ID: 1105981963

View in Genome Browser
Species Human (GRCh38)
Location 13:25526677-25526699
Sequence GCTTAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 2, 2: 17, 3: 45, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105981963_1105981965 4 Left 1105981963 13:25526677-25526699 CCTACAGCATGGTGCTGCTAAGC 0: 1
1: 2
2: 17
3: 45
4: 161
Right 1105981965 13:25526704-25526726 ACTGCAATTTGGTATCTCTTTGG 0: 1
1: 0
2: 2
3: 12
4: 172
1105981963_1105981964 -7 Left 1105981963 13:25526677-25526699 CCTACAGCATGGTGCTGCTAAGC 0: 1
1: 2
2: 17
3: 45
4: 161
Right 1105981964 13:25526693-25526715 GCTAAGCAGACACTGCAATTTGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105981963 Original CRISPR GCTTAGCAGCACCATGCTGT AGG (reversed) Intronic