ID: 1105981962

View in Genome Browser
Species Human (GRCh38)
Location 13:25526674-25526696
Sequence TAGCAGCACCATGCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 3, 1: 11, 2: 29, 3: 52, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105981962_1105981964 -4 Left 1105981962 13:25526674-25526696 CCTCCTACAGCATGGTGCTGCTA 0: 3
1: 11
2: 29
3: 52
4: 177
Right 1105981964 13:25526693-25526715 GCTAAGCAGACACTGCAATTTGG 0: 1
1: 0
2: 1
3: 7
4: 108
1105981962_1105981965 7 Left 1105981962 13:25526674-25526696 CCTCCTACAGCATGGTGCTGCTA 0: 3
1: 11
2: 29
3: 52
4: 177
Right 1105981965 13:25526704-25526726 ACTGCAATTTGGTATCTCTTTGG 0: 1
1: 0
2: 2
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105981962 Original CRISPR TAGCAGCACCATGCTGTAGG AGG (reversed) Intronic