ID: 1105981962 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:25526674-25526696 |
Sequence | TAGCAGCACCATGCTGTAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 272 | |||
Summary | {0: 3, 1: 11, 2: 29, 3: 52, 4: 177} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1105981962_1105981964 | -4 | Left | 1105981962 | 13:25526674-25526696 | CCTCCTACAGCATGGTGCTGCTA | 0: 3 1: 11 2: 29 3: 52 4: 177 |
||
Right | 1105981964 | 13:25526693-25526715 | GCTAAGCAGACACTGCAATTTGG | 0: 1 1: 0 2: 1 3: 7 4: 108 |
||||
1105981962_1105981965 | 7 | Left | 1105981962 | 13:25526674-25526696 | CCTCCTACAGCATGGTGCTGCTA | 0: 3 1: 11 2: 29 3: 52 4: 177 |
||
Right | 1105981965 | 13:25526704-25526726 | ACTGCAATTTGGTATCTCTTTGG | 0: 1 1: 0 2: 2 3: 12 4: 172 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1105981962 | Original CRISPR | TAGCAGCACCATGCTGTAGG AGG (reversed) | Intronic | ||