ID: 1105983040

View in Genome Browser
Species Human (GRCh38)
Location 13:25538294-25538316
Sequence GAAAAAAACCCCAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 630}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105983040_1105983043 -10 Left 1105983040 13:25538294-25538316 CCTGGCTATTTGGGGTTTTTTTC 0: 1
1: 1
2: 5
3: 61
4: 630
Right 1105983043 13:25538307-25538329 GGTTTTTTTCTTATTTATAGGGG 0: 1
1: 0
2: 3
3: 77
4: 1115
1105983040_1105983044 10 Left 1105983040 13:25538294-25538316 CCTGGCTATTTGGGGTTTTTTTC 0: 1
1: 1
2: 5
3: 61
4: 630
Right 1105983044 13:25538327-25538349 GGGCACTGAGTCAAGAGCAGTGG 0: 1
1: 0
2: 1
3: 28
4: 287
1105983040_1105983045 15 Left 1105983040 13:25538294-25538316 CCTGGCTATTTGGGGTTTTTTTC 0: 1
1: 1
2: 5
3: 61
4: 630
Right 1105983045 13:25538332-25538354 CTGAGTCAAGAGCAGTGGAGTGG 0: 1
1: 0
2: 2
3: 36
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105983040 Original CRISPR GAAAAAAACCCCAAATAGCC AGG (reversed) Intronic
901008244 1:6182053-6182075 AAAAAAAAACCCAAAAAACCTGG - Intronic
901525333 1:9818303-9818325 AAAAAAAAACCCAAACGGCCAGG - Intronic
901595545 1:10382708-10382730 CAAAAAAACCCAACATGGCCAGG - Intergenic
902055540 1:13597812-13597834 AAAAATAAACCCAATTAGCCAGG + Intronic
902249448 1:15144343-15144365 AAAAAAAACCCAAATCAGCCGGG - Intergenic
902433230 1:16379746-16379768 AAAAAAAACCCCAAATCAACAGG - Intronic
903142343 1:21346151-21346173 GCAACAAACCCCAAATATACCGG - Intergenic
903336599 1:22628465-22628487 GAAAAAAACAAAAATTAGCCTGG + Intergenic
903484684 1:23680863-23680885 GAAAAATACTCAAATTAGCCAGG - Intergenic
903820590 1:26099577-26099599 TAAAAAAACCCCGAATGTCCGGG + Intergenic
904066024 1:27751795-27751817 GAAAAAAAACAAAAAAAGCCAGG - Intronic
904149579 1:28426501-28426523 CAAAAAAAACCCAATTAGCCAGG + Intronic
904452737 1:30626508-30626530 GATAAAAACCCCCAAAAGCAAGG - Intergenic
904626054 1:31803578-31803600 GAAAAAAAAAAAAAATAGCCAGG + Intronic
905054426 1:35080610-35080632 GTACAAAACCACAAATAGCCGGG - Intronic
905523064 1:38615012-38615034 GGCAAAAACCAGAAATAGCCTGG + Intergenic
906339188 1:44963247-44963269 AAAAAAAACCCCAGAAAACCAGG + Intronic
907220423 1:52903388-52903410 AAAAAAATCCTCAAATAGCATGG - Intronic
907740226 1:57158296-57158318 CAAAAAAATCCCAAACAGCTGGG - Intronic
908213914 1:61931465-61931487 TAAGAAAAGCCCAAATAGGCTGG + Intronic
908950770 1:69560334-69560356 AAAAAAGAGCCCAAATAGCCAGG + Intergenic
909007944 1:70299204-70299226 GAATAAAGGCCCAAATAGCCTGG + Intronic
909087773 1:71187853-71187875 AAAAAAAACAAAAAATAGCCGGG - Intergenic
909091057 1:71226350-71226372 GAAAAGAACCCCAAATACACAGG + Intergenic
909442667 1:75715316-75715338 AAAAAGGAGCCCAAATAGCCAGG + Intergenic
910165387 1:84322360-84322382 GAAACACACCCCAAATAGCATGG - Intronic
910742436 1:90534716-90534738 GAAAAAAACCCTGAAGAGTCTGG + Intergenic
910857916 1:91714604-91714626 GGAAAAAACCCAAAATATCCAGG + Intronic
911745644 1:101439068-101439090 AAGCAAACCCCCAAATAGCCAGG - Intergenic
912152003 1:106870989-106871011 AAAAAAGAGCCCAAATATCCAGG - Intergenic
912572810 1:110637033-110637055 AAAAAAACCCCAAATTAGCCAGG + Intergenic
914845320 1:151280724-151280746 GAAAAAAACAAAAATTAGCCGGG + Intronic
914875363 1:151509643-151509665 CAAAAAAACCCAAAACAGGCTGG + Intergenic
915347761 1:155206679-155206701 GAAAAAAAAACCACCTAGCCGGG + Intronic
915688211 1:157658913-157658935 CAAAAAAACTACAAATAGGCCGG + Intergenic
916712154 1:167421093-167421115 GAAAATGACATCAAATAGCCAGG - Exonic
917321164 1:173783160-173783182 GAAGGAAACCCCAAATTGCTTGG - Intronic
918485563 1:185025431-185025453 AAAAAAAAACCAAATTAGCCAGG - Intergenic
918706196 1:187665349-187665371 GAAAAAAATCACAAAGAGTCAGG + Intergenic
918956352 1:191213488-191213510 TAAAAAGATCCTAAATAGCCAGG - Intergenic
919889468 1:201960237-201960259 TAAAAATACACCAATTAGCCGGG + Intronic
920228303 1:204453932-204453954 AAAAAAAATACAAAATAGCCGGG - Intronic
923595773 1:235360095-235360117 TAAAAAAAAAACAAATAGCCAGG - Intergenic
924646590 1:245883511-245883533 GAAAAAAACCCCAAAACATCAGG + Intronic
1062975501 10:1679578-1679600 TAAAAACACCTCAATTAGCCAGG - Intronic
1063061273 10:2556052-2556074 GTAAAAGACCCAGAATAGCCAGG - Intergenic
1063588490 10:7374099-7374121 TAAAAATACACCAATTAGCCAGG + Intronic
1063595579 10:7432113-7432135 CAAAAAAATACAAAATAGCCAGG - Intergenic
1064207415 10:13335817-13335839 TAAAAATACACAAAATAGCCAGG + Intronic
1064284915 10:13983840-13983862 AAAAAAAAACAAAAATAGCCGGG + Intronic
1064324085 10:14332718-14332740 AAAAAAAATCCCAAATAGTTTGG + Intronic
1065202692 10:23330160-23330182 AACAAAAAATCCAAATAGCCAGG + Intronic
1065765758 10:29028032-29028054 AAAAAAAACACAAATTAGCCTGG - Intergenic
1065832317 10:29625898-29625920 AAAAAAGACCCCAAAAAACCCGG - Intronic
1066137485 10:32464668-32464690 AAAAAAAATACCAATTAGCCAGG - Intronic
1066345533 10:34581528-34581550 GAAAAATAACCTAAATAGGCCGG - Intronic
1066475262 10:35740509-35740531 TAAGAAAGACCCAAATAGCCAGG - Intergenic
1066612867 10:37267812-37267834 GAGAAAAACTCCAAATATCATGG - Intronic
1066680306 10:37931663-37931685 CAAAAAAACACAAAATAGCCAGG - Intergenic
1068146876 10:53082845-53082867 GATAAAAATCCCGAAGAGCCTGG - Intergenic
1068248048 10:54398744-54398766 AAAAAAAACCCCAAATATTCTGG + Intronic
1068314734 10:55325241-55325263 CAAAAAAAGCTCAAATAGCTTGG + Intronic
1068570443 10:58622019-58622041 ACAAAAAACCCAAATTAGCCAGG + Intronic
1069044587 10:63729350-63729372 AAAAAAGAGCCCGAATAGCCAGG + Intergenic
1069047068 10:63753886-63753908 AAAACAAAACCCAAATAGCTAGG + Intergenic
1069335456 10:67344013-67344035 GATAAAAACCCTAAAAAACCTGG - Intronic
1069442960 10:68445829-68445851 AAAAAAAACCACAATTGGCCAGG + Intronic
1069480874 10:68781069-68781091 TAAAAATACACAAAATAGCCAGG + Intronic
1069633949 10:69914066-69914088 GAGGACAACCCCAATTAGCCTGG + Intronic
1069643339 10:69971376-69971398 GAAAAACAGCCCAAGTGGCCAGG + Intergenic
1069764782 10:70847121-70847143 AAAAAAAACCTCAAATGGCTTGG - Intronic
1070899043 10:80011713-80011735 GAAAAATACAAAAAATAGCCAGG + Intergenic
1070904151 10:80056970-80056992 CAAAAAAACCAAAATTAGCCAGG + Intergenic
1071113774 10:82193301-82193323 TAAAAATACCCAAATTAGCCGGG - Intronic
1071612438 10:87043817-87043839 CAAAAAAACCCCAAACAGGCCGG + Intergenic
1072039864 10:91596751-91596773 GAAAAATACCACAAATAAGCAGG + Intergenic
1072776210 10:98197108-98197130 TAAAAATACCAAAAATAGCCAGG - Intronic
1072996565 10:100249879-100249901 TAAGAAAACCCCAAAGAGCTGGG - Intronic
1073914483 10:108386359-108386381 GATAAAAACCCCAGATCACCAGG - Intergenic
1074313461 10:112342224-112342246 GAAAAAAGCCTCAAGTTGCCTGG + Intergenic
1074376809 10:112947509-112947531 GAAAAATACCTTGAATAGCCGGG - Intergenic
1074444797 10:113512752-113512774 AAGCAAAACCCAAAATAGCCAGG + Intergenic
1075041209 10:119108186-119108208 AAAAAAACCCCAAAATAGGCTGG + Intronic
1075102205 10:119514360-119514382 GAAAAAAACCTGAAAAGGCCAGG + Intronic
1075302631 10:121338904-121338926 AAAGAAAACTCCAAAAAGCCAGG - Intergenic
1076660410 10:132052062-132052084 AAATAAAACCACAATTAGCCAGG + Intergenic
1077468460 11:2745388-2745410 GAAAAAATTCCAAAATAGCAGGG - Intronic
1077737308 11:4804807-4804829 AAAAAAAAACCCCATTAGCCAGG + Intronic
1078037883 11:7826562-7826584 GAAAAGTACACCAAATATCCAGG + Intergenic
1078096923 11:8304232-8304254 AAAAAAACCCCAAAATAGCCAGG + Intergenic
1079669250 11:23146071-23146093 GAACATATCCCTAAATAGCCAGG + Intergenic
1080038369 11:27732936-27732958 AAAAAAAAACACAATTAGCCAGG - Intergenic
1081035504 11:38139597-38139619 GAAAAAAGCCCCAAATAAATGGG - Intergenic
1081960908 11:47136545-47136567 GACAAAAACCCCAAATCTCCAGG - Intronic
1082045607 11:47723723-47723745 AAAAAAGACCAAAAATAGCCAGG - Intronic
1083493983 11:63034336-63034358 AAAAAAAATCCCAATTGGCCGGG - Intergenic
1083799792 11:65039998-65040020 CAAAAAAACCCCAAAAAGACAGG - Exonic
1084610269 11:70197789-70197811 AAAAAAAACAAAAAATAGCCGGG + Intergenic
1084968011 11:72754458-72754480 GAAAAAGAAAGCAAATAGCCTGG + Intronic
1085086120 11:73668563-73668585 CAAAAAAACAAAAAATAGCCGGG + Intergenic
1086109241 11:83180379-83180401 GAAAAAAAAAAAAAATAGCCGGG - Intronic
1086387005 11:86319396-86319418 AAAAAAAACACAAATTAGCCAGG - Intronic
1086479923 11:87223555-87223577 AAAAAAAACCCCAAAAAGTCTGG + Intronic
1086721147 11:90123138-90123160 GAAAAAAAAAAAAAATAGCCGGG - Intergenic
1087106686 11:94416547-94416569 TAAAAAAACACAAAATAGGCTGG + Exonic
1087361616 11:97167347-97167369 GAAAAATACAAAAAATAGCCGGG - Intergenic
1087420658 11:97921633-97921655 AAAAAATACACAAAATAGCCCGG + Intergenic
1089388347 11:118082716-118082738 AAAAAAAAACCCAAATTACCAGG + Intronic
1089809854 11:121122690-121122712 AAAAGAAAGCCAAAATAGCCAGG + Intronic
1089904659 11:122026102-122026124 AAAAAAAACCCCAAAGATCCAGG - Intergenic
1091468776 12:708749-708771 CAAAAAAAACACAACTAGCCAGG - Intergenic
1091758928 12:3074803-3074825 AACAAAAACCCCAATTAGCTGGG + Intergenic
1091805848 12:3355279-3355301 GAAGAAAACACCAGAGAGCCAGG - Intergenic
1092175390 12:6401539-6401561 AAAAAAAACCCAAATGAGCCAGG - Intergenic
1092393793 12:8106358-8106380 AAAAAAGAGCTCAAATAGCCAGG - Intergenic
1092502029 12:9057523-9057545 GAAAAAAACCCCAAACACATTGG + Intergenic
1092511534 12:9162120-9162142 GAAAAAAACAAAAATTAGCCAGG - Intronic
1092529476 12:9332571-9332593 AAAATAAACCTCAAAGAGCCAGG + Intergenic
1092857053 12:12684259-12684281 GACAAAATCTCCAAATTGCCTGG + Intronic
1092975012 12:13736322-13736344 CAAGACAACACCAAATAGCCAGG + Intronic
1093034987 12:14324432-14324454 GAAAATAAACCAAATTAGCCAGG - Intergenic
1093489435 12:19688146-19688168 GAAAAATACACAAATTAGCCAGG + Intronic
1093915795 12:24801389-24801411 GAAATAGACCTCAAGTAGCCTGG + Intergenic
1094073409 12:26445518-26445540 GAACAAAACCCCACGCAGCCAGG + Intronic
1094402478 12:30076890-30076912 GAAAATAACCCAAAATGGCATGG + Intergenic
1094414765 12:30204817-30204839 AAAAAAAACCCTAAATAACAGGG - Intergenic
1094461647 12:30702947-30702969 TAAAAAACCCCCAAACAGCTGGG + Intergenic
1094845057 12:34357841-34357863 GAAGAAAAACACAAATGGCCAGG - Intergenic
1095085694 12:38055806-38055828 GAAAAATACAACAATTAGCCGGG + Intergenic
1095134134 12:38577686-38577708 GATAAAAACCCTACATAACCGGG + Intergenic
1095566075 12:43624482-43624504 GAAATAAACCTCAAATATACAGG - Intergenic
1096273239 12:50183515-50183537 AAAAAAAATCCAAAATAGGCTGG + Intronic
1096449781 12:51728747-51728769 AAAAAAATTCCCAAATGGCCAGG + Intronic
1097205462 12:57317175-57317197 AAAAAAAAACACAAAAAGCCTGG - Intronic
1097487037 12:60215662-60215684 GAAAAAAACTCCAAGCAGACAGG - Intergenic
1097861556 12:64523243-64523265 GAAAAATACAAAAAATAGCCGGG + Intergenic
1098571566 12:71993371-71993393 GAAAAAAACACCAATTACCTAGG - Intronic
1098872098 12:75827511-75827533 GAAAACAAACCTAAATATCCTGG - Intergenic
1099072239 12:78059581-78059603 AAAAATATCCCCAAATAGGCGGG - Intronic
1099874837 12:88391811-88391833 AAAAAAATCCCCAAGCAGCCAGG - Intergenic
1100555693 12:95691554-95691576 TAAAAATACCACAATTAGCCAGG - Intronic
1101032396 12:100673083-100673105 GAAAAAAACCCCAAATCTTATGG - Intergenic
1102105010 12:110313869-110313891 AAAAAAAATACAAAATAGCCAGG - Intronic
1102267325 12:111498029-111498051 CAAAAAAACCCCAAAGAACTGGG + Intronic
1102312497 12:111857400-111857422 AATAAAACCCCAAAATAGCCAGG - Intronic
1102489254 12:113279070-113279092 GAAAAATACCCCAAATGTCTTGG - Intronic
1103332520 12:120164098-120164120 AACAAAAACCCCAAAAACCCTGG + Intronic
1103473184 12:121198588-121198610 CAAAAAAACCCAAACCAGCCGGG - Intergenic
1103712570 12:122923805-122923827 GAACAAAACCCTGAAGAGCCAGG + Intronic
1103783680 12:123416341-123416363 CAAAAAAACCCCAAAAAACCCGG + Intronic
1103982078 12:124743049-124743071 GAAATCAGCCCCAAATTGCCTGG + Intergenic
1104867501 12:131966741-131966763 TAAAAATACCACAATTAGCCGGG + Intronic
1104873068 12:132014548-132014570 GAAAAAAACACAAAAAACCCTGG + Intronic
1105246676 13:18658960-18658982 GTAAAAAACTCCAGATATCCAGG - Intergenic
1105399452 13:20075843-20075865 GAAAAAAAACCCAACTAGCCAGG - Intronic
1105425834 13:20294343-20294365 GAAAAAAATCACAAATAGAAAGG + Intergenic
1105548557 13:21370202-21370224 AAAAAAAACCAAAATTAGCCGGG + Intergenic
1105983040 13:25538294-25538316 GAAAAAAACCCCAAATAGCCAGG - Intronic
1106100492 13:26691499-26691521 CAAATAAACTCCAAACAGCCTGG - Intergenic
1106280079 13:28259286-28259308 AAAAAAAACACAAATTAGCCAGG - Intronic
1107045682 13:35989698-35989720 AAAAAAAAAGCCAATTAGCCAGG - Intronic
1108785138 13:53891380-53891402 AAAAAAAAGGCCACATAGCCAGG - Intergenic
1108943085 13:55983049-55983071 AAAAAAAACAACAATTAGCCGGG - Intergenic
1109689312 13:65865154-65865176 AAAAAAAACACCATATAGACAGG + Intergenic
1109945389 13:69424769-69424791 GAAGAAATCTCCAAATTGCCAGG + Intergenic
1110030298 13:70602961-70602983 AAAAAAAACCCCAAAAAACCTGG + Intergenic
1110417769 13:75270588-75270610 TAAAAATACAACAAATAGCCGGG - Intergenic
1110460711 13:75742394-75742416 CCAAAAAAGCCCCAATAGCCAGG + Intronic
1111093171 13:83474026-83474048 ACAAAAGATCCCAAATAGCCAGG + Intergenic
1112268103 13:97944113-97944135 TAAAAATACCGCAATTAGCCAGG - Intergenic
1114045083 14:18868152-18868174 AAAAAAAAAGCCAAATAGGCTGG + Intergenic
1114119128 14:19651316-19651338 AAAAAAAAAGCCAAATAGGCTGG - Intergenic
1114201704 14:20527077-20527099 GAAAAATACAAAAAATAGCCTGG - Intergenic
1115188898 14:30725154-30725176 AAAAAAGAGCCAAAATAGCCAGG - Intronic
1115259928 14:31441351-31441373 CAAAAAAAACCAAATTAGCCAGG + Intronic
1115312788 14:31996110-31996132 AAAAAAAACCACAAAGAGGCCGG - Intergenic
1115440458 14:33428967-33428989 GAAAAGAAACCAAAATAGCGAGG + Intronic
1115484065 14:33892695-33892717 GAAAAAAAAAAAAAATAGCCTGG + Intergenic
1116603065 14:46952521-46952543 TAAATAAACTCCAAATAACCAGG - Intronic
1117087824 14:52219681-52219703 AAAAAATACCACAATTAGCCAGG - Intergenic
1117483512 14:56171853-56171875 TAAAAATACCCAAAATAGCTGGG + Intronic
1117916894 14:60687281-60687303 GAAAAAAACCACAACTAATCAGG + Intergenic
1117977835 14:61316042-61316064 GAAAAAAACAGTAAATAGGCTGG - Intronic
1118138639 14:63055394-63055416 AAAAAAAAAACCAATTAGCCGGG - Intronic
1118195569 14:63622604-63622626 CAAAAAAACCAAAAGTAGCCAGG + Intronic
1119343306 14:73899897-73899919 TAAAATCACCCCAAATAGGCTGG + Intronic
1119387763 14:74268495-74268517 AAAAAATACCAAAAATAGCCGGG + Intergenic
1120363946 14:83541703-83541725 AAAAAAAACCCAAAAAGGCCAGG + Intergenic
1121468420 14:94130953-94130975 AAAAAAAACACCAAAAAGGCAGG - Intergenic
1122464611 14:101922656-101922678 GAAAAAAAAAAAAAATAGCCAGG + Intronic
1122625558 14:103083878-103083900 AAAAAAAAACCCAAACTGCCGGG - Intergenic
1122692893 14:103539459-103539481 GAAACAAGCCCCCAAAAGCCTGG - Intergenic
1124032361 15:26023100-26023122 AAACAAAACCCAAATTAGCCGGG - Intergenic
1124354915 15:28987916-28987938 TAAAAATACCCAAATTAGCCAGG - Intronic
1124446832 15:29742100-29742122 CCAGAAAACCCAAAATAGCCAGG + Intronic
1124905733 15:33866924-33866946 GAAAAAAAAACCAACTAGCAAGG - Intronic
1125247900 15:37662546-37662568 AAATAAAAGCCCAAATAGCCAGG - Intergenic
1125557769 15:40600368-40600390 TATAAAAATCCCAAATAGCCGGG - Intronic
1125866946 15:43060949-43060971 AAAAAAAAGCACAAAAAGCCAGG + Intronic
1126399423 15:48254623-48254645 AAAAAAAACCCAAAAAAGACCGG + Intronic
1126414597 15:48404662-48404684 AAAAAATACCCAAATTAGCCAGG - Intergenic
1126638717 15:50803933-50803955 GGAAAAAACGCCAAATATACAGG - Intergenic
1127103719 15:55591350-55591372 TAAAAACACACCAAAAAGCCAGG + Intergenic
1127664121 15:61128270-61128292 GAAAAAAACAGCAAATTGACCGG + Intronic
1127807284 15:62533091-62533113 GAAAAATACAAAAAATAGCCAGG + Intronic
1128029496 15:64467283-64467305 GAAAAAAACCCCAAAGAAGTTGG - Intronic
1129006365 15:72376686-72376708 AGACAAAACCCCACATAGCCCGG + Intergenic
1129557031 15:76521393-76521415 AAAAAAAACCCCAAATAATTAGG + Intronic
1130315589 15:82792881-82792903 GAAAAAAACCCCAAAACTACAGG - Intronic
1131632659 15:94195711-94195733 GAGAAAGACCCCAAATAGTCTGG - Intergenic
1132079089 15:98849918-98849940 GAAAACAACCCCACATGGCTGGG + Intronic
1132233754 15:100203736-100203758 AAAAAACACCCAAATTAGCCAGG + Intronic
1132753665 16:1471291-1471313 GCAACAAACCCTAAAGAGCCTGG + Intronic
1133079558 16:3307672-3307694 GAAAAAAAAAAAAAATAGCCAGG - Intronic
1133282507 16:4675131-4675153 TAAAAATACACAAAATAGCCGGG - Intronic
1133290814 16:4719837-4719859 AAAAAGAAACCCAAATGGCCAGG + Intronic
1133606651 16:7394073-7394095 GAAAAATACCAAAATTAGCCGGG + Intronic
1134125710 16:11614594-11614616 AAAAAAAACCAGAAAAAGCCTGG - Intronic
1134269686 16:12722771-12722793 GAAAGAAACCCCTGAAAGCCAGG - Intronic
1134417603 16:14058001-14058023 GAAATAAACCCAGAATACCCCGG + Intergenic
1134755448 16:16663386-16663408 GAAAAAAACCCAAATTACCTGGG + Intergenic
1134990618 16:18695784-18695806 GAAAAAAACCCAAATTACCTGGG - Intergenic
1135111532 16:19694127-19694149 GACAGACACCCCAAATACCCTGG + Intronic
1135191114 16:20355573-20355595 AAAAAAAACACAAATTAGCCGGG - Intronic
1135702523 16:24644587-24644609 AAAAAAAAACCAAATTAGCCTGG - Intergenic
1136449277 16:30343576-30343598 AAAAAAAACCACAAAGTGCCGGG - Intergenic
1136797039 16:33028861-33028883 GCAAAAAGCCGCAAAAAGCCGGG + Intergenic
1137991907 16:53165726-53165748 AAAAAAAACAGCAAATAGCTTGG - Intronic
1138056956 16:53845204-53845226 GAGATAAACCCCAAATAATCAGG - Intronic
1138178071 16:54921042-54921064 GAAAAAAACCACTAAAAGCAGGG + Intergenic
1138579927 16:57934017-57934039 GAAAAAAACCCCATATCGGCTGG - Intronic
1138884132 16:61054331-61054353 GAAAAATACAAGAAATAGCCAGG + Intergenic
1138940222 16:61781458-61781480 AAAAAAAACTACAATTAGCCAGG + Intronic
1139553825 16:67693272-67693294 AAAAAAAAACCCAAAAAGCCAGG - Intronic
1140149525 16:72348190-72348212 TAAAAATACCCAAATTAGCCAGG + Intergenic
1141059710 16:80854495-80854517 TAAAAACACACCAATTAGCCAGG + Intergenic
1141356066 16:83348027-83348049 GAAAAAAACAAAAATTAGCCGGG + Intronic
1141576228 16:84965115-84965137 TTAAAAAACCCCAAAGACCCTGG + Intergenic
1141642934 16:85352006-85352028 AAAAAAAAACCCAAATAGACTGG + Intergenic
1141721311 16:85757029-85757051 AAAAAAAACCCCCAAAAGACTGG + Intergenic
1142971081 17:3611962-3611984 TAAAAATACCACAATTAGCCAGG - Intronic
1143214985 17:5218184-5218206 GAAAAATACCAAAATTAGCCAGG - Intronic
1143879564 17:10019670-10019692 GAAAAAACCCCCAAACAGAGAGG + Intronic
1144842965 17:18199803-18199825 AAAAAAAACCCCAAAAACCCAGG + Intronic
1144868951 17:18356494-18356516 GAAAAATACACAAATTAGCCAGG - Intronic
1144943528 17:18958066-18958088 GAAAAAAACAACAAATATCTTGG - Intronic
1145876232 17:28320066-28320088 GAAAAAAACCTCAACGAACCGGG - Intronic
1145953482 17:28838282-28838304 CAAAAAAACAACAAATAGGCCGG + Intronic
1146071244 17:29683782-29683804 AAAAAAAAGACCAAATAGCTGGG + Intronic
1146096516 17:29935396-29935418 AAAAAATACCACAATTAGCCAGG + Intronic
1146666174 17:34705451-34705473 GAAAAATACAAAAAATAGCCAGG + Intergenic
1147017775 17:37506298-37506320 CAAAAAAACCCAAAAAACCCTGG + Intronic
1147118128 17:38317866-38317888 TAAAAAAACACAAAACAGCCGGG - Intronic
1147300435 17:39522089-39522111 AAAAAAAACCCCAAAAAACTGGG - Intronic
1147646722 17:42038625-42038647 GAAAAAAGCCCCAGATGGGCTGG - Intronic
1147806836 17:43137888-43137910 AACAAAAACCCAAAATAGGCCGG + Intergenic
1147833569 17:43314353-43314375 AAAAAAAAAAACAAATAGCCAGG - Intergenic
1148648408 17:49232226-49232248 GAAAAAAAAAAAAAATAGCCAGG + Intergenic
1148806865 17:50268309-50268331 GGAAAACACCTCAAAGAGCCTGG - Intergenic
1149381088 17:56094662-56094684 AAAAAAAAACCCAATTAGCTGGG - Intergenic
1150015490 17:61552627-61552649 TAAAAAAATACAAAATAGCCAGG - Intergenic
1152696047 17:81796095-81796117 AAAAAAAATACAAAATAGCCAGG - Intergenic
1152761837 17:82112491-82112513 GAAGAAAACTCCACAAAGCCAGG - Intronic
1153531275 18:6048795-6048817 AAAAAAAATCCCAAACAGCATGG + Intronic
1154253481 18:12763867-12763889 AAGAAAAAACCCAAATAGCACGG - Intergenic
1154348492 18:13564064-13564086 CAAAAAAACCACAATTATCCAGG - Intronic
1154458437 18:14552897-14552919 CAAAAAAACCCCAAAAAAACAGG + Intergenic
1154987023 18:21562313-21562335 TAAAAATACAACAAATAGCCAGG + Intronic
1155475273 18:26231331-26231353 AAAAAAAACCCCAAGCAGCTGGG - Intronic
1155927837 18:31676742-31676764 GAAAAATACCCCAAATGGTGGGG - Intronic
1156744243 18:40369943-40369965 GAAAAATACAACAATTAGCCGGG - Intergenic
1157232111 18:45927191-45927213 GAAAAAAAAACAAATTAGCCGGG - Intronic
1157235583 18:45962053-45962075 AGAAAAAACCCCAAAGAACCTGG - Intronic
1157445410 18:47742940-47742962 AAAAAGTATCCCAAATAGCCTGG - Intergenic
1157548237 18:48563024-48563046 GCAAATGACCCCACATAGCCTGG + Intronic
1157883004 18:51340104-51340126 GAAAAAAATCATAAATTGCCAGG + Intergenic
1158178369 18:54683753-54683775 GAGAGAAACTCCAAAAAGCCAGG + Intergenic
1158279904 18:55813237-55813259 TTAAAAAACACCAACTAGCCAGG - Intergenic
1159271355 18:66155787-66155809 GAAAAAAACAAAAATTAGCCGGG + Intergenic
1160275246 18:77426567-77426589 AAAAAAGAGCCCAAATAGCCAGG - Intergenic
1160463454 18:79056623-79056645 TAAAAGAAACCCACATAGCCAGG - Intergenic
1160470516 18:79128570-79128592 AAAAAAACCCCCAAATGGCCCGG + Intronic
1160558139 18:79739391-79739413 AAAAAAAACCACAAAAACCCAGG - Intronic
1161271486 19:3392230-3392252 TAAAAATACCACAATTAGCCGGG - Intronic
1162177520 19:8842163-8842185 TACAAAAACCACAAACAGCCAGG + Intronic
1162570630 19:11470192-11470214 TAAAAATACCACAATTAGCCAGG + Intronic
1162626455 19:11888536-11888558 AAAAACAACCCCAAGAAGCCTGG + Intronic
1162920782 19:13901270-13901292 AAAAACACCCCAAAATAGCCAGG - Intronic
1163048577 19:14663676-14663698 TAAAAATACCAAAAATAGCCAGG + Intronic
1163099648 19:15087012-15087034 GAGAAAAACCACACAGAGCCAGG - Exonic
1163260443 19:16186426-16186448 GAAAAATACCAAAATTAGCCAGG - Intronic
1163562599 19:18029105-18029127 AAAAAAAACCCAAACTAGCTGGG + Intergenic
1163763342 19:19148870-19148892 TAAAAATACCCAAATTAGCCAGG - Intronic
1163771939 19:19196567-19196589 AAAAAAAAACCCCAATAGCTGGG + Intronic
1163994335 19:21028977-21028999 GAAAAAAACACAGAATTGCCAGG - Intronic
1164072001 19:21776896-21776918 TAAAAATACCACAATTAGCCAGG + Intergenic
1164072029 19:21777029-21777051 TAAAAATACCACAATTAGCCAGG + Intergenic
1164421250 19:28095164-28095186 AAAAAGAACCACATATAGCCAGG + Intergenic
1165177474 19:33940738-33940760 TAAAAAAACCCCGACTAGGCTGG - Intergenic
1165781873 19:38439492-38439514 AAACAAAACCAAAAATAGCCGGG - Intronic
1165967940 19:39600061-39600083 CAAAAAAATGCCAAATAACCGGG + Intergenic
1166129043 19:40734767-40734789 AAAAAAAACAACAATTAGCCAGG - Intronic
1166187583 19:41151561-41151583 AAAAAAAAGCCCAACCAGCCGGG + Intergenic
1166537947 19:43587167-43587189 GAAAAATACCAAAATTAGCCAGG + Exonic
1166656295 19:44614408-44614430 AACAAAAACCCCAAACAGGCTGG - Intronic
1166793508 19:45412153-45412175 AAAAAAAACCAAAAATAGGCCGG - Intronic
1167330353 19:48852044-48852066 AAAAAAAACCCCAAAGGGCATGG + Intronic
1167475747 19:49700084-49700106 AAAAATAACAACAAATAGCCGGG + Intronic
1167813872 19:51861276-51861298 AAAAAAAAAAACAAATAGCCAGG - Intronic
1167850455 19:52197377-52197399 GAGAAAAACCAAAAAAAGCCGGG + Intronic
1167931584 19:52870183-52870205 GAAAAATACTTAAAATAGCCAGG + Intronic
1202669578 1_KI270709v1_random:39287-39309 GCAAAAAGCCGCAAAAAGCCGGG - Intergenic
1202669614 1_KI270709v1_random:39428-39450 GCAAAAAGCCGCAAAAAGCCAGG - Intergenic
925064090 2:915434-915456 GTAAAAACCCCCAAATGGCAAGG - Intergenic
925480121 2:4261319-4261341 GGAAAAAAACACAAAAAGCCAGG + Intergenic
925734529 2:6949677-6949699 GAAAGAACACACAAATAGCCTGG - Intronic
926611502 2:14952594-14952616 GAAAAACGCCCCAAACAGGCTGG - Intergenic
926922964 2:17957718-17957740 GAAAGAAACCTCATCTAGCCGGG + Intronic
927200680 2:20576275-20576297 GAAAGAAACCTCACATAGCCGGG - Intronic
927500167 2:23577288-23577310 TAAAAATACACGAAATAGCCGGG + Intronic
927728340 2:25446395-25446417 AAAAAAAAACAAAAATAGCCAGG - Intronic
927759407 2:25738951-25738973 GAAAGTAAAGCCAAATAGCCTGG - Intronic
927961034 2:27240841-27240863 GAAAGAAACCCCATATTCCCAGG - Intronic
928544044 2:32312694-32312716 AAAAAAGACCCCCAATAGGCCGG + Exonic
928847479 2:35694773-35694795 GATAAAAACCCCAAAAAACTAGG - Intergenic
928946371 2:36775494-36775516 GAAACAAACCCAAAATTGTCAGG - Intronic
929209931 2:39344903-39344925 GAAATAAACCCAGAATAGGCTGG + Intronic
929236521 2:39610832-39610854 GAAAAATACCAAAATTAGCCAGG - Intergenic
929505424 2:42524459-42524481 AAAAAAAAACACAACTAGCCAGG - Intronic
929861575 2:45682745-45682767 TAAAAATACCAAAAATAGCCAGG - Intronic
930226542 2:48800008-48800030 AAAAAAAAACCCAAATACTCTGG + Intergenic
930586373 2:53271960-53271982 AAAAAAGAGCACAAATAGCCAGG + Intergenic
931290675 2:60870441-60870463 AAAAAAAAACAAAAATAGCCAGG - Intergenic
931727577 2:65126345-65126367 AAAAAAAAACACAAACAGCCAGG + Intronic
931737164 2:65206456-65206478 AAAAAAAACTAAAAATAGCCAGG + Intergenic
932323647 2:70839836-70839858 GAAAAAAACCCACCATAGGCTGG + Intergenic
933247661 2:79994066-79994088 AAAAAAACCCCAAAATAGCTAGG - Intronic
933333759 2:80927975-80927997 GAAAAAAACCACAAAATTCCTGG + Intergenic
933647191 2:84822333-84822355 GAATAAAGAGCCAAATAGCCAGG - Intronic
933732117 2:85464944-85464966 TAAAAATACCCAAATTAGCCGGG - Intergenic
933770181 2:85738787-85738809 GGAAACAACCCCAAATATCAGGG + Intergenic
933817282 2:86078318-86078340 GAAAAAAGCTCCAAAAGGCCTGG + Intronic
934159578 2:89235572-89235594 GAAAAAAACAACAAAAATCCTGG + Intergenic
934207700 2:89946859-89946881 GAAAAAAACAACAAAAATCCTGG - Intergenic
934251693 2:90360510-90360532 GCAAAAAGCCGCAAAAAGCCGGG + Intergenic
934257742 2:91442433-91442455 GCAAAAAGCCGCAAAAAGCCGGG - Intergenic
935118965 2:100163721-100163743 AAAAAAAACCCCACATACCTAGG + Intergenic
935681808 2:105644861-105644883 GTAATAAACCCCAAACAGACAGG + Intergenic
935932397 2:108142102-108142124 AAAAAAAAGCCCAAATAGCCAGG + Intergenic
935965327 2:108467091-108467113 GTAAAAAACCAAGAATAGCCAGG - Intronic
936171266 2:110177901-110177923 CAAAAAAACCCAAACTAGTCAGG - Intronic
937306650 2:120875759-120875781 CAACAAAACGCCAAAGAGCCAGG + Intronic
938252465 2:129826581-129826603 TAAAAATACCACAATTAGCCAGG + Intergenic
939740554 2:145901173-145901195 GTAATAAACCCCAAATATCAAGG + Intergenic
939837038 2:147142527-147142549 GAATATCACACCAAATAGCCAGG - Intergenic
939982584 2:148798973-148798995 AAAAAACACCCCAAATACCCAGG + Intergenic
940054572 2:149500264-149500286 AAAAAAAACCGCAGATAGCTCGG + Intergenic
940126362 2:150330326-150330348 CAAAAAGACACCAAATAGGCAGG + Intergenic
940166701 2:150781648-150781670 GAAAAATACCAAAATTAGCCAGG - Intergenic
940642541 2:156361411-156361433 GAAAAAAGCCCCAATGAGCCAGG - Intergenic
943427568 2:187754938-187754960 GATAAAAACCCAAAAAAGCTGGG - Intergenic
943573873 2:189607667-189607689 TAAAAAATCCAAAAATAGCCAGG - Intergenic
944491767 2:200265185-200265207 GAAAAAAACTCCACATTTCCTGG + Intergenic
944679329 2:202062609-202062631 GAAAAAAACCACATATGGCCAGG - Intergenic
944687265 2:202128424-202128446 AAAAAAACCCCCAAAAAGACAGG - Intronic
944857141 2:203778925-203778947 AAAAAAAACCCCAAAAACCTGGG + Intergenic
944997001 2:205304782-205304804 GAAAAAAACACAAATTAGCTGGG + Intronic
945086219 2:206135177-206135199 CAAAAAAACCCCAATTTGCTTGG - Intronic
945523598 2:210860582-210860604 GAAAAAAACCCCACATATCGGGG + Intergenic
945838357 2:214858850-214858872 AAAAAAAACCCCACATGGCCAGG - Intergenic
946019193 2:216628769-216628791 GAAAAATACAACAATTAGCCAGG + Intergenic
946617099 2:221522013-221522035 ACAAAAAACCCAAAATAGGCCGG + Intronic
946738531 2:222778250-222778272 ATAAAAAACCAAAAATAGCCAGG + Intergenic
946820814 2:223627463-223627485 GAAGAAATCCCCAAATAGGTAGG + Intergenic
947050870 2:226041447-226041469 GAAAAAAACCTCAAATTACCTGG - Intergenic
947582266 2:231327943-231327965 GAAAAAAACAAAAATTAGCCAGG - Intronic
948109466 2:235443032-235443054 GAAAAAAACCCCAGTAAACCTGG - Intergenic
948176561 2:235948155-235948177 AAAAAAAACCCCAGAAAACCTGG - Intronic
948219232 2:236256185-236256207 AAAAAATACACCAATTAGCCTGG - Intronic
1169310199 20:4531638-4531660 TAAAAATACCAAAAATAGCCAGG + Intergenic
1169534730 20:6525717-6525739 GAAAACAACCACACATAGCAGGG - Intergenic
1170306305 20:14941942-14941964 GAAAAAAAAAAAAAATAGCCGGG - Intronic
1171054878 20:21896642-21896664 GAAGAAAACCCTAAATGGCAAGG - Intergenic
1171161949 20:22934059-22934081 GAAAAAACACACAATTAGCCGGG - Intergenic
1171206465 20:23285395-23285417 AAAAAAGACCCTGAATAGCCAGG - Intergenic
1171241565 20:23571688-23571710 ACAAAAGACCTCAAATAGCCAGG - Intergenic
1171537571 20:25909343-25909365 AAAAAAAACCAAAATTAGCCGGG + Intergenic
1172044359 20:32069809-32069831 GAAAAAAACCCCAAACTCCTAGG - Intronic
1172049625 20:32106892-32106914 GCAAAAAATCCCAAATAACCTGG - Intergenic
1173517132 20:43672579-43672601 CAAAAAAATACAAAATAGCCAGG + Intronic
1173522277 20:43709139-43709161 GAGAAACACCCCAGGTAGCCAGG - Intronic
1174084540 20:47996950-47996972 GTAAAAGACCCAGAATAGCCAGG - Intergenic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1174837674 20:53873623-53873645 GAAAAAAAACCCAAAAAAACAGG + Intergenic
1175861952 20:62155250-62155272 CAAAAAAAACCCATTTAGCCAGG + Intronic
1176007060 20:62871362-62871384 GAAAAATACAAAAAATAGCCAGG - Intergenic
1176415798 21:6474129-6474151 GAAAAACACAACAATTAGCCAGG - Intergenic
1177677539 21:24321120-24321142 GAAAGAAACCCCAAAGAGTTGGG - Intergenic
1178544735 21:33483349-33483371 AAAAAAAACCACACATGGCCGGG + Intergenic
1178954485 21:37010195-37010217 GAATAAAACCTCAAGTAGGCCGG + Intronic
1179691298 21:43082463-43082485 GAAAAACACAACAATTAGCCAGG - Intergenic
1180463613 22:15590767-15590789 AAAAAAAAAGCCAAATAGGCTGG + Intergenic
1180685387 22:17662315-17662337 GAAAAAAACAAAAATTAGCCAGG + Intronic
1181406851 22:22690889-22690911 GAAAAAAAGCCCAACAAACCTGG - Intergenic
1181476438 22:23170570-23170592 GAAAAAAAAACAAATTAGCCGGG + Intergenic
1181661622 22:24354599-24354621 GAAAAAAAACCAAGATAGGCTGG - Intronic
1181771446 22:25128646-25128668 ACAGAAAAGCCCAAATAGCCTGG - Intronic
1182635414 22:31722681-31722703 GAAAAAAAACAAAATTAGCCAGG - Intronic
1183454542 22:37914960-37914982 GAAAAAAAGAAAAAATAGCCGGG + Intronic
1183696066 22:39423131-39423153 GAAAACAACCAAAATTAGCCAGG - Intronic
1185264117 22:49889448-49889470 AAAAAAAACCCCATAAAGGCAGG - Exonic
949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG + Intergenic
950279841 3:11697259-11697281 AAAAAAAACCACAATTAGCTGGG - Intronic
950868335 3:16207580-16207602 GCAAATAACCCAAAATAGTCAGG + Intronic
950991995 3:17449326-17449348 GAAAAAAACTCCTACTAGCTTGG - Intronic
951233481 3:20207156-20207178 AAAAAAGAGCCCCAATAGCCAGG - Intergenic
951430907 3:22605947-22605969 GAAAAAAACCCCAACAATTCAGG - Intergenic
951897241 3:27621573-27621595 CAAAAAGAGCCCAAATAGCCGGG - Intergenic
952069811 3:29620777-29620799 GAAAAAATTTCAAAATAGCCAGG - Intronic
953364441 3:42331067-42331089 AAAAAAACCCAAAAATAGCCAGG + Intergenic
953496550 3:43392548-43392570 TAAAAACAACCTAAATAGCCTGG - Intronic
954011408 3:47642743-47642765 GAAAAAAACCTGAAATTTCCAGG + Intronic
955152245 3:56379347-56379369 GAAAAAAAACCAAAATAACCTGG + Intronic
955478305 3:59362454-59362476 GAAAAATACAACAATTAGCCAGG + Intergenic
955993830 3:64657497-64657519 AAAAAAAAAACCAATTAGCCAGG - Intronic
956521226 3:70106499-70106521 GAAAAAAAAAAAAAATAGCCAGG - Intergenic
956689966 3:71867118-71867140 GAAAAAAACCCCAAAACTCTTGG + Intergenic
957675911 3:83364366-83364388 TGAAATAACCCCAAATAGGCCGG + Intergenic
958415903 3:93872397-93872419 AAAAAAAACTCCAAATAACAGGG - Intergenic
958548388 3:95587258-95587280 GACAAAGACCCAAAATAGGCTGG - Intergenic
958792165 3:98664319-98664341 TAAAAATACCCAAATTAGCCAGG - Intergenic
958971292 3:100613048-100613070 TAAAAATACACAAAATAGCCAGG - Intronic
959060128 3:101609030-101609052 AAAAAAAACCACAAATGGCTGGG + Intergenic
959072989 3:101720493-101720515 AAAAAAAACCAAAATTAGCCAGG + Intergenic
959346017 3:105195565-105195587 GAAAAAAAACACATATACCCAGG + Intergenic
959957657 3:112257219-112257241 CAAAAAGAGCCCAAATAGCCAGG + Intronic
960017125 3:112904009-112904031 TAAAAAAAGCTCATATAGCCAGG - Intergenic
960434398 3:117607831-117607853 GAAAAATACAACAATTAGCCGGG + Intergenic
960836518 3:121912392-121912414 GAAAAATACACAAATTAGCCGGG - Intronic
961065538 3:123872315-123872337 GAAAAAAACTCCACATAGCTGGG - Intronic
961217695 3:125173467-125173489 AAAAAAAAACCAAAATAACCTGG + Intronic
961250467 3:125500083-125500105 AAAAAAAAACCCAAAAAGGCAGG + Intronic
961857480 3:129886955-129886977 AAAAAAAACCCCAAAAGGCCAGG + Intronic
962690299 3:137890016-137890038 CAAGAAAACATCAAATAGCCTGG - Intergenic
962893956 3:139697619-139697641 GACATATACCCCAAATAGCAAGG + Intergenic
963853650 3:150232519-150232541 AAAAAAAATGCCAAATAGTCTGG - Intergenic
964555200 3:157929441-157929463 AAAAAAAACCCAAAACAGCCAGG - Intergenic
965040742 3:163503523-163503545 GCAGAAATCCTCAAATAGCCGGG + Intergenic
965559185 3:170045438-170045460 AAAAAAAAAACCAATTAGCCAGG + Intronic
965871837 3:173274516-173274538 TAAAAATACCAAAAATAGCCAGG + Intergenic
966173584 3:177111431-177111453 TAAAAATACCCAAATTAGCCTGG - Intronic
966251474 3:177870290-177870312 GAAAAAGAGCCCATATGGCCAGG + Intergenic
966534626 3:181017626-181017648 GAAAAAAATGACAAGTAGCCAGG - Intergenic
966793923 3:183696766-183696788 TAAAAAAACCAAAATTAGCCTGG + Intergenic
967495207 3:190135976-190135998 AAAAAAAACCCTTAATGGCCGGG + Intergenic
967683099 3:192388098-192388120 GAAAATTAAACCAAATAGCCAGG + Intronic
968088872 3:195887168-195887190 GAAATCAACCCCAACTAACCCGG + Intronic
968197010 3:196714754-196714776 AAAAAAAAGAACAAATAGCCTGG - Intronic
968356569 3:198112329-198112351 AAAAAAAAACAAAAATAGCCAGG - Intergenic
968768964 4:2491443-2491465 AAAAACAAACCAAAATAGCCTGG - Intronic
969343967 4:6559863-6559885 TAACAAAACACCATATAGCCTGG - Intronic
969410850 4:7027210-7027232 CAAAAAAACCCCAAAAAAGCAGG + Intronic
971321520 4:25609727-25609749 AAAAAAAACCCCAAAAAACAGGG - Intergenic
971406602 4:26326991-26327013 GAAATAGACCCCAAAAAGCTGGG - Intronic
972117326 4:35652653-35652675 GAAAAACACACAAAATAGCTGGG - Intergenic
972197984 4:36677111-36677133 GAAAACAACCCTAAATAGAGTGG + Intergenic
972359680 4:38315453-38315475 GAAAAAAACCACAGAGAGCCTGG - Intergenic
972603147 4:40590404-40590426 CAAAAAAACCCCACAAAGACTGG + Intronic
973218218 4:47695909-47695931 GAAAAACACCCCAAATCCCAAGG + Intronic
973341427 4:49008945-49008967 AAAAAAGAGCCCACATAGCCAGG - Intronic
974022427 4:56703720-56703742 GCAAAAAGCCCCGAAGAGCCTGG - Intergenic
974060929 4:57034793-57034815 GAAAAAAAATGCAAAAAGCCAGG - Intronic
974460435 4:62180232-62180254 CAAAAAAACAACAAATACCCAGG + Intergenic
975215115 4:71744296-71744318 AAAAAAAACCCAAATTAGCTGGG + Intronic
975624994 4:76337139-76337161 AAAAAAACCCAAAAATAGCCGGG - Intronic
976015940 4:80554460-80554482 CAAAAAGAGCCCAAATAGCCAGG - Intronic
976120806 4:81779045-81779067 GAAAAAGAGCCCATATAGCCAGG - Intronic
976183094 4:82417770-82417792 GGCGAAAACCCAAAATAGCCAGG - Intergenic
976324019 4:83750512-83750534 GAAAAAAACAAAAATTAGCCAGG + Intergenic
976506583 4:85853972-85853994 AAAAAAAACCCCAATTAGCCGGG + Intronic
976825247 4:89253740-89253762 GAAGAAAAGCCCAAATTGCTTGG + Intronic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
977672786 4:99715401-99715423 GCAATAGGCCCCAAATAGCCAGG - Intergenic
978038559 4:104028174-104028196 GAAAAAAATCCAAAATATACAGG + Intergenic
978790627 4:112660066-112660088 GAAAAAAACCCCAAATGGCCAGG + Intergenic
979189851 4:117842937-117842959 GAAAAATACAAAAAATAGCCGGG + Intergenic
979617111 4:122755834-122755856 GAAGTAAACCACAAATAGCATGG - Intergenic
980059071 4:128109629-128109651 GAAAAAAACCCAACATTGTCAGG - Intronic
980828973 4:138106690-138106712 GAAAAAAAAAACAACTAGCCGGG + Intergenic
981106526 4:140887995-140888017 GATAAAAACCTTAAATAGACTGG - Intronic
981631462 4:146823571-146823593 AAAGAAGACCCCATATAGCCAGG - Intronic
981744633 4:148040500-148040522 GAAAAATACAAAAAATAGCCAGG - Intronic
982543406 4:156704634-156704656 TAAAAATACCCAAATTAGCCAGG + Intergenic
982614100 4:157618173-157618195 GAAAAAAAACAAAAATAGCCAGG + Intergenic
983468161 4:168122001-168122023 GAAAAATACCAAAAGTAGCCGGG - Intronic
986117929 5:4798593-4798615 AAAAAAAACCCAAAATAGCTGGG - Intergenic
986240819 5:5958203-5958225 TAAAAAGACCCTACATAGCCAGG + Intergenic
986357126 5:6939744-6939766 AAAAAAAACAACAATTAGCCGGG - Intergenic
986496537 5:8347374-8347396 AAAAAAGAGCCCAAATAACCAGG + Intergenic
986819423 5:11448827-11448849 AAAAAAAAACACAAAAAGCCAGG - Intronic
987223253 5:15812601-15812623 AAAAAAGACCCCGGATAGCCAGG - Intronic
987811079 5:22837121-22837143 TAAAATAATCCCAAATAGGCAGG + Intronic
988545247 5:32150422-32150444 GAAAAAAAAAAAAAATAGCCAGG + Intronic
988566313 5:32322212-32322234 GAAAAATACAAAAAATAGCCAGG + Intergenic
989670338 5:43909425-43909447 GAAAAACACCTCATATAGGCAGG + Intergenic
989789478 5:45379477-45379499 GAAATAAAACACAAATAGCCTGG + Intronic
989943751 5:50190465-50190487 GAAAAGAGCTCCAAATGGCCGGG + Intergenic
990089623 5:52025936-52025958 CAAGAAAAACTCAAATAGCCAGG + Intronic
990229720 5:53699664-53699686 AAAACAAACCCCAAATAGTGAGG + Intergenic
990259452 5:54005876-54005898 AAAAAAACCCAAAAATAGCCAGG + Intronic
990449507 5:55921490-55921512 GAAAACAGCCCCAAAGAGACAGG - Intronic
990601106 5:57359503-57359525 GAAAAACAAACAAAATAGCCTGG + Intergenic
992643589 5:78791854-78791876 GAAAAAAGCCCCTAACAGCTGGG + Intronic
992935121 5:81695013-81695035 GAAACAAAACTCAAATAACCAGG + Intronic
993205810 5:84876974-84876996 TAAAAAACCCCCAAATAACTGGG + Intergenic
993840408 5:92870944-92870966 TAAAGAAATCCCAAACAGCCAGG - Intergenic
994119258 5:96095410-96095432 GAAAAAAAAAACAATTAGCCAGG + Intergenic
994148125 5:96417414-96417436 GAAAAAAATCACAAAAAGTCAGG - Intronic
994289518 5:98012045-98012067 TAAAACCACCCCTAATAGCCAGG - Intergenic
994815364 5:104579932-104579954 GAAAAAAACCTTAAAAAGCAGGG + Intergenic
996139622 5:119890101-119890123 GAAAAAAACCCCAACAACCCCGG + Intergenic
996317558 5:122177637-122177659 TAAAAAAATCCCCACTAGCCTGG - Intronic
996324482 5:122257521-122257543 AAAAAAAAACCCAAACAGGCTGG - Intergenic
996716752 5:126594603-126594625 AAAAAAAATACAAAATAGCCGGG - Intronic
997145550 5:131429135-131429157 AAAGAAATCCCCAAATATCCTGG + Exonic
997447663 5:133953260-133953282 GAGAACCACCCCAAATATCCTGG + Intergenic
997494778 5:134313732-134313754 AAAAAAAACCCCACATAACATGG - Intronic
997945621 5:138198118-138198140 GAAAATAACCACAATTAGCTAGG - Intronic
998829205 5:146139180-146139202 GAAAAAAACAAAAATTAGCCGGG + Intronic
998897974 5:146820589-146820611 GAAAATATCCCCAAACAGCATGG - Intronic
998941063 5:147282379-147282401 GAAAAAAACCCAAAGTACACAGG + Intronic
999649714 5:153753707-153753729 AAAAAAATCCTCAAATACCCAGG + Intronic
999791685 5:154945697-154945719 GAAGAAAACCCCAAGTGTCCTGG + Intronic
999982442 5:156970736-156970758 AAAAAATACAACAAATAGCCAGG + Intergenic
1000320469 5:160130479-160130501 GAAAAAAACAAAAATTAGCCAGG - Intergenic
1000341080 5:160277901-160277923 GAAAAAAAAAGCAATTAGCCAGG - Intronic
1000400367 5:160820403-160820425 GAAAAAAACAAAAAAAAGCCTGG + Intronic
1001335566 5:170793769-170793791 GAAAAAAATACAAATTAGCCGGG + Intronic
1002413146 5:179100206-179100228 AAAACAAAACCAAAATAGCCAGG + Intergenic
1002576019 5:180174170-180174192 GAAAATAACTCCAAAAAGCAAGG + Intronic
1002844844 6:937163-937185 GTAAAAAAGCCCAAAGACCCAGG + Intergenic
1003587560 6:7406819-7406841 AAAAAATACCCAAATTAGCCGGG - Intronic
1004492239 6:16128489-16128511 AAAAAAAAAACAAAATAGCCAGG - Intergenic
1004632006 6:17430830-17430852 AAAAATAACCCCTAATGGCCGGG - Intronic
1004838159 6:19551785-19551807 AAAAATAACCACAAATAACCAGG + Intergenic
1005163439 6:22892320-22892342 GGAAAAAACCCCAAGTAAACAGG + Intergenic
1005689136 6:28284814-28284836 GAAATACACACCGAATAGCCAGG - Intronic
1008125665 6:47665655-47665677 GAAAAATACAAAAAATAGCCAGG - Intronic
1008231332 6:48987660-48987682 AAAAAAAACCCAAAATACACTGG + Intergenic
1008314224 6:50019608-50019630 GAAATAAACCCCAAATATTCAGG - Intronic
1008364931 6:50667045-50667067 TAAGAAAAACTCAAATAGCCAGG + Intergenic
1009428292 6:63539051-63539073 TAAAAAAACACAAATTAGCCGGG - Intronic
1010160315 6:72846515-72846537 GAAAAAAAAAAAAAATAGCCAGG + Intronic
1010464239 6:76148396-76148418 AAAAAAAAGCCCATATAGCCAGG + Intergenic
1010465123 6:76158570-76158592 AAAAAAGAGCCCATATAGCCAGG - Intergenic
1010482177 6:76368804-76368826 AAAGAAGACCCCATATAGCCAGG - Intergenic
1010726746 6:79343814-79343836 TTAAAAAAGCCCCAATAGCCAGG + Intergenic
1011056200 6:83205962-83205984 AAAAAAAAACCAAATTAGCCAGG + Intergenic
1011120717 6:83949100-83949122 AAAAAAAAGCCCAAAACGCCAGG - Intronic
1012455684 6:99402333-99402355 TAAAAATACCCTAAATAGCTTGG + Intronic
1012634864 6:101525076-101525098 GACAAAAACTCCAATTAGACTGG - Intronic
1012688721 6:102286964-102286986 AAAAAACAGCCCAAATAGCCCGG + Intergenic
1012824287 6:104127176-104127198 AAACAAAACACCAATTAGCCAGG - Intergenic
1012881111 6:104791512-104791534 GAATAAAACTCCAAGAAGCCAGG - Exonic
1013001747 6:106029765-106029787 CAAAAAAAAACCAATTAGCCAGG - Intergenic
1013229612 6:108150079-108150101 AAAAAAAACCCCAAAGGGCTGGG + Intronic
1013485877 6:110595573-110595595 GAAAAAAACAAAAATTAGCCGGG + Intergenic
1013715252 6:112952966-112952988 CCAAAAAACCCCAAATATCTAGG - Intergenic
1015392140 6:132694699-132694721 GAAAAAAAAAAAAAATAGCCAGG + Intronic
1015415606 6:132944563-132944585 CAAAAAACCCACAAATAGTCTGG + Intergenic
1016195637 6:141335484-141335506 TGAAAAAACAACAAATAGCCAGG - Intergenic
1017510085 6:155106299-155106321 TAAAAATACCCCAAAAAGGCTGG - Intronic
1018247589 6:161837549-161837571 GAAAAAAAACCCAGACACCCAGG - Intronic
1020751850 7:12150709-12150731 GAAACAAACCCCAAATACATAGG - Intergenic
1020874824 7:13679380-13679402 GAAAAAATCCTTAAACAGCCTGG + Intergenic
1023363490 7:39439783-39439805 CAAAAACACACCAAAAAGCCTGG - Intronic
1023930518 7:44702537-44702559 GAAAAAACCCCCAAAAAACAAGG - Intronic
1024432363 7:49303665-49303687 TAAAAAGAGCCTAAATAGCCAGG - Intergenic
1024583029 7:50815571-50815593 ACAAAAAACCCCAAATACCAAGG + Intergenic
1024932677 7:54680317-54680339 TAAAAAAACCCCAAAGTGGCAGG - Intergenic
1025065286 7:55849448-55849470 TAAAAACACCCAAAACAGCCAGG + Intronic
1025081045 7:55983136-55983158 AAAAAAAACCCCCAAAAGACTGG + Intronic
1025320097 7:58086862-58086884 GCAAAAAGCCGCAAAAAGCCGGG - Intergenic
1025553612 7:62276611-62276633 GCAAAAAGCCACAAAAAGCCGGG + Intergenic
1025710356 7:63902107-63902129 AAAAAAAACCCTAAAAACCCTGG + Intergenic
1026461927 7:70622005-70622027 AAAAAATACACCAATTAGCCGGG - Intronic
1026907303 7:74069673-74069695 AAAATAATCCCCAAATATCCAGG - Intronic
1026990921 7:74585096-74585118 AAAAAAAACACCAAACAGGCTGG - Intronic
1027230762 7:76270815-76270837 GAAAAAAAAAAAAAATAGCCAGG + Intronic
1028831395 7:95330494-95330516 AAAAAAAAACCCAAAAACCCTGG + Intergenic
1029360864 7:100087891-100087913 GAAAATAACCCCACAAGGCCAGG - Intergenic
1029364773 7:100109653-100109675 AAAAAAAAAACCAAAAAGCCGGG - Intronic
1029665550 7:101992807-101992829 TAAAAAAACTCCAAATAATCCGG - Intronic
1029854296 7:103498650-103498672 GAAAAATACAAAAAATAGCCAGG - Intronic
1030001477 7:105068610-105068632 AAAAAAAACCACAACTAGTCAGG - Intronic
1030541945 7:110842160-110842182 AAAAAAATCCCCAAATAGTTAGG - Intronic
1032125786 7:129191701-129191723 CAAAAACACCCCTAAGAGCCAGG - Intronic
1032253965 7:130282493-130282515 GAAAAAAAAAACAAAGAGCCAGG - Intronic
1032320253 7:130879974-130879996 AAAAAAAAACCAAACTAGCCAGG + Intergenic
1032644838 7:133812018-133812040 GCAAAAAACCCCACGTGGCCAGG - Intronic
1032712547 7:134473377-134473399 GAAAAAAACCATGATTAGCCAGG - Intergenic
1033567072 7:142589251-142589273 TAAAAATACAACAAATAGCCAGG - Intergenic
1033675050 7:143532679-143532701 GAAAAAAAAAAAAAATAGCCAGG - Intergenic
1034003955 7:147447714-147447736 AAAAATTACCCCAAATAGGCTGG - Intronic
1034523633 7:151640148-151640170 GAAAAAAACAAAAATTAGCCGGG + Intronic
1034537108 7:151732297-151732319 GAAAAATACAACAATTAGCCAGG - Intronic
1034581305 7:152044966-152044988 GATAAAAACCTCAAAAAACCGGG - Intronic
1035126182 7:156609016-156609038 GGAAAAAACCCCAATAAGCAAGG - Intergenic
1035834249 8:2731154-2731176 GAAAATACCCACATATAGCCAGG - Intergenic
1035926600 8:3734548-3734570 TAAAAATACCCAAAATAGCTAGG + Intronic
1036583281 8:10098916-10098938 GAAAAAAATCCCACATAAACAGG - Intronic
1037034514 8:14148994-14149016 GATAAAAACCCCCAAAAACCTGG + Intronic
1037722809 8:21459303-21459325 GAAAAGAACCCCACACAGGCCGG + Intergenic
1037864546 8:22432806-22432828 AAAAAAAAAACAAAATAGCCGGG - Intronic
1038232138 8:25711237-25711259 GTAGAAAGCCACAAATAGCCAGG - Intergenic
1038379644 8:27080459-27080481 GAAAAAGCCTCCAAATTGCCAGG + Intergenic
1038451799 8:27644238-27644260 GAAAAAAAAGTTAAATAGCCTGG - Intronic
1038678947 8:29648974-29648996 CAATAAATCTCCAAATAGCCTGG - Intergenic
1040735646 8:50504638-50504660 AAAAAAACCCCAAAATAGCCAGG + Intronic
1040753303 8:50738579-50738601 GAAAAAGAGCCCACACAGCCAGG + Intronic
1040754781 8:50759815-50759837 AAAAAAGAGCCCACATAGCCAGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042535185 8:69851569-69851591 TAGAAAAACTCCAAAAAGCCAGG + Intergenic
1042705268 8:71660307-71660329 TAAAAAAAACCCAAAGGGCCAGG + Intergenic
1043243213 8:77963514-77963536 GAAAAAAAAGCCAAATAGCTGGG + Intergenic
1043640816 8:82447942-82447964 GAAAAAGAGCTCAAATAGCCAGG - Intergenic
1044569261 8:93699819-93699841 GAATAAAACCCCAAACAAACAGG - Intronic
1045282488 8:100761164-100761186 AAAAAAAACCCAGAATATCCAGG + Intergenic
1045456036 8:102380095-102380117 GAAAAAAACAGCAAAGAGGCCGG + Intronic
1045505898 8:102778357-102778379 CAAAAAGACACCAAGTAGCCAGG + Intergenic
1045540941 8:103084545-103084567 AAAAAATAAGCCAAATAGCCAGG + Intergenic
1046993661 8:120489908-120489930 GAAAAAAACCCAAGCTATCCTGG + Intronic
1047688761 8:127329512-127329534 TAAAAAAACCCAAAATGGCCGGG + Intergenic
1047985561 8:130229741-130229763 TAAAAAACCCCAAAATAGGCTGG + Intronic
1048545581 8:135383931-135383953 AAAAAAAAGCCCAAATAGCCCGG - Intergenic
1049823235 8:144649287-144649309 AAAAAAAAAACCAATTAGCCAGG + Intergenic
1049825332 8:144664004-144664026 GAAAAATACAACAATTAGCCGGG + Intergenic
1050429824 9:5551071-5551093 GAAGATCACCCCAAATAACCAGG - Intronic
1050661178 9:7884591-7884613 AAAAAGAAGCCCATATAGCCAGG + Intronic
1051373450 9:16379223-16379245 AAAGAAGACCCCATATAGCCAGG - Intergenic
1051531278 9:18106499-18106521 GAAAAAAGGCCCAAATAAGCAGG + Intergenic
1051965683 9:22826706-22826728 GAATAAAACTCAAAATAGGCTGG - Intergenic
1051994722 9:23201245-23201267 AAACAAAACCCCAAATCTCCAGG + Intergenic
1052049676 9:23830902-23830924 AAAAAAAACCCCAAAAAACCCGG + Intergenic
1052972400 9:34385114-34385136 GACAAGAACCCCAAAAAGCAGGG + Intronic
1053070474 9:35098493-35098515 GAAAAAAACCCTTCATAGGCCGG + Intergenic
1053140458 9:35679559-35679581 CAACAAAACCAAAAATAGCCGGG + Intronic
1053259410 9:36648973-36648995 AAAAAAAACCCCAGATATGCAGG + Intronic
1053401279 9:37825872-37825894 CAAAAAAACAAAAAATAGCCAGG + Intronic
1053402153 9:37834944-37834966 GAAAAATACCAAAATTAGCCAGG - Intronic
1054321572 9:63674341-63674363 GAAAAAAAAACCAAATAAACAGG - Intergenic
1054853138 9:69869744-69869766 AAAAAAAACCCCAAATTGAGTGG + Intronic
1055390530 9:75817227-75817249 AAAAAAGAGCCCATATAGCCAGG - Intergenic
1056371742 9:85962328-85962350 TAAAAATACACAAAATAGCCAGG + Intronic
1056634737 9:88322213-88322235 GAAAAAAAACAAAATTAGCCGGG - Intergenic
1056876574 9:90338987-90339009 GATAAAAACACCGAATAACCAGG - Intergenic
1057578483 9:96263566-96263588 GAAAAAAAAATCAAAAAGCCAGG + Intronic
1058233472 9:102460692-102460714 AAAAAAGAGCCCAAATAACCAGG + Intergenic
1058443183 9:105029461-105029483 AAAAAAAACCCCACATAATCTGG - Intergenic
1058620257 9:106875353-106875375 GATAAAAATCCCAAATTGGCTGG + Intronic
1058872692 9:109216252-109216274 GAAAAAAATCCCAAAGTGCTGGG - Intronic
1060648823 9:125306651-125306673 GAAAAATACCAAAATTAGCCAGG - Intronic
1060895385 9:127213651-127213673 GACAAAAACCCAAAATTGCCTGG + Intronic
1061005295 9:127925624-127925646 GAAAAACACACAAATTAGCCAGG - Intronic
1061888973 9:133607777-133607799 GAACAAAACCCCACATTTCCTGG + Intergenic
1061991393 9:134160836-134160858 TAAAAATACACAAAATAGCCGGG - Intergenic
1062108489 9:134768533-134768555 AACAACAACCCCAAAGAGCCTGG - Intronic
1186251673 X:7674163-7674185 CAAAAAAACCACAAATTGACAGG + Intergenic
1186989265 X:15049931-15049953 GAAAAATACAACAATTAGCCGGG + Intergenic
1187902514 X:24037954-24037976 AAAAAAAATCCAAAATTGCCTGG + Intergenic
1187911695 X:24117380-24117402 GAAATAAGCCCAAAATAGCGTGG - Intergenic
1188614515 X:32141273-32141295 AAAAAAAAAAACAAATAGCCTGG + Intronic
1188843247 X:35041902-35041924 AAAAAAAAGCTCAAAGAGCCAGG + Intergenic
1189237626 X:39500079-39500101 AAAAAAAACCTCAAAAAGGCAGG + Intergenic
1189447082 X:41090060-41090082 GAAAAAAAATACAAATAGCCAGG - Intronic
1190313722 X:49135843-49135865 CAAAAAACCCACAAATTGCCGGG + Intergenic
1190821072 X:53973318-53973340 AAAAAAGAGCCCAAATAGCCAGG + Intronic
1191096459 X:56678373-56678395 AAAAAAGAGCCCACATAGCCAGG + Intergenic
1191591709 X:62892762-62892784 AAAAAAGAGCCCATATAGCCAGG + Intergenic
1192330559 X:70172092-70172114 AAAAAAAACCCCAAAAAAACTGG - Intergenic
1192685240 X:73297687-73297709 GAAAAAGAGCCCAAATAGCCAGG + Intergenic
1194162947 X:90478041-90478063 TAATAAAACCCCCAATAGCTAGG + Intergenic
1194285297 X:92003072-92003094 GATAAAAACCCTAAAAAACCTGG - Intronic
1194550994 X:95299059-95299081 CAAAAAATGCCCAAATACCCAGG + Intergenic
1195064162 X:101224407-101224429 AAAAAAAAGCCCAAAAAACCCGG + Intronic
1195546309 X:106115996-106116018 GAAAAAAAACCCACATCACCAGG - Intergenic
1195690365 X:107619292-107619314 AAAAAAAACCAGAATTAGCCGGG - Intergenic
1195840097 X:109166600-109166622 GAAAAAAAACCCTGCTAGCCAGG - Intergenic
1195993459 X:110707312-110707334 AAAAAAGAGCCCATATAGCCAGG + Intronic
1197411709 X:126124116-126124138 TAAAAAAAACCCAAAAAACCTGG + Intergenic
1197524171 X:127541213-127541235 GATAAAAACCCTAAAAAACCTGG - Intergenic
1198125784 X:133642293-133642315 GAACATAACCCCAAATATTCTGG - Intronic
1199641128 X:149863154-149863176 CAAAAACAGCCCAAATAGCCAGG + Intergenic
1199965723 X:152819032-152819054 GAAAAAAATCCCGAAGGGCCAGG + Intergenic
1200468286 Y:3548783-3548805 GAAAAAAACCCCAAAACCACAGG + Intergenic
1200509221 Y:4055773-4055795 TAATAAAACCCCCAATAGCTAGG + Intergenic
1200602866 Y:5227614-5227636 GATAAAAACCCTAAAAAACCTGG - Intronic
1201381927 Y:13389627-13389649 GAAGAAAACCCCACATAGATAGG - Intronic