ID: 1105986121

View in Genome Browser
Species Human (GRCh38)
Location 13:25569275-25569297
Sequence CTTCTTATCATGAAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105986121 Original CRISPR CTTCTTATCATGAAGAGAAA AGG (reversed) Intronic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
902645010 1:17791849-17791871 CATCTTATGAGGAAGAGAGAGGG + Intronic
902760083 1:18575380-18575402 CTCCTTTTCATGAGCAGAAAGGG - Intergenic
903077353 1:20781925-20781947 CTTTTTATCATTAAGAAAAATGG - Intronic
904690241 1:32288357-32288379 GTTCTTATAATAAAGATAAATGG + Intergenic
905603299 1:39272680-39272702 CTTTTTAGGATGGAGAGAAATGG + Intronic
906715545 1:47965788-47965810 TTTCAGATCATGAAGAGCAAGGG + Intronic
908367318 1:63439139-63439161 CTTCTTAAAATGAAGAGAATAGG + Intergenic
908521262 1:64945163-64945185 CTTGTTAACATGGAGAGAACTGG - Intronic
909106413 1:71415010-71415032 CTTCTTCTAAAGAAGACAAACGG - Intronic
909438576 1:75672693-75672715 CTTCTTCTCAAGCAGAGAAAAGG - Intergenic
909820826 1:80058280-80058302 CTTGTGAATATGAAGAGAAATGG - Intergenic
910165224 1:84320498-84320520 CTTGTTAGCATGAAGGGAGAGGG + Intronic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910555739 1:88530247-88530269 CTTCTAAACGTTAAGAGAAATGG + Intergenic
911733221 1:101311065-101311087 CTTCTTGGCATGAAGTGGAAGGG - Intergenic
911886669 1:103309903-103309925 CTTTTTAGCAGGGAGAGAAAAGG + Intergenic
912184594 1:107260100-107260122 TTTACTATCATGAAGAGACATGG - Intronic
912749750 1:112276721-112276743 CCTCTTACAATGAAGAGAAATGG + Intergenic
913989191 1:143594556-143594578 ATTCTTATCCTGTAGAGAACAGG - Intergenic
915779489 1:158530801-158530823 GTTTTTATCATGAAGGGACATGG - Intergenic
916623030 1:166522154-166522176 CTTCTTATCACTTAGAGAATGGG + Intergenic
917578752 1:176351274-176351296 TATCTTAACATGAAGAGAAATGG + Intergenic
918553396 1:185770495-185770517 TTTCTTGTCCTGAAGAAAAATGG + Intronic
919037252 1:192329482-192329504 CTGCTTATTATTAAGAGAAAAGG + Intronic
920764522 1:208819196-208819218 TTTCTCATCATGCAGAGTAAAGG + Intergenic
921823534 1:219645077-219645099 GTTTTTATCATGAAGGGATATGG - Intergenic
922059735 1:222076883-222076905 CCTCTTATAATGAAGGGTAAAGG - Intergenic
922729539 1:227942523-227942545 CTTCTTAGCATGGAGAGGAGAGG - Intronic
923102598 1:230828091-230828113 CTTATTCTCATGAGGAGGAAGGG - Intergenic
924151964 1:241138694-241138716 CTTCTAATCATAAATGGAAAGGG - Intronic
1064600623 10:16988654-16988676 GTTCTTACCTTGAAAAGAAATGG - Intronic
1064666814 10:17661640-17661662 CATCTTGTCATTAATAGAAATGG - Intronic
1064724882 10:18269053-18269075 GTTCTTATCATGCAAAGCAAAGG - Intronic
1064826852 10:19413552-19413574 CTTTTAATCATGAAAAAAAAAGG + Intronic
1065795483 10:29303656-29303678 TTTCTTATCGTGAAGAGCATGGG + Intronic
1066312564 10:34211942-34211964 CTTCTTTCCATCAAGAGAAAAGG + Intronic
1066428532 10:35331327-35331349 ATACTTTTCAAGAAGAGAAATGG - Intronic
1066483266 10:35818654-35818676 CTTCTTATTGTTAAGAGAAGTGG + Intergenic
1066570857 10:36770234-36770256 TTTCTTTTCCTAAAGAGAAAGGG - Intergenic
1066976204 10:42369972-42369994 CTACTTAGCATGAATATAAAAGG - Intergenic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068200486 10:53777589-53777611 CTGCTTATCATTAACAGGAATGG - Intergenic
1071423043 10:85520753-85520775 CTTCTCATCAGGAAGAGAGCAGG - Intergenic
1071810341 10:89173254-89173276 CTTGATATCATGCAGAGGAAGGG + Intergenic
1073192348 10:101660710-101660732 CTGCTCATCAGGAAGGGAAATGG - Intronic
1073609168 10:104926280-104926302 GTTCTGCTCATGGAGAGAAATGG + Intronic
1073626253 10:105100791-105100813 TTTTTTATTATGAAGAGAAAGGG - Intronic
1075489246 10:122852467-122852489 GTTCTTATAATGAAGACAACAGG + Intronic
1076277197 10:129211485-129211507 CTTCCTCACATGAAGACAAAAGG + Intergenic
1078208976 11:9254747-9254769 CTTCTTATTTAAAAGAGAAAAGG - Intronic
1079568498 11:21913412-21913434 CTTCTTGGGATGAAGAGAAAGGG + Intergenic
1079968584 11:27008129-27008151 CTTTTTGTCAGGAAGAGAAGTGG - Intergenic
1081430137 11:42967740-42967762 CATCTTCTCTTGAAGGGAAAAGG + Intergenic
1082558515 11:54591721-54591743 TTTCTTCTCATGAAGGGAATCGG - Intergenic
1082617591 11:55380123-55380145 CTTCTTATCATCATTGGAAAAGG - Intergenic
1083073660 11:60014408-60014430 CATCATACCATGAAGAGACATGG - Intergenic
1083250998 11:61467105-61467127 TTTCTCATAATGAAGAGCAAAGG + Intronic
1086748005 11:90454504-90454526 GTTTTTATCATGAAGAGATTTGG - Intergenic
1086858647 11:91898269-91898291 CTTCATTTCGTGATGAGAAAAGG + Intergenic
1086971209 11:93083052-93083074 CTTCTTTTCATGATGACAGATGG + Intergenic
1088664758 11:112083517-112083539 GATGTTATCATGAAGGGAAAAGG - Exonic
1089033753 11:115362425-115362447 TGTCTTATCTTCAAGAGAAAAGG + Intronic
1091604605 12:1939426-1939448 CTTTTTCTTGTGAAGAGAAAGGG - Intergenic
1091667129 12:2427318-2427340 CTTCCTTTCATGAAATGAAAAGG + Intronic
1094246569 12:28303260-28303282 ATTTTTGTTATGAAGAGAAAGGG + Intronic
1094698947 12:32849655-32849677 CCTCTAAGCATGAAGAGAAGGGG - Intronic
1095690559 12:45083838-45083860 ATTCTTATCATGAAGATAGTGGG - Intergenic
1095913000 12:47447907-47447929 CTTATTATTTTGAAGAAAAAGGG - Intergenic
1096898245 12:54846750-54846772 CTTCCTATGATGAAAAGCAAGGG - Intronic
1097988927 12:65814121-65814143 CTTATGAGGATGAAGAGAAAGGG - Intergenic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1098394542 12:70004460-70004482 CTCCTTATTAAGAACAGAAAAGG + Intergenic
1099939096 12:89163674-89163696 CATCTTAATATGAAGAAAAATGG + Intergenic
1100366997 12:93931060-93931082 CTCCTCATAATGTAGAGAAATGG - Intergenic
1100600947 12:96110923-96110945 CTTCTGCTCATGAAGACTAAGGG + Intergenic
1101130521 12:101686553-101686575 CTTTATATCAGGAAGAGTAAAGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101852444 12:108414784-108414806 CTTCTTATCATGATGAGACTGGG - Intergenic
1103171956 12:118828598-118828620 CTTGTTATAATAAAAAGAAAGGG + Intergenic
1105821380 13:24084071-24084093 CTTCTTCTCAGAAAGAGAAAGGG + Intronic
1105986121 13:25569275-25569297 CTTCTTATCATGAAGAGAAAAGG - Intronic
1107140667 13:36995426-36995448 CTTCATACAATGAAGAAAAACGG - Exonic
1109158786 13:58946163-58946185 CATCTTCACATGAAGAAAAAAGG + Intergenic
1109704375 13:66070898-66070920 TTTCACATAATGAAGAGAAAAGG + Intergenic
1110764533 13:79267714-79267736 CTTCTTATACTGTAGAGAAGTGG + Intergenic
1111646687 13:91040371-91040393 CTGCTCATCTTGAAGAGAATGGG - Intergenic
1111942051 13:94620059-94620081 CATCTTATCCTCAATAGAAAAGG + Intronic
1112680814 13:101763033-101763055 CTTGTGATGATAAAGAGAAATGG - Intronic
1112691024 13:101894040-101894062 CTTTTTATCTTGCAGAGATATGG + Intronic
1112720658 13:102240925-102240947 CTTCAAATCATTAGGAGAAAAGG + Intronic
1115539691 14:34408935-34408957 TTTCTTATAATGAAGAGCTATGG - Intronic
1115793824 14:36910008-36910030 CTTGTAATCATGAAGTGTAAAGG + Intronic
1116684678 14:48023102-48023124 CTTCTTTTCAGAAACAGAAAAGG + Intergenic
1116807786 14:49510468-49510490 CTTCTTCTCATCAAGAGCACAGG - Intergenic
1116913931 14:50502583-50502605 ATTTTTATCAAGAAGAAAAAAGG - Intronic
1117407137 14:55415285-55415307 ACTGTTAGCATGAAGAGAAATGG + Intronic
1117945939 14:61021267-61021289 ATATTTATCAAGAAGAGAAAAGG + Intronic
1119690847 14:76671319-76671341 TTTCTGATCATGAGGGGAAATGG - Intergenic
1120258080 14:82144666-82144688 TTTATTATCAAGAAGATAAAGGG + Intergenic
1121666349 14:95675378-95675400 CTTCTTATGATGAAGAAATTGGG - Intergenic
1122456899 14:101860868-101860890 CTTTTTATCTGGAAAAGAAAAGG - Intronic
1125593426 15:40869948-40869970 CTGGTTATCATGAGGAGAAATGG + Intergenic
1126375625 15:47994126-47994148 CTTTTTATAAAGAAGAGAACAGG + Intergenic
1126607130 15:50489341-50489363 CCTCTTAGCATATAGAGAAAAGG + Intronic
1128025395 15:64432204-64432226 GTACTTATCCTGAAGAGAGATGG + Intronic
1130124645 15:81082916-81082938 CATGTTTTCATGAACAGAAAAGG + Intronic
1130630833 15:85567511-85567533 ATAATTATTATGAAGAGAAAAGG + Intronic
1132775162 16:1589512-1589534 CTTGCTATCCAGAAGAGAAAGGG + Intronic
1133044606 16:3080731-3080753 CTTATTATTTTGAAGAAAAAGGG - Intronic
1133695218 16:8256847-8256869 CTTATTATCACAAACAGAAATGG - Intergenic
1137796147 16:51221793-51221815 TTTCTCATCATGAAGGCAAAAGG + Intergenic
1138120767 16:54399383-54399405 CTCCTTACCTTGAAGAGCAAAGG + Intergenic
1138331080 16:56215911-56215933 CTTCTCATCAGGAAGAGAGTGGG - Intronic
1138463664 16:57170541-57170563 CTTCCTCACATGAAGATAAATGG + Intronic
1140137586 16:72221181-72221203 CTTCTTAAAATGGAAAGAAAGGG + Intergenic
1143363896 17:6393047-6393069 TTTCTGAAGATGAAGAGAAAGGG - Intergenic
1143887916 17:10079368-10079390 GTTCAGATCATGAAGGGAAATGG + Intronic
1145215621 17:21049830-21049852 CTTCTTATCAAGAAAATAAGAGG + Intergenic
1145221229 17:21090907-21090929 CTTGTTAACATGTAGAAAAATGG - Intergenic
1145260388 17:21351370-21351392 GTTCTTATTTTGAACAGAAAAGG + Intergenic
1147983762 17:44292228-44292250 CTGATTATCATGAGGAGACAGGG - Intergenic
1148477445 17:47938228-47938250 CTTATTATCCTCAAGACAAAGGG + Intergenic
1149825127 17:59821343-59821365 CATCTTATCTTTAAGAGTAAAGG - Intronic
1151145890 17:72040661-72040683 ATTCTTTTCATGGAAAGAAAAGG + Intergenic
1151209236 17:72531804-72531826 CCTTTTATCATGAAGAAATACGG + Intergenic
1153376484 18:4386315-4386337 CTTCTAATAATAAAAAGAAATGG - Intronic
1154018676 18:10643637-10643659 TTTCCTATCATGAAAAGAAAAGG + Intergenic
1154185552 18:12179785-12179807 TTTCCTATCATGAAAAGAAAAGG - Intergenic
1155410594 18:25540712-25540734 CTCTATATTATGAAGAGAAAGGG - Intergenic
1155715259 18:28934351-28934373 CTTCTTATCAACAAAAGAAGAGG - Intergenic
1156564105 18:38164106-38164128 CTTGTTTTGATGGAGAGAAAGGG - Intergenic
1156594968 18:38538250-38538272 CGTCTTATCATGGAGGGAGAGGG + Intergenic
1157655733 18:49385982-49386004 CTTCTTATTTTGTAGAGACAGGG + Intronic
1158696120 18:59705577-59705599 CTTCTAATTGTGAATAGAAAAGG + Intergenic
1159001279 18:62977716-62977738 CTTGTGATCATGGAGAGCAATGG + Intronic
1159981043 18:74779576-74779598 TTTATTATCATGGAGAAAAATGG - Intronic
1160973935 19:1783262-1783284 CTTCTCCTCCTGAAGAGCAAAGG + Exonic
1162594749 19:11619613-11619635 GTTCTTATCCAGAAGGGAAAAGG + Intergenic
1163084560 19:14969995-14970017 CTACTCAACATGAAGACAAAGGG + Intronic
1163680143 19:18676482-18676504 GGTCTGATCATGAAGAGAGAGGG - Intergenic
1164445116 19:28310530-28310552 CTCCTTATAATGAACACAAATGG + Intergenic
1166499565 19:43330820-43330842 TTTGATATCATGAAAAGAAAAGG - Intergenic
1167019976 19:46866248-46866270 ATTCTTTGCATGAAGAGAGAAGG + Intergenic
925561587 2:5201981-5202003 CTTCATGTCCTGAAGACAAAAGG - Intergenic
926487326 2:13478036-13478058 CTGCTTATCATTAACACAAATGG + Intergenic
926835375 2:17013437-17013459 TTTTTTATCCTGAAGAGAAAAGG + Intergenic
928206601 2:29289122-29289144 CTTATAATGATGAAGATAAACGG + Intronic
928591963 2:32826420-32826442 ATTGTTATGATCAAGAGAAAGGG + Intergenic
929253338 2:39782303-39782325 CTTCATCTCATGGAGAGAAGAGG - Intergenic
932702054 2:73998818-73998840 CTTTGTGTGATGAAGAGAAAAGG + Intronic
933123768 2:78576781-78576803 CTTCCTCTCAAGAAGATAAATGG - Intergenic
933291084 2:80439017-80439039 TTTATTATCAAAAAGAGAAAGGG - Intronic
935262126 2:101364668-101364690 ATTCTTTTCATGAATTGAAAGGG + Intronic
935741026 2:106148030-106148052 TTTCTTATCTTGAAGGCAAAGGG - Intronic
935885080 2:107609192-107609214 CTTCTTATAGTGGTGAGAAATGG - Intergenic
937694453 2:124792224-124792246 CTTCGTATCATTATGAGAAACGG - Intronic
939639932 2:144627993-144628015 CTTCTCTGCATGAAGAGAGATGG + Intergenic
940020793 2:149154022-149154044 ATTCTAATAATGAAGAGAATGGG + Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
940529412 2:154861195-154861217 CTTCCGATGAGGAAGAGAAATGG - Intergenic
940556350 2:155233418-155233440 TTTCTGATGATGAAAAGAAAAGG - Intergenic
943215906 2:185034434-185034456 TTTATTGTAATGAAGAGAAAGGG + Intergenic
943656574 2:190515035-190515057 CTTCTTGTCATGAAAGGAAAAGG + Intronic
945162515 2:206907555-206907577 ATTTTTATCATGAATAGACAAGG + Intergenic
945445938 2:209938914-209938936 TTCCTAATCATCAAGAGAAAAGG + Intronic
946775606 2:223137114-223137136 CATCTGATAATGAAGAGCAATGG + Intronic
946847740 2:223874772-223874794 CTTATTATAATAAAAAGAAAAGG - Intronic
947209220 2:227691603-227691625 CTTCTTTTCTTTAAGAGACAGGG - Intronic
948923140 2:241076083-241076105 CTTCTGAAGATGAAGAGTAAAGG - Intronic
1169473263 20:5907279-5907301 CTTCCTCCCAAGAAGAGAAAGGG - Intergenic
1169757058 20:9053661-9053683 CTTTCTCTCATGAAGAGGAAGGG + Intergenic
1169760609 20:9088410-9088432 ATTCTTCTAATGATGAGAAAAGG - Intronic
1173464064 20:43267521-43267543 CTTGTCAACATGGAGAGAAAAGG + Intergenic
1174216580 20:48921069-48921091 CTTTTTATTTTGTAGAGAAAGGG + Intergenic
1177894978 21:26846438-26846460 CTTCCTACCAGGAAGGGAAAAGG + Intergenic
1178029706 21:28510277-28510299 CTTCTTTTCAGGCAGAGTAATGG - Intergenic
1179429040 21:41306094-41306116 CTTCTTATGATTGAGTGAAATGG - Intronic
1182310778 22:29404731-29404753 CTTTTTATCTTTAAGAGACAGGG + Intronic
949354865 3:3169829-3169851 CTTCTTAGCATGTAGAGAGGAGG - Intronic
953500667 3:43430734-43430756 CTTCTGATAAAGAAGAAAAATGG - Intronic
956054898 3:65288487-65288509 CTTCTTATGGTGAAGTGAAGTGG - Intergenic
956156225 3:66300674-66300696 CTTTTTTTCATGAAGCAAAAAGG - Intronic
956245916 3:67182827-67182849 CTTCCTTGCATGTAGAGAAAAGG - Intergenic
958434773 3:94082925-94082947 TTTCTTCTGATGAAGATAAAAGG - Intronic
959143870 3:102520683-102520705 CTTCTTACCATTAAGTAAAATGG - Intergenic
960059382 3:113304533-113304555 ATACATATCATTAAGAGAAAAGG - Intronic
960292028 3:115897418-115897440 CTTCTCTTCATGGAGAGAAGAGG - Intronic
960292029 3:115897421-115897443 CTTCTCTCCATGAAGAGAAGAGG + Intronic
962911214 3:139852056-139852078 ATTTTTATCATGAAGGGATATGG + Intergenic
963398200 3:144760101-144760123 CTTCTTACTATGAAAAAAAAAGG - Intergenic
964524299 3:157601566-157601588 TTTCTTTTCAAGAAAAGAAAGGG + Intronic
964599600 3:158482968-158482990 TTTCTTGTCATGAATACAAATGG + Intronic
964915067 3:161830755-161830777 CTTCTTCTACTGAAGAGTAAAGG - Intergenic
966043099 3:175516286-175516308 CTTCTCAGCCTGAAGAGATATGG - Intronic
966514637 3:180805097-180805119 CTTCTTTCCAAGAAGACAAAGGG - Intronic
966746189 3:183279666-183279688 CATTTTATCCTGAAGAAAAAGGG + Intronic
967356018 3:188572645-188572667 ATCCTCATAATGAAGAGAAAAGG - Intronic
967430103 3:189373486-189373508 TATCTAATCAAGAAGAGAAATGG + Intergenic
967514002 3:190345577-190345599 CTGCTTATGATAAAGAGAGACGG - Intronic
968131168 3:196193780-196193802 GTTCTTAGCATGCAGAGGAATGG - Intergenic
968782220 4:2591627-2591649 CTTATAAACATGAAGAAAAAAGG - Intronic
971137873 4:23889517-23889539 CGTCTTATTATAAATAGAAATGG + Intronic
971702120 4:29992063-29992085 TTTCTTTTCATGAAAAGAAGAGG + Intergenic
974128487 4:57724599-57724621 CTTTGTCTCATGAAAAGAAAGGG + Intergenic
975355717 4:73401099-73401121 CTTCTTCTCTTAAAGATAAAGGG - Intronic
976457964 4:85271711-85271733 GTTTTTATCATGAAGAGATGTGG - Intergenic
977836646 4:101653201-101653223 CTTTTTCTCATGACTAGAAATGG - Intronic
978822611 4:112983123-112983145 TTTATTATCCTGAAGAAAAACGG + Intronic
979993170 4:127399999-127400021 CTTCTTACCATGGAGAAATATGG + Intergenic
980488715 4:133496106-133496128 TTTTTTATTATGAAGAGAATGGG - Intergenic
981594417 4:146402991-146403013 CTCATTTTCCTGAAGAGAAAAGG - Intronic
983311673 4:166071809-166071831 TTTCTTATGTTGATGAGAAATGG - Intronic
986418474 5:7552157-7552179 CTTCCTATCAGGTATAGAAAGGG + Intronic
987087297 5:14482995-14483017 ATTCTTACCATGATGAGAACTGG + Intronic
987334879 5:16889864-16889886 ATTCTTATCAAGAGGAGGAAAGG - Intronic
989000569 5:36756154-36756176 CTTCTCATTATGAGGAAAAAAGG + Intergenic
989046012 5:37274339-37274361 ATTCATATACTGAAGAGAAAGGG - Intergenic
989147455 5:38262823-38262845 CTTCTGTTTATCAAGAGAAATGG - Intronic
989170013 5:38464613-38464635 CTTCTTATAATGCAGAGTTAAGG + Intronic
989428737 5:41327104-41327126 CCTCTTAAGATAAAGAGAAAGGG + Intronic
990695905 5:58416539-58416561 CTTCCTGTGATGAAGAGAAGAGG - Intergenic
992310588 5:75494846-75494868 CTTCTTATGAAGAAAAGAAATGG - Intronic
992759066 5:79935534-79935556 CTCTTTTTCAGGAAGAGAAATGG - Intergenic
993774010 5:91968619-91968641 CTTCTTTTCTAGAAGAGAGAAGG + Intergenic
994551725 5:101242122-101242144 CTTTTCATCCTGAAAAGAAATGG + Intergenic
994660704 5:102650548-102650570 CATCTTTTCATGAATAGTAAAGG - Intergenic
994985066 5:106922678-106922700 AAACTTACCATGAAGAGAAAAGG + Intergenic
995804138 5:116032482-116032504 CTTCTTATGATGATGTAAAATGG - Intronic
995809685 5:116090683-116090705 CTGCTGATCATGAAATGAAATGG + Intronic
995847271 5:116507820-116507842 CTCCTTAGCCTGAAGTGAAATGG + Intronic
995893171 5:116980317-116980339 CTTCTTATCAGAAAAAGAAAAGG - Intergenic
996637491 5:125710836-125710858 CTTCTGGTCATGAAGGGATATGG - Intergenic
997503881 5:134400674-134400696 CTTCATATCATATAAAGAAATGG + Intergenic
997738729 5:136234792-136234814 GTTCTTGTCATGAAGATAAGTGG + Intronic
999941724 5:156550339-156550361 TTTCTTTTCATGAGCAGAAAGGG + Intronic
1000276421 5:159739822-159739844 CTCCTTATTTTAAAGAGAAAAGG - Intergenic
1000427827 5:161113691-161113713 CTTCTTGTCATTCAAAGAAAAGG - Intergenic
1001021359 5:168185196-168185218 CTCCTAATAATGAAGACAAAAGG + Intronic
1001047850 5:168388912-168388934 CTACTAATCATGATTAGAAATGG - Intronic
1003032504 6:2614489-2614511 CTTTCTATCATGAAGACACATGG - Intergenic
1003421750 6:5964656-5964678 CTTCTTATACTGAAGAGAGTGGG - Intergenic
1003475606 6:6479338-6479360 CTTCAAATAAGGAAGAGAAAAGG + Intergenic
1003716399 6:8651402-8651424 AATCTTATCATGAAAATAAATGG - Intergenic
1003859920 6:10313299-10313321 TTTCTGTGCATGAAGAGAAAAGG - Intergenic
1004401163 6:15289937-15289959 CTTCTTTCCATGAAGACAAGTGG - Intronic
1004746316 6:18512125-18512147 CCTTTTATCAGGAAGAGAATGGG - Intergenic
1005234369 6:23742696-23742718 CCTCTAAGCAAGAAGAGAAAAGG + Intergenic
1006942845 6:37764459-37764481 CTTCTTAGAAAGAAGAAAAATGG + Intergenic
1007675827 6:43594014-43594036 TTTCTTATCAACTAGAGAAAAGG + Intronic
1008271238 6:49492960-49492982 CTTATTATCATAATAAGAAAAGG - Exonic
1008805573 6:55423012-55423034 CTTCTTATGATCAAAGGAAATGG - Intergenic
1011724424 6:90194958-90194980 TTTCTTCTCATCAAGAAAAAGGG - Intronic
1012667553 6:101994207-101994229 CTTCGTATCATGGAGAGATTAGG - Intronic
1012908585 6:105094552-105094574 CTTCCTTTCCTGCAGAGAAAAGG - Intergenic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1016732261 6:147439519-147439541 CTGGTTAACATCAAGAGAAAAGG + Intergenic
1017033555 6:150246151-150246173 TTGATTGTCATGAAGAGAAAGGG + Intronic
1017067515 6:150543039-150543061 CTTCCTGTTATGAAGAAAAAAGG + Intergenic
1018055009 6:160044499-160044521 ATTTTTATCTGGAAGAGAAAGGG - Exonic
1018139424 6:160814276-160814298 CATCATATCATAAAGAGAATGGG + Intergenic
1018949107 6:168367298-168367320 ATTCTTATCCTGTAGAGGAAAGG + Intergenic
1020355377 7:7269885-7269907 CTTATTATCATGAACATACAAGG + Intergenic
1021126977 7:16862363-16862385 CTTCTTCCCATGAAAAGAAAGGG - Intronic
1021283822 7:18754234-18754256 TTTCTTATCACCATGAGAAATGG + Intronic
1021540819 7:21755744-21755766 CTTCTAATCAGAAAGACAAATGG - Intronic
1021615457 7:22498858-22498880 CTCCTTACCATGCAGACAAATGG - Intronic
1022404365 7:30073484-30073506 CTTATTATCATGGTGGGAAAAGG - Intronic
1024250473 7:47502285-47502307 GCTCTTAGCATGCAGAGAAAAGG + Intronic
1024391182 7:48814168-48814190 CTTCTTCTCATTAGGAGGAATGG - Intergenic
1026680678 7:72464305-72464327 CCTCTTAAAAAGAAGAGAAAAGG + Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1028045753 7:86117013-86117035 CTTGTGATCAGAAAGAGAAAGGG + Intergenic
1028377042 7:90155772-90155794 CTCCTTACCATGCAGACAAATGG + Intronic
1028682625 7:93554528-93554550 CTTGTTCTCATGACCAGAAAGGG - Intronic
1028893861 7:96018924-96018946 CTTCATATCATGGAGAAAAATGG - Intronic
1029891050 7:103930968-103930990 CTTGTTATAATGAGGAGTAAAGG - Intronic
1030286573 7:107833030-107833052 CTAGTTATCAGCAAGAGAAAAGG + Intergenic
1030372486 7:108716222-108716244 CTTCTTATGATGAAAAGCACAGG + Intergenic
1031214914 7:118877774-118877796 TTTATTGTCTTGAAGAGAAAAGG - Intergenic
1031264133 7:119562742-119562764 CTTCTTTTCAGGAAGCTAAAGGG - Intergenic
1031424006 7:121584141-121584163 ATTCTTATCAAGAATATAAAAGG + Intergenic
1032328632 7:130956297-130956319 CTTCTTATAAGGAAAAGAAGAGG + Intergenic
1032381553 7:131488749-131488771 ATTGTTATTTTGAAGAGAAATGG + Exonic
1032656399 7:133935225-133935247 CTTCATTCCATGAAGAGAGAAGG + Intronic
1032861524 7:135884382-135884404 CTTTTTACCAAGCAGAGAAAAGG + Intergenic
1033015409 7:137665900-137665922 CTGCTTCTCAGGAAGAGGAAAGG - Intronic
1033718645 7:144032427-144032449 CTTCTTATTTTGTAAAGAAAAGG + Intergenic
1034683596 7:152950106-152950128 AGTCTTATCTTGAAGAGATAAGG - Intergenic
1034735147 7:153422062-153422084 TTTCTGATTATGAAGGGAAAAGG + Intergenic
1034967932 7:155403036-155403058 TTTCTTATGATGAAGATCAATGG - Intergenic
1035121151 7:156568637-156568659 TTTCTTATCCTTAAGAGAAGGGG - Intergenic
1037034513 8:14148980-14149002 GTTTTTATCATGAAGAGATGTGG - Intronic
1037715917 8:21400059-21400081 CTTTTCAGCATGAAGAGGAAAGG + Intergenic
1038258149 8:25970013-25970035 CTTCATATTATCAAGAGGAAAGG + Intronic
1039778268 8:40758280-40758302 CTTCATGACAAGAAGAGAAAGGG - Intronic
1040994654 8:53389520-53389542 CTTCACATCATGAAGAGCACAGG + Intergenic
1041858812 8:62487534-62487556 GATCTTATCATGAAGAGACATGG + Intronic
1042750776 8:72155283-72155305 CTTTGTATCATAAAGAGAAATGG + Intergenic
1042945935 8:74154453-74154475 TTCCCTATCATGAAAAGAAAAGG + Intergenic
1044763610 8:95548447-95548469 CTAGTTAACATGAACAGAAAAGG + Intergenic
1045136795 8:99229578-99229600 CTTGTTCTCATGTAGAGAAAAGG + Intronic
1045798504 8:106074794-106074816 TTTCTTATCATGAATTGGAAAGG - Intergenic
1045808715 8:106196365-106196387 CTTCTAATGAAAAAGAGAAAGGG - Intergenic
1046034849 8:108828292-108828314 CCTCTTATCCTAAACAGAAAGGG + Intergenic
1046102671 8:109632458-109632480 ATTCTTATTGTGAAGAAAAATGG - Intronic
1047606654 8:126481465-126481487 CTTCTTATTATTTAGAGACAAGG - Intergenic
1048679982 8:136830720-136830742 TTTCTTTTCTTGAAAAGAAAAGG - Intergenic
1049561306 8:143312503-143312525 TTTTTTATCATGAAGAGCATTGG - Intronic
1051026342 9:12616466-12616488 CATCTTATCAAGAAGAAAATTGG - Intergenic
1051533000 9:18126328-18126350 TTACTTATAAGGAAGAGAAATGG - Intergenic
1051627748 9:19114276-19114298 CTTGTTTTCATGGAGAGAAAGGG + Intronic
1051821181 9:21170808-21170830 GTTTTTATCATGAAAAGATATGG - Intergenic
1052129399 9:24823477-24823499 CTTCATATCAAAAAGGGAAAAGG - Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1054893414 9:70279339-70279361 TTTCTTTTCATGTAGAGACAGGG - Intronic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055619179 9:78106204-78106226 CTTCTGAGCATGAAGAGAGCTGG - Intergenic
1055635082 9:78269128-78269150 CGACTTAGCAAGAAGAGAAAGGG + Intronic
1055759253 9:79589327-79589349 CTGCTTATCATCATGGGAAAGGG - Intronic
1055791807 9:79930251-79930273 TTTACTATCATAAAGAGAAAGGG - Intergenic
1055817776 9:80227643-80227665 GTTTTTATCATGAAGAGATGTGG + Intergenic
1056036741 9:82614567-82614589 CTTATCATCATAAAAAGAAATGG + Intergenic
1056567193 9:87784170-87784192 ATACTCATCAAGAAGAGAAAAGG - Intergenic
1058444616 9:105043761-105043783 CCTCTTATCAGAAAGAGAATAGG - Intergenic
1059710527 9:116863726-116863748 CTTCTTCCCTTGGAGAGAAAGGG + Exonic
1060320067 9:122550694-122550716 ATTTTTATCATGAAGGGATATGG - Intergenic
1185504550 X:621573-621595 GTGCTTATCATGAATAGAAATGG + Intergenic
1186711783 X:12205417-12205439 CCTCTTACCTTGAAGGGAAATGG - Intronic
1188746056 X:33845646-33845668 GTTTTTATCATGAAGGGATATGG + Intergenic
1188909739 X:35832148-35832170 TTTCTTCTCTAGAAGAGAAATGG - Intergenic
1189107105 X:38248417-38248439 TCTCTTATCAAAAAGAGAAAAGG + Intronic
1189838303 X:45042777-45042799 CTTCTTCCCATGTAGAGAAGTGG - Intronic
1190595704 X:52051376-52051398 CTTCTTTCCAGGGAGAGAAAAGG + Exonic
1190613120 X:52202697-52202719 CTTCTTTCCAGGGAGAGAAAAGG - Exonic
1192013030 X:67295759-67295781 TATTTTAACATGAAGAGAAATGG - Intergenic
1193076054 X:77356903-77356925 CTTCTTCTCATGAAGCCAGAAGG + Intergenic
1194751655 X:97691982-97692004 ATTGTTATAATAAAGAGAAAAGG + Intergenic
1197416162 X:126175924-126175946 CTTTTTATCATCAAAATAAATGG + Intergenic
1197864087 X:130999587-130999609 CTTCCTGTCATTAAGATAAATGG + Intergenic
1198333084 X:135640258-135640280 CATATTGTCATGAAGAGGAAAGG - Intergenic
1198641074 X:138756984-138757006 CTTCTTTTCCTGAAGTGTAATGG + Intronic
1198645865 X:138805864-138805886 CTTTTAATCCTAAAGAGAAAGGG + Intronic
1198863082 X:141091576-141091598 ATTCTTAGAATGAAAAGAAAAGG + Intergenic
1198899608 X:141495811-141495833 ATTCTTAGAATGAAAAGAAAAGG - Intergenic
1199365535 X:146977291-146977313 ATTTTTATCATGAAAAGATAGGG + Intergenic
1200291574 X:154880321-154880343 CTTCCTTTCATGAAAAAAAAAGG - Intronic
1201560715 Y:15313547-15313569 ACTCTTCTCATGAAGAGACAGGG - Intergenic
1201617342 Y:15915351-15915373 CTTCTTGTCTAGATGAGAAAGGG + Intergenic
1202164394 Y:21970934-21970956 GGTTTTATCAGGAAGAGAAAAGG - Intergenic
1202226962 Y:22615438-22615460 GGTTTTATCAGGAAGAGAAAAGG + Intergenic
1202316160 Y:23580216-23580238 GGTTTTATCAGGAAGAGAAAAGG - Intergenic
1202554604 Y:26089850-26089872 GGTTTTATCAGGAAGAGAAAAGG + Intergenic