ID: 1105981963

View in Genome Browser
Species Human (GRCh38)
Location 13:25526677-25526699
Sequence GCTTAGCAGCACCATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 2, 2: 17, 3: 45, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105981963_1105981965 4 Left 1105981963 13:25526677-25526699 CCTACAGCATGGTGCTGCTAAGC 0: 1
1: 2
2: 17
3: 45
4: 161
Right 1105981965 13:25526704-25526726 ACTGCAATTTGGTATCTCTTTGG 0: 1
1: 0
2: 2
3: 12
4: 172
1105981963_1105981964 -7 Left 1105981963 13:25526677-25526699 CCTACAGCATGGTGCTGCTAAGC 0: 1
1: 2
2: 17
3: 45
4: 161
Right 1105981964 13:25526693-25526715 GCTAAGCAGACACTGCAATTTGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105981963 Original CRISPR GCTTAGCAGCACCATGCTGT AGG (reversed) Intronic
902642891 1:17778152-17778174 GCTTAGCAGCAAAAAGCTGTGGG + Intronic
904012788 1:27399346-27399368 GCTGAGCAGCTCCAGGCTGTGGG - Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
905043107 1:34976602-34976624 GCTCAGCAGCGCCAGGCTGAGGG + Intergenic
905435927 1:37955115-37955137 GTTTAGCAGCACCAATCTGAGGG + Intergenic
905528285 1:38655904-38655926 GCTTAGCAGCCACATGGGGTCGG + Intergenic
906071427 1:43019409-43019431 GCTGAGATGCACCATGCTCTTGG - Intergenic
908450687 1:64251884-64251906 GCCAAGCAGCACCATCCTGAGGG + Intronic
908660915 1:66434349-66434371 GCTGAGCAGGACCATCCTGTAGG + Intergenic
909386147 1:75059037-75059059 GCTAAGCATCAGGATGCTGTGGG + Intergenic
910485697 1:87711048-87711070 GCTGAGCCCCAGCATGCTGTAGG - Intergenic
910838068 1:91535574-91535596 GCTTCGAAGCAGCATGCGGTGGG + Intergenic
911149145 1:94580322-94580344 GCTGAGCAGCATCAGTCTGTGGG - Intergenic
911756870 1:101568467-101568489 GCTTAGCAGGATCATGATGTGGG + Intergenic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
912232072 1:107806011-107806033 GCTTTTCAGTACCATGCTATAGG - Intronic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915361849 1:155290581-155290603 GCTTAGCACCCGCATGATGTTGG + Exonic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916168812 1:161985616-161985638 GCTGAGCTGCCCCAGGCTGTGGG + Intronic
920845875 1:209592592-209592614 GCTTACCAGGACCCTGCTGGTGG - Intronic
921533205 1:216311095-216311117 GCTTAGCAGCACTATGATGCAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923724916 1:236497395-236497417 GGTGCACAGCACCATGCTGTGGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1063400829 10:5743984-5744006 GACTAGCAGCAACATGCTTTTGG - Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1069053188 10:63815869-63815891 GCTGAGCAGCAACAGTCTGTAGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074673118 10:115818253-115818275 GCTCAGCAGCTCCATGCTTCTGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1089617915 11:119705632-119705654 CCTGAGCTGGACCATGCTGTTGG + Intronic
1091270186 11:134305038-134305060 TCTTAGTGGCACAATGCTGTAGG + Intronic
1091361536 11:134981944-134981966 GCTTAGGGGCACCAGGCTCTGGG - Intergenic
1091686936 12:2569206-2569228 GCTGAGGGGCACCATGCTCTAGG + Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097487080 12:60216369-60216391 GCATAGCAGCAGCATGCTGAGGG - Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101987655 12:109460405-109460427 TCCTTGCAGCCCCATGCTGTTGG - Intronic
1103871433 12:124095199-124095221 GCTTTGCTGCTCCATGCTGAGGG + Intronic
1104682299 12:130760341-130760363 TCTAAGCTGCACCCTGCTGTGGG - Intergenic
1104858134 12:131911411-131911433 GCGTGGCAGCGCCCTGCTGTAGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1107527902 13:41251529-41251551 CCTGAGCAGCAGCATGCTGGTGG - Intronic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1107985879 13:45775752-45775774 CCTCATCAGCACCAAGCTGTGGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1113457385 13:110458243-110458265 GCAAGGCAGCACCATGCTGGCGG - Intronic
1113491756 13:110697842-110697864 GCTAAACAGCCCCATGCGGTGGG + Intronic
1113601911 13:111575558-111575580 CCTCAGCAACACCATGCGGTTGG + Intergenic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119608940 14:76045551-76045573 GCTTAGCAGCCCGGGGCTGTAGG + Intronic
1119711444 14:76825340-76825362 GCATGGCAGCACCATTCTGGTGG - Intronic
1124413737 15:29457688-29457710 ACTTAGCAGCTTCATGCTGATGG - Intronic
1126990410 15:54368630-54368652 TGTTAGCATCACCATGCTGTGGG - Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127251161 15:57239769-57239791 GGTTAGTAGCACCATGCTTATGG - Intronic
1127719915 15:61689237-61689259 GCTTAGCAGCACCATGCCATAGG - Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1130431181 15:83848674-83848696 GCTTAGGAGCACCGTGATCTTGG + Intronic
1130553935 15:84909819-84909841 GCATAGCAGCTCCATGGTGATGG - Intronic
1130779208 15:87017027-87017049 GCTGAGCAGCATCATTCTGCAGG + Intronic
1136279894 16:29202183-29202205 GCTGAGCAGAGCCAGGCTGTTGG + Intergenic
1136279924 16:29202353-29202375 GCTGAGCAGAGCCAGGCTGTTGG + Intergenic
1140144932 16:72297539-72297561 ACTTAGCAGCGCTATGGTGTGGG + Intergenic
1141537196 16:84690262-84690284 GCTTAGCGGCAGGAAGCTGTGGG - Intergenic
1142084286 16:88168291-88168313 GCTGAGCAGAGCCAGGCTGTTGG + Intergenic
1144455966 17:15418491-15418513 GCTTATAAGTACCAAGCTGTGGG + Intergenic
1145795361 17:27652354-27652376 GATGAGCAGCAGCATGCTGAAGG + Intergenic
1148142037 17:45335850-45335872 TCTCAGCAGATCCATGCTGTTGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1154202967 18:12312023-12312045 GCTTAAAAGCACTATGGTGTAGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155270285 18:24134933-24134955 GTTTTGCAACACCATCCTGTAGG + Intronic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1167309181 19:48727056-48727078 GCTAAGCAGCTCCGTGGTGTTGG + Exonic
1167826384 19:51977434-51977456 GCTAAACAGAACCATGCTGCTGG + Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925748769 2:7068449-7068471 TGTTAGCAGCACCATCCTCTCGG - Intergenic
926007796 2:9386053-9386075 GCCTCGAAGCACCATGCTGAAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
944383341 2:199137274-199137296 GCGTAGCTACACCATGCTGTGGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
947526521 2:230879791-230879813 GCTTAACAGCACCAAGCAGGTGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1177496092 21:21894456-21894478 GCTTAGCAGTTCAAGGCTGTGGG - Intergenic
1177723364 21:24936160-24936182 GAGAAGCAGCACCATGCTCTGGG + Intergenic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1180701937 22:17785896-17785918 GCTGAGCAGCCACAGGCTGTTGG + Intergenic
1181481325 22:23201021-23201043 GCTTAGCAGCACCAAGCACTAGG - Intronic
950081069 3:10222491-10222513 GCTCAGAAGCTCCATGCTGAGGG + Intronic
952884899 3:38006296-38006318 GCCCATCAGGACCATGCTGTCGG - Intronic
953743996 3:45559453-45559475 GCTGAGCAGCACCTTGATGATGG + Intronic
954396759 3:50297137-50297159 GCTTAGCAGCATCAGGCAGAGGG + Exonic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
958640728 3:96801163-96801185 GCTGAGCAGCATCAGTCTGTGGG - Intergenic
960037177 3:113113700-113113722 GCTTGGCAGCATCATGAGGTGGG + Intergenic
961120001 3:124366073-124366095 GCTTAGAAGAAACATGATGTTGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965438887 3:168688333-168688355 GATTAGCATCAACATGCCGTTGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969306541 4:6329156-6329178 GCTGAGTAGCCCCATGCTGCGGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
971427132 4:26527297-26527319 GAATATCAGCACCATACTGTGGG - Intergenic
972168549 4:36316716-36316738 AGTTAGCAACAACATGCTGTGGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
976030878 4:80751854-80751876 GCCAAGCAGGACCATTCTGTGGG - Intronic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978280518 4:107006431-107006453 ACTTAGCAGCACCTGGTTGTGGG + Intronic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979692256 4:123572674-123572696 TCTTTGCAGCACCATGCAGCTGG + Intergenic
979964392 4:127060682-127060704 TATTAGCAGCACCAAGGTGTTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
985435049 4:189920645-189920667 GTTTATGGGCACCATGCTGTGGG + Intergenic
986341963 5:6796883-6796905 GCTCAACAGAACCATGCTCTTGG - Intergenic
987853549 5:23388046-23388068 GCTTTGCAGCACCAGGCAGGCGG + Intergenic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995579031 5:113574699-113574721 GCCAAGCAGCATCATTCTGTGGG - Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997111945 5:131085055-131085077 TGTTAGCAGCAACATGTTGTAGG - Intergenic
997258473 5:132447234-132447256 GCTCAGCAGCCCCAAGCTATGGG + Intronic
998148351 5:139743232-139743254 GCTCACCAGCACCTTGCTGGAGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003262291 6:4529752-4529774 GCCTAGCAGCTCTATGATGTAGG - Intergenic
1006925149 6:37649953-37649975 CCTTGACAGCCCCATGCTGTAGG - Intronic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1009623250 6:66102606-66102628 GCTTAGCATCCCAAAGCTGTAGG - Intergenic
1009693538 6:67067104-67067126 GTCTAGCAGCACCAAGCTATAGG - Intergenic
1010295865 6:74194937-74194959 GCTGAGCAGCAACACTCTGTAGG - Intergenic
1011508252 6:88071888-88071910 ACTCAGCAGCACTATGCTATAGG - Intergenic
1011854627 6:91673944-91673966 GCTTAGCAGAACCCTGGAGTAGG - Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019897978 7:3997907-3997929 GCTTGGCTGCTCCCTGCTGTTGG - Intronic
1020583730 7:10037956-10037978 TATTAGCATCACAATGCTGTGGG - Intergenic
1021520681 7:21536675-21536697 GCCTACCCCCACCATGCTGTGGG - Intergenic
1021677554 7:23096952-23096974 GGCTAGGAGCACCATGCTCTGGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023269874 7:38450726-38450748 GCTTATCAGCAACATTCTGATGG - Intronic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1025869930 7:65422161-65422183 GCTGAGCAGCATCAGTCTGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1029517617 7:101036150-101036172 GCCTGTCAGCACCATGCTGGTGG + Exonic
1029517989 7:101039507-101039529 ACTTGTCAGCACCACGCTGTTGG + Exonic
1030006571 7:105126309-105126331 GCCTAGCAGCTCTATGATGTGGG + Exonic
1035615474 8:997187-997209 ACTTAGCAACAGCATGCTTTGGG + Intergenic
1036764894 8:11543217-11543239 ACTTACCAGCCCCATCCTGTCGG - Exonic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1042644547 8:70971831-70971853 TCATACCAGTACCATGCTGTTGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043063799 8:75540637-75540659 GTTTAGCCGCACAAAGCTGTTGG + Intronic
1044447628 8:92297153-92297175 GCCAAGCAGCATCATTCTGTGGG - Intergenic
1047690804 8:127352544-127352566 ACTTAGCAGCTCCATGATCTGGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053348028 9:37392457-37392479 GATTAACAGCCTCATGCTGTGGG - Intergenic
1055343376 9:75308981-75309003 GCTAAGTAGCATCATTCTGTGGG - Intergenic
1056140392 9:83672896-83672918 GCTTAGCAGAAACATGTTGTAGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060059585 9:120447231-120447253 GCTCAGCTGCATCATTCTGTGGG + Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187052558 X:15709192-15709214 TCTTGGCAGCACCATAATGTAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188901218 X:35734562-35734584 GCTGAGCAGCATCATTCTGTGGG - Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1191701507 X:64047556-64047578 GCTAAGCAGCATCATTCTGTAGG + Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197903986 X:131403674-131403696 GCTTACCAGAACTCTGCTGTAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1201967674 Y:19755361-19755383 GCTGAGCAGCATCCTTCTGTGGG - Intergenic