771 18:77966695-77966717 TTCACTCTTCCTCCTGCTGGTGG + Intergenic
1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG + Intronic
1165609945 19:37142689-37142711 TTTATTTTACCTCCTACAGGTGG + Intronic
1165692562 19:37874954-37874976 TTTTCTCTCCCTCTCTCAGGAGG + Intergenic
1165729909 19:38138575-38138597 TTGCCTCCCCCTCCCACAGGGGG + Intronic
1165798414 19:38532676-38532698 TCTCCCCTCCCTCCTCCAGGTGG - Exonic
1167085533 19:47307226-47307248 TTGCCTCTCCCACCTTCAGGTGG - Intronic
1167166092 19:47801660-47801682 TTTACCCACCCTGCTGCAGGTGG - Exonic
1167175587 19:47861605-47861627 TTTACCCACCCTGCTGCAGGTGG + Intergenic
1168367776 19:55804152-55804174 TTTACACTCCCACCAACAGTGGG - Intronic
927894686 2:26774232-26774254 TTCCCTCTCTCTCCTACAGATGG + Exonic
932407339 2:71522214-71522236 TTTTCTCTCTCTCCTACTGCTGG + Intronic
934040285 2:88122552-88122574 TTTGCTCAGCCTCCCACAGGAGG + Intergenic
940141011 2:150490478-150490500 TACACTCTCCCTCCTTCAGCAGG - Intronic
941297312 2:163756297-163756319 TTTTCTCTTCCACCTCCAGGTGG - Intergenic
942209695 2:173658200-173658222 TTTCCTCACCTTCCTTCAGGTGG + Intergenic
943520108 2:188938500-188938522 ATTACTCTCCTTCCCACAGGCGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947079536 2:226380729-226380751 TTTCCTCTCTCTCCTGCAGCTGG + Intergenic
1169733468 20:8811830-8811852 TTTACTCAGCCTCCTATAGCAGG + Intronic
1170696628 20:18665004-18665026 TTTACTTTCCATCCTCCAAGTGG - Intronic
1173126550 20:40341927-40341949 TTCACTTTCCCTCCCACATGTGG - Intergenic
1173722219 20:45269322-45269344 TGTTCTCTGCCTCCCACAGGAGG + Intergenic
1175324865 20:58116572-58116594 TTTCCTGTCTCACCTACAGGTGG + Intergenic
1176346621 21:5754267-5754289 TTTATTCTGCCTTCTACAGCAGG + Intergenic
1176353435 21:5874851-5874873 TTTATTCTGCCTTCTACAGCAGG + Intergenic
1176498206 21:7570188-7570210 TTTATTCTGCCTTCTACAGCAGG - Intergenic
1176540942 21:8152337-8152359 TTTATTCTGCCTTCTACAGCAGG + Intergenic
1176559893 21:8335382-8335404 TTTATTCTGCCTTCTACAGCAGG + Intergenic
1178756232 21:35352811-35352833 TTCAGTCTCCCTCCTTCGGGTGG - Intronic
1179719321 21:43306436-43306458 TTTCCTTTCCCTCCTCCAGGGGG + Intergenic
1184925666 22:47635161-47635183 ATTACTCTCCGTCATACAGGTGG + Intergenic
1203245881 22_KI270733v1_random:68756-68778 TTTATTCTGCCTTCTACAGCAGG + Intergenic
949265885 3:2155879-2155901 TTGACCCTCCAGCCTACAGGAGG + Intronic
949654742 3:6205081-6205103 GTTATTCTGCCTCCTACTGGGGG - Intergenic
949681853 3:6523074-6523096 TTTAATCTCTCTCTTACAGGAGG - Intergenic
957766802 3:84635683-84635705 TTTACATTCCCACCAACAGGAGG + Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
960266669 3:115627962-115627984 TTTACTCTTCATTCTACAGAAGG - Intronic
968533020 4:1105230-1105252 TACACTCTCCCTCCTCAAGGAGG + Intronic
969548792 4:7850418-7850440 TTCCCTCTCCCTCCTCCAGGGGG - Intronic
969778610 4:9379020-9379042 AGTACTCTCCCACCTGCAGGAGG - Intergenic
969937712 4:10698838-10698860 ATTGCTCTCCCTGCTGCAGGTGG + Intergenic
970177032 4:13349908-13349930 TTTACTCTCTCTCCTTGAGCTGG + Intergenic
970600262 4:17636545-17636567 TGTCCTCTCTCTCCTTCAGGCGG + Exonic
975285345 4:72611279-72611301 TTTCCTTTCCCTCCTACAGTAGG + Intergenic
975904314 4:79191274-79191296 TTTACACTCCCACCAACAGTGGG + Intergenic
976937260 4:90651740-90651762 TTTGCTCTCTGTCCTAGAGGGGG - Intronic
977815854 4:101413126-101413148 TTTACACTCCCACCAACAGTGGG - Intronic
980534140 4:134092728-134092750 TATCCTCTCCCTCCCACAAGGGG + Intergenic
980804041 4:137789182-137789204 TTTACACTCCCACCAACAGTGGG - Intergenic
981090564 4:140728049-140728071 TTAACTCTAGCTCCTATAGGAGG + Intronic
983049295 4:163026258-163026280 CTTTGTTTCCCTCCTACAGGAGG + Intergenic
986225761 5:5810797-5810819 TTTATCCTACCTCCTACATGGGG - Intergenic
990992797 5:61701717-61701739 TTTGCTCTCCCTCCAAGAGAAGG - Intronic
991953820 5:71972454-71972476 TTTCCTTTCCCTCATACTGGAGG + Intergenic
995536422 5:113141113-113141135 TTCACTCTCCCTCTTCCTGGAGG + Intronic
996453439 5:123654439-123654461 TTTCCTCTCACCCCAACAGGTGG + Intergenic
998205189 5:140152676-140152698 TTTTCAGTCCCTCCCACAGGTGG - Intergenic
998246191 5:140507775-140507797 TTTACTCCCAGTCCTAAAGGGGG - Exonic
999210695 5:149886101-149886123 ATTATTCTGCCTGCTACAGGAGG + Intronic
1001809432 5:174616404-174616426 TTTACTCTGCTTCCTTCATGAGG + Intergenic
1001818524 5:174691466-174691488 TTGCCTCTCCCTCCAACAGAGGG - Intergenic
1002195325 5:177497874-177497896 TTTCCTCTCCCTCCGCCAGCGGG - Intergenic
1007272997 6:40652499-40652521 TTGACACTCCTTCCTTCAGGAGG - Intergenic
1008473957 6:51916079-51916101 TTTTCTCTCCACCTTACAGGTGG + Intronic
1011507544 6:88063317-88063339 TTTACTCATCCTCCTACTGATGG - Intronic
1018621847 6:165736440-165736462 TTCACTCTCCTTCCCCCAGGAGG - Intronic
1021638860 7:22718738-22718760 CTAACTCTCCCTCATTCAGGTGG + Intergenic
1021857327 7:24870204-24870226 TGTGCTGTCTCTCCTACAGGTGG - Intronic
1022858337 7:34339296-34339318 TTTGCACTCCCTCCTTCTGGTGG + Intergenic
1026316092 7:69228906-69228928 TTTACTCACCAGCCTACAGGTGG - Intergenic
1026557545 7:71421367-71421389 TTTATTCTTCCTCGTATAGGAGG + Intronic
1031781514 7:125973267-125973289 TATACTCTCCCTCCCTCAGATGG - Intergenic
1032861638 7:135885333-135885355 TTCTCTCTCCCTCCTACGAGGGG + Intergenic
1036015162 8:4774814-4774836 TTCTCTCTTCCTCCTACTGGAGG + Intronic
1036345295 8:7957354-7957376 AGTACTCTCCCACCTGCAGGAGG + Intergenic
1036840624 8:12118121-12118143 AGTACTCTCCCACCTGCAGGAGG + Intergenic
1036862427 8:12364366-12364388 AGTACTCTCCCACCTGCAGGAGG + Intergenic
1036941922 8:13059962-13059984 TTTACTGAGCCTCCTACAGAAGG - Intergenic
1036969230 8:13335218-13335240 TTTGCTCTTCCTCCTCCAAGAGG - Intronic
1040574152 8:48636118-48636140 TTGACACTCCATCCTACAGGAGG - Intergenic
1043387595 8:79763805-79763827 TTTGCCCTGCCTCCTACAAGGGG - Intergenic
1043670281 8:82876101-82876123 TTTACACTCCATCCTACATCTGG - Intergenic
1045792295 8:105997447-105997469 TTTAATCTCCTTCCTTCTGGGGG + Intergenic
1046521548 8:115332026-115332048 TTTAGTCTCCCACCCACAGAAGG - Intergenic
1050252591 9:3760942-3760964 TTTGCTCCCTCTCCTAAAGGAGG + Intergenic
1050784812 9:9387925-9387947 TTTAGTTTCCCACCTATAGGTGG + Intronic
1055523366 9:77105078-77105100 TTTACACTCCCACCAACAGTGGG - Intergenic
1056201878 9:84284804-84284826 TTTTCTCTCCCTCATCCACGTGG + Intronic
1059137451 9:111820816-111820838 TTAACTCTCACTCCCACATGAGG - Intergenic
1203462218 Un_GL000220v1:51828-51850 TTTATTCTGCCTTCTACAGCAGG + Intergenic
1186379263 X:9039912-9039934 ATTATTCTACCTACTACAGGTGG + Intronic
1188447709 X:30273489-30273511 TTTACATTCCCTCCAACAGTAGG - Intergenic
1189312330 X:40028470-40028492 TTTTTTCTCCATCCTACAGATGG - Intergenic
1189647604 X:43150939-43150961 ATTATTCTTTCTCCTACAGGTGG - Intergenic
1190822413 X:53985946-53985968 TACACTCTCTCTCCAACAGGAGG - Exonic
1191841228 X:65514758-65514780 TCTTCTCTCCCTCCCACAGGTGG + Intronic
1198059639 X:133032357-133032379 TTTACTCTTCCTCCTGCCTGGGG - Intronic
1201731686 Y:17211172-17211194 TGTACTCCCCCTCCTGCAAGGGG + Intergenic