ID: 1105986642

View in Genome Browser
Species Human (GRCh38)
Location 13:25573691-25573713
Sequence GTGGCAGCCCTGGTGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105986642 Original CRISPR GTGGCAGCCCTGGTGCTGGG TGG Intronic
900143112 1:1146755-1146777 CTGGCTGCACTGGTGCAGGGTGG + Intergenic
900163676 1:1236331-1236353 GGGGCAGCCCTGCTGCAGGCTGG - Intergenic
900164597 1:1239687-1239709 GAGGCAGCCCCGGGGCAGGGTGG + Intergenic
900393559 1:2444036-2444058 GCCGCAGCCCTGGTGCGGGTCGG + Intronic
900411472 1:2514600-2514622 GTAGGAGGCCTGGTGCAGGGTGG + Intronic
900478517 1:2887322-2887344 CTGGCAGCAGAGGTGCTGGGTGG - Intergenic
900647724 1:3716524-3716546 GTGGCTTCCCTGGGGCAGGGAGG + Intronic
900649153 1:3722566-3722588 CTGGCAGCCCTTGTGCTCTGGGG - Intronic
900716201 1:4146341-4146363 GTGGCAGGCCTGGTAGTGAGTGG - Intergenic
900826176 1:4928781-4928803 ATGGCTCCCCTGGTTCTGGGAGG - Intergenic
901022900 1:6264008-6264030 TAGGCAGCCCAGATGCTGGGAGG - Intergenic
901649486 1:10735488-10735510 GGGACAGCCCTGGCGCTGCGTGG - Intronic
901660748 1:10796440-10796462 GCGGCAGCCCCGGGGGTGGGGGG + Intronic
901755510 1:11439208-11439230 GAAACAGCCCTCGTGCTGGGAGG - Intergenic
902053048 1:13579258-13579280 GAGACAGCCCTATTGCTGGGAGG + Intergenic
902378233 1:16040207-16040229 GGGGCAACAGTGGTGCTGGGAGG + Intergenic
902383340 1:16062715-16062737 GGGGCAACAGTGGTGCTGGGAGG + Intronic
902475930 1:16687440-16687462 CTGGGAGCGCAGGTGCTGGGTGG + Intergenic
902618079 1:17634772-17634794 GGGCCAGCCCTGGGGCAGGGTGG + Intronic
902911045 1:19597306-19597328 GCAGCAGCCCGGGTGCGGGGTGG + Intronic
903944373 1:26952338-26952360 GTGGAGGCCCAGATGCTGGGCGG + Exonic
904055034 1:27664436-27664458 GACTCAGCCCTGGAGCTGGGCGG + Intergenic
904392732 1:30196492-30196514 GGGGCAGGCCTGGGGGTGGGAGG - Intergenic
904586749 1:31584970-31584992 GCGGCAGCCCTGCTGCTGGTGGG - Exonic
905309207 1:37037785-37037807 GTGCCAGCCCTGGTGCCTGCTGG - Intergenic
906725188 1:48039401-48039423 GTGTCAGCCCTTGGGCAGGGTGG + Intergenic
907574834 1:55517046-55517068 GAGGCAGCCCTGCTGGTGAGTGG + Intergenic
908131948 1:61082864-61082886 GGGGCAGGGCTGGGGCTGGGTGG + Intronic
908650278 1:66325429-66325451 GTGCCAAGCCTGCTGCTGGGTGG - Intronic
912804400 1:112744007-112744029 GGGCCAGCCCTGGGGCTGGGAGG + Intergenic
912812085 1:112802354-112802376 ATGGCAGCTCTGGGGCTGGAAGG + Intergenic
912886522 1:113480343-113480365 GGGGCTGGCCTGGTACTGGGGGG + Intronic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
913552052 1:119925545-119925567 GTGGCAGGAGGGGTGCTGGGGGG + Exonic
913612189 1:120519327-120519349 CTGGGAGCGCAGGTGCTGGGTGG + Intergenic
914579000 1:149002911-149002933 CTGGGAGCGCAGGTGCTGGGTGG - Exonic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915308341 1:154993819-154993841 ATGCCAGCCATGGTGCTGGTGGG - Exonic
915461303 1:156072264-156072286 GAGACAGCCCTGGGGCAGGGAGG - Exonic
915668905 1:157470580-157470602 GTGGCAGCAGTGGTGATGGTGGG + Intergenic
917432914 1:174989369-174989391 ATGGCAGCCATGGTGCTGGTAGG - Intronic
917522611 1:175760650-175760672 GTGGTGGCCTTGGTGCTTGGTGG - Intergenic
917801879 1:178579166-178579188 GGGGCATCCCTGGTGCTGCCTGG + Intergenic
919912932 1:202123040-202123062 GTGCCTGCCCAGGTGCAGGGGGG - Exonic
921961112 1:221035292-221035314 GAGGCAGCCTTTGGGCTGGGTGG - Intergenic
922404439 1:225298029-225298051 GGGTCACCCCTGGTGGTGGGAGG - Intronic
922467228 1:225852755-225852777 CTGGAAGGCCTGGTTCTGGGAGG + Exonic
923203323 1:231733561-231733583 GTGGCAGTGCTGGTGATGGTGGG + Intronic
923203336 1:231733630-231733652 GTGGCAGTGCTGGTGATGGTGGG + Intronic
923956306 1:239025565-239025587 GTGGTAGGCCTGGTGATGGATGG - Intergenic
924706409 1:246506651-246506673 GTGGCGGGCGTGGGGCTGGGTGG - Intronic
1062929366 10:1342318-1342340 GTGTCAGTCCTGGTTCTGTGGGG - Intronic
1063953163 10:11242854-11242876 GGGGGAGGCCTGATGCTGGGAGG + Intronic
1063974049 10:11401446-11401468 GTGGTGGCCCTGTGGCTGGGCGG - Intergenic
1065072359 10:22038970-22038992 CAGGCAGCTCTGGAGCTGGGAGG - Intergenic
1066289389 10:33999873-33999895 CTGACATCCCTGGTGGTGGGTGG + Intergenic
1067007100 10:42674462-42674484 GGAGAAGCCCTGGTGCTGGTGGG + Intergenic
1067937562 10:50624366-50624388 GTCGCAGCCCTTGGGCTTGGTGG - Intronic
1068882986 10:62069751-62069773 GTGGCAGCGCTGGTGCTCCCAGG - Exonic
1069568592 10:69480184-69480206 GTGGCAGCTCTGGTGTTTGGGGG + Intronic
1069751470 10:70747947-70747969 GTGGCAGCCCTGGCGATGAAGGG + Intronic
1069798714 10:71069337-71069359 GTGCCTGCCCTGCTGCTGGCTGG + Intergenic
1069881646 10:71597189-71597211 ATGGCAGTCCTGGGGCCGGGAGG + Intronic
1069984567 10:72274468-72274490 GGGGAAGCCCCGGTGCTGGAAGG + Intronic
1070150082 10:73800130-73800152 GTGGAAGCCCTGGCTCTGTGTGG - Exonic
1070322077 10:75362062-75362084 GTTGCAGCCCTGGGGCTGGTAGG - Intergenic
1070445632 10:76498324-76498346 ATGGCAGCCCTGGTTCTCTGAGG + Intronic
1070683841 10:78467595-78467617 TTGGCAGACCTGGGGCTTGGTGG + Intergenic
1070786704 10:79166235-79166257 GGTGCAGCCGTGCTGCTGGGAGG - Intronic
1070900933 10:80028533-80028555 GTGGCAGTCCAGGTGCAGTGGGG - Intergenic
1070902669 10:80044300-80044322 GTGGCAGTCCAGGTGCAGTGGGG - Intergenic
1071292002 10:84195111-84195133 GTGGCAGCTCCGATGCTGCGTGG + Intronic
1072635287 10:97173945-97173967 GTGGAAGCCCTGCTGCTGAGGGG - Intronic
1073115025 10:101087137-101087159 GAGGCAGCCTTGCTGCTTGGTGG + Intergenic
1073332410 10:102679051-102679073 GTGGCTGCCCTGGGCCCGGGAGG + Intronic
1073599979 10:104837142-104837164 GTGTCAGCCGTTGTGCTTGGTGG + Intronic
1074687953 10:115977160-115977182 GGGGCAGCCCTAGTGCAGGCCGG - Intergenic
1074787007 10:116849987-116850009 GCGGCAGCCCAGGGGCTGGCAGG + Intronic
1075079150 10:119371185-119371207 GCTGCAGCCCGGGTGCGGGGAGG - Intronic
1075140399 10:119828903-119828925 GGGGCAGCCCTGGTTCTGTGTGG - Exonic
1075676529 10:124299811-124299833 CTGGCAGGGCTGGTGCTGGTGGG - Intergenic
1075862459 10:125689020-125689042 GCTGCAGCCCTGATGTTGGGAGG + Intergenic
1076704225 10:132292658-132292680 GTGCCAGCCCAGGTGCTCTGAGG + Intronic
1076729768 10:132432411-132432433 GTCCCAGCCCTGTTGCCGGGTGG - Intergenic
1076750922 10:132542567-132542589 GTGGCAGCCCTCGAGTGGGGTGG + Intronic
1076898295 10:133325014-133325036 GGGGGACCCCTGGTTCTGGGCGG - Intronic
1077113645 11:873086-873108 GCTGGAGCCCAGGTGCTGGGTGG + Intronic
1077378201 11:2215507-2215529 GAGGGAGCACGGGTGCTGGGGGG + Intergenic
1077407989 11:2391175-2391197 CTGGCAGGGCTGGTGCTGGTGGG + Intronic
1077436020 11:2539608-2539630 GTTGCATCCCTGGTGAAGGGCGG + Intronic
1078071321 11:8113438-8113460 GTTGCTGGCCTGATGCTGGGTGG - Intronic
1078893533 11:15578561-15578583 GGGGCTGACCTGGTGCTGGCAGG + Intergenic
1079245324 11:18748232-18748254 GTGGCTGTTCTGCTGCTGGGTGG - Intronic
1081646231 11:44792562-44792584 GTGGCAGACCTTGCGCAGGGCGG + Intronic
1083205970 11:61149486-61149508 GTGCCAGACCTGCTGCTTGGTGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083550271 11:63583257-63583279 GTGGCAGCCATGGTTCTGTTGGG + Intronic
1083596097 11:63918881-63918903 GGGGCAGCCCTGGAGTAGGGAGG - Intergenic
1083890551 11:65593619-65593641 CTGCCAGCGCTGGTGCTGTGGGG - Exonic
1083896150 11:65620775-65620797 GGGCGAGCCCTGGGGCTGGGTGG - Intronic
1083966836 11:66048638-66048660 GGGGCAGACCTGGTGCAGGCTGG - Intronic
1084891360 11:72238637-72238659 CAGGCACCCCTGGGGCTGGGAGG - Exonic
1084939378 11:72604205-72604227 GGGGCAGGCATGCTGCTGGGAGG - Intronic
1085270849 11:75269087-75269109 GTGGCAGAACTGGGGCTGGAGGG - Intronic
1085994414 11:81893520-81893542 CTGGCATCCCTGCTGCTGGGAGG + Intergenic
1089124785 11:116169273-116169295 GAGGCAGCCCTGGGGCTGGTAGG + Intergenic
1089181005 11:116582806-116582828 CTGGCAGGCCTGGTGGAGGGTGG + Intergenic
1089294797 11:117461161-117461183 GTGGCATCTCTGGTGAGGGGTGG - Intronic
1089844237 11:121445960-121445982 CTGGCTGCCCTGGTGCTGACAGG + Intergenic
1090770559 11:129915794-129915816 GTGGGAGCTCTGCTCCTGGGTGG + Exonic
1091216550 11:133905818-133905840 GTGGGCTCCCTGGTGCTGAGCGG - Intergenic
1091305112 11:134531670-134531692 GTGGCTGCACTGGAGGTGGGGGG - Intergenic
1091488575 12:913621-913643 ATGACAGACCTGCTGCTGGGAGG + Intronic
1091918441 12:4285857-4285879 GGGGCAGCCCTGGTGCCACGGGG + Intronic
1092218111 12:6696345-6696367 GTGGCAGCAATTTTGCTGGGGGG - Intronic
1093542706 12:20305863-20305885 GTGGTGGCCCTGGCTCTGGGTGG - Intergenic
1096179686 12:49543873-49543895 GAGTCAGCACTGGGGCTGGGGGG - Intronic
1096573443 12:52538209-52538231 GTGGCAGCCCTGCTGGAGGCTGG + Intergenic
1098567602 12:71953410-71953432 GTGCCTGCCATGGTGCTGGTGGG + Intronic
1100648478 12:96558107-96558129 GTTCCAGTTCTGGTGCTGGGTGG + Intronic
1100721982 12:97368948-97368970 GTGGGAGTCCGGGTGCTGGAGGG - Intergenic
1102035616 12:109769052-109769074 GGGGCAGCCCGGGAGCTGGCTGG + Exonic
1102197201 12:111034079-111034101 GCGGCGGCCCCGGGGCTGGGGGG + Exonic
1102381325 12:112469094-112469116 CTGGCAGACCTGATGATGGGTGG + Intronic
1103360871 12:120353006-120353028 GTGGCAACCCTGGAGTCGGGTGG + Intronic
1103636384 12:122310055-122310077 GTGGCAGCCCTCCTTTTGGGAGG - Intronic
1103727532 12:123005498-123005520 CCGGCAGGCCTGGTGCTGGCAGG - Exonic
1103927743 12:124433134-124433156 GTGGCCAGGCTGGTGCTGGGTGG + Intronic
1103966965 12:124646141-124646163 TTGGCCCCCCTGGGGCTGGGTGG - Intergenic
1104376373 12:128267726-128267748 GGGGCAGCTCTGGGTCTGGGGGG - Intronic
1104633244 12:130422481-130422503 GTGGCAGCGCTGGTCCTCAGAGG - Exonic
1104891763 12:132143720-132143742 GTCCCCGGCCTGGTGCTGGGGGG - Exonic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1108746297 13:53397972-53397994 GAGGCAGCCCCAGTGCTGTGCGG + Intergenic
1111658852 13:91184278-91184300 TTCTCAGCCCTGATGCTGGGAGG - Intergenic
1113231548 13:108218245-108218267 GAGGGAGTCCTGGTGCTCGGAGG + Intronic
1113553722 13:111214299-111214321 GCCTCAGCCCTGGTGCTGGCTGG + Intronic
1114549807 14:23526211-23526233 GTGGCAGCAGTGGTGGTGGGTGG + Exonic
1118772186 14:68949465-68949487 GTGGCAGGCCTGGCGCTGGCAGG + Intronic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1121328107 14:93033576-93033598 GTGGGAGCCTTGGGGCTGGGAGG + Intronic
1121336914 14:93083239-93083261 GTGGCAGGCCTGCTGCTGGATGG - Intronic
1121616881 14:95319532-95319554 CTGGCCGCCCTGGGGCTTGGGGG + Intronic
1122013154 14:98770322-98770344 ATGGCAGCCATGGGGGTGGGAGG - Intergenic
1122047175 14:99032478-99032500 GAGGGGGCCCTGGGGCTGGGAGG - Intergenic
1122604041 14:102936574-102936596 CTGGCTGCCCAGGTGCTGAGGGG + Intronic
1122691529 14:103534047-103534069 GTGGCTGCCCTGGTGGGAGGCGG + Intronic
1122787476 14:104170652-104170674 GTTGGAGCCCTGGTTCAGGGTGG + Intronic
1123013932 14:105364484-105364506 GTGGCGGCCCGGGTGCGCGGTGG + Intronic
1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG + Intronic
1125059440 15:35401336-35401358 GTGGCAGCTGTGGTGCTGATGGG + Intronic
1125143721 15:36440812-36440834 GTGGCAGTCCTGGACCTGGGAGG + Intergenic
1125507264 15:40274056-40274078 GTGGCAGCAGTGGTGGAGGGGGG - Intronic
1125825970 15:42676773-42676795 GTGACATCACTGGTGTTGGGAGG + Intronic
1128027216 15:64448098-64448120 GTGGCAACACTGGTGGTAGGAGG + Intronic
1128296506 15:66525241-66525263 GTGCCACCCATGGTGCTGGCTGG + Intronic
1129273677 15:74432503-74432525 GTGGGAGCCCAGGTGCAGGCAGG - Intronic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129644742 15:77419855-77419877 GTGGCGGCGCGGGTTCTGGGTGG - Intronic
1129906554 15:79191718-79191740 TGTGCAGCCCTGGTGCTCGGGGG - Intergenic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130538260 15:84802350-84802372 GTGGCTGTCCTGGTCCTGAGAGG - Exonic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1132331173 15:101013349-101013371 GAGGCCGCCCTGGTTGTGGGCGG + Intronic
1132358187 15:101189232-101189254 GGGCCATACCTGGTGCTGGGTGG - Intronic
1132572680 16:650876-650898 GAGGCAGCCCTGGGGTGGGGCGG + Intronic
1132616444 16:843256-843278 GTGCCAGCCCTGCAGCTGCGGGG - Intergenic
1132806457 16:1777316-1777338 GTGGCAGCACAGGTACTGGAGGG + Exonic
1133013213 16:2926051-2926073 GTGGCAGTCATGGTGTGGGGTGG - Intronic
1133013572 16:2928732-2928754 GTGGCAGTCATGGTGTGGGGTGG - Intronic
1133117794 16:3588003-3588025 GTGGCATCCCTGCACCTGGGAGG + Intronic
1133132694 16:3687483-3687505 GTGGTAGACCTGGTGTTTGGTGG - Intronic
1133230015 16:4361955-4361977 GGGGCAGCCCTGGTGGGGTGGGG + Intronic
1133234169 16:4380164-4380186 GTGACAGAGCTGGAGCTGGGGGG - Intronic
1133236731 16:4390874-4390896 GGGGCAGCTGTGGTCCTGGGCGG - Intronic
1133318300 16:4897631-4897653 GTAGCACCCCCGGTGCTGGGGGG + Intronic
1133332936 16:4987708-4987730 TGGGCGGCCCTGGGGCTGGGGGG + Intronic
1133400039 16:5479061-5479083 GTGGCAGCCAGGGTCCTGGAAGG - Intergenic
1134042800 16:11081181-11081203 CTTGCAGCCCCGGTGCAGGGTGG + Intronic
1134767980 16:16778414-16778436 GAAGGAGTCCTGGTGCTGGGGGG + Intergenic
1137540157 16:49356397-49356419 CTGGCACCCCTGGAGCTGTGCGG - Intergenic
1138194122 16:55040085-55040107 GTGGAAGCCTTGGGGCTAGGGGG + Intergenic
1138335893 16:56252622-56252644 GTGCCAGACGTCGTGCTGGGTGG - Intronic
1138539175 16:57678110-57678132 GTGGCAGGACTCGTGTTGGGGGG + Intronic
1138583908 16:57958367-57958389 GTGGTGGCCCTGGTGGTGGTGGG - Intronic
1139099175 16:63744564-63744586 GTGGCAGTGCTGGTGCAGGGCGG - Intergenic
1139402701 16:66695705-66695727 GTGCCAGCCACCGTGCTGGGCGG + Intronic
1139406853 16:66725853-66725875 CTGGAAGTCCTGGTGCTGGTGGG - Exonic
1139515415 16:67449793-67449815 GGGCCAGGCCTGGGGCTGGGAGG - Intronic
1140950559 16:79812868-79812890 GTGGCAGCCCTGGTGATTTGGGG - Intergenic
1141721638 16:85759270-85759292 GGGGCAGCCCTCCTGCAGGGAGG + Intergenic
1142143424 16:88482774-88482796 GTGGCTGGCATGGAGCTGGGAGG - Intronic
1142245197 16:88967163-88967185 GTGGCACCTCGGGGGCTGGGGGG - Intronic
1142245216 16:88967217-88967239 GTGGCACCTCGGGGGCTGGGGGG - Intronic
1142342907 16:89535817-89535839 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342912 16:89535848-89535870 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342917 16:89535879-89535901 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342927 16:89535941-89535963 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342932 16:89535972-89535994 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342937 16:89536003-89536025 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342942 16:89536034-89536056 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342947 16:89536065-89536087 GTGGCCGCTCTGGTGCTGTGTGG + Intronic
1142342952 16:89536096-89536118 GTGGCCGCTCTGGTGCTGTGTGG + Intronic
1142342957 16:89536127-89536149 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342962 16:89536158-89536180 GTGGCCGCTCTGGTGCTGTGTGG + Intronic
1142342967 16:89536189-89536211 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342972 16:89536220-89536242 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342982 16:89536280-89536302 GTGGCCTCTCTGGTGCTGTGTGG + Intronic
1142342987 16:89536311-89536333 GTGGCCGCTCTGGTGCTGTGTGG + Intronic
1142411233 16:89918235-89918257 GCTGCAGCCCTGGGGCTGTGGGG - Exonic
1142593629 17:1019087-1019109 TGGGCAGACCTGGTGCTGGGAGG + Intronic
1142596422 17:1031978-1032000 GGGGCGGCCCTGGGCCTGGGAGG - Intronic
1142952874 17:3497948-3497970 GTGACAGCCATGGTGCTTGAGGG + Intronic
1143289134 17:5815758-5815780 GTGGCTGCCAGGGTTCTGGGTGG + Intronic
1143651941 17:8268790-8268812 GGGCCAGCCCTGATGCTGCGAGG + Exonic
1145065412 17:19758295-19758317 TTGGGACCCCTGGTGATGGGTGG + Intergenic
1145392890 17:22469677-22469699 GTGTCACCCCTGGGGCAGGGTGG + Intergenic
1147381693 17:40060103-40060125 GGGACAGCCCTGGTGGTGGTGGG + Intronic
1148052978 17:44778202-44778224 GTTGCAGCCATCGTCCTGGGCGG + Exonic
1148130289 17:45258085-45258107 GTGACAGCCCTGGCTCTGGCTGG + Intronic
1148215213 17:45830410-45830432 GTGGCAGGGCTGGTGCAGGTTGG + Exonic
1148215908 17:45833939-45833961 GGGGCAGCCCAGAGGCTGGGTGG + Intronic
1150283882 17:63944889-63944911 TTGGCAGCCCTGGGGGTGGATGG - Intronic
1150657893 17:67052361-67052383 GCAGCAGCCCTGGCTCTGGGGGG + Intronic
1151387537 17:73764346-73764368 GTGGCAACCCGGGGGCAGGGAGG - Intergenic
1151748512 17:76024112-76024134 GTGGCAGCCCTAGTGTGTGGAGG + Exonic
1152152664 17:78612270-78612292 GTGGCAGCCCGGGTGGAGGAGGG + Intergenic
1152190166 17:78883355-78883377 CTTGCAGCCCTGGTGCAGGGCGG + Intronic
1152238656 17:79150977-79150999 GTGGCCGCCCCGCTGCTGTGCGG + Intronic
1152276243 17:79359233-79359255 CTGGCAGCCCTGGGGAGGGGCGG - Intronic
1152363635 17:79843499-79843521 GTGGCTGCCCTGACGTTGGGAGG - Intergenic
1152374756 17:79913383-79913405 GTGGCCACCCTTATGCTGGGTGG + Intergenic
1153091831 18:1355631-1355653 GTGGTTGCACTGGTGCGGGGGGG + Intergenic
1153104517 18:1511382-1511404 GTGGCATCCCTGCTGCTGCTGGG + Intergenic
1153299491 18:3580716-3580738 GTGGCTGTCCTGGTCCTGAGAGG - Intronic
1155257774 18:24014153-24014175 TTGGCTGCCCTGGTCCTAGGGGG + Intronic
1156336329 18:36175703-36175725 TTGGGAGCCTGGGTGCTGGGTGG + Intronic
1157117080 18:44871895-44871917 GAGTCAGGCCTGGTGCTGGTAGG + Intronic
1157180294 18:45491866-45491888 CTGGCAGAGCTGGTGCTGGCTGG - Intronic
1157612083 18:48963484-48963506 GTAGCAGCCCTCAGGCTGGGGGG + Intergenic
1157715143 18:49879788-49879810 ATGGCAGCCCAGGAGCTGGTGGG + Intronic
1158017161 18:52797746-52797768 CTGGCAGCAGTGGTGATGGGTGG + Intronic
1159927076 18:74279062-74279084 GTGGCAGCTCTGGGCCTGGCAGG - Intronic
1160463064 18:79054080-79054102 GTGGCAGCCAGGGGGCTGTGAGG + Intergenic
1160831961 19:1108394-1108416 GTCGCAGCCCTGGTGCGCGAGGG + Exonic
1160890109 19:1373271-1373293 GAGGTGGCCCAGGTGCTGGGTGG + Intronic
1160965851 19:1746591-1746613 GCTGCAGGCCTGGAGCTGGGAGG + Intergenic
1161093395 19:2374980-2375002 GTGGAGGAGCTGGTGCTGGGCGG + Intergenic
1161242241 19:3228810-3228832 TTGGCACCCCTGGTGGTGGCGGG + Intronic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161563492 19:4986572-4986594 GTGCCAGGCCAGGTGCTGAGGGG + Intronic
1161572759 19:5039569-5039591 GGGTTGGCCCTGGTGCTGGGGGG + Intronic
1161592468 19:5135050-5135072 GTGTGGCCCCTGGTGCTGGGTGG - Intronic
1161746043 19:6060869-6060891 CTGGGAGTCCTGGTGCCGGGAGG - Intronic
1161785463 19:6322529-6322551 GAGTCAGCCCAGGTGTTGGGAGG - Intronic
1161989130 19:7674093-7674115 GTGGCAGCCCTAGTGAGGGCTGG + Intergenic
1162141704 19:8589351-8589373 GTCGCAGCCCACGTGCTGCGTGG + Exonic
1162195791 19:8983583-8983605 GTGAGAGCCCTGTTGCTGGTGGG - Intergenic
1163079564 19:14927712-14927734 CTGGCAGCTGTGCTGCTGGGTGG + Intergenic
1163408013 19:17135741-17135763 TGGGCAGCCATGGTGGTGGGAGG + Intronic
1163874829 19:19859257-19859279 GTGGCAGCCTTGGGGCTGAAAGG - Intergenic
1163905337 19:20147486-20147508 GTGGCAGCCTTGGGGCTGAAAGG - Intergenic
1163958705 19:20667008-20667030 GTGGCAGCCCTGGGGCTGAAAGG + Intronic
1164005381 19:21143591-21143613 GTGGATGCCCTGGGGCTGAGAGG + Exonic
1164023267 19:21327908-21327930 GTGGATGCCCTGGGGCTGAGAGG - Intronic
1164070696 19:21765724-21765746 GTGGATGCCCTGGGGCTGAGAGG - Exonic
1164415066 19:28040040-28040062 GTGGCTGCCCTGGGACAGGGAGG + Intergenic
1164573728 19:29392844-29392866 GTGGCAGCCTTGAGTCTGGGTGG + Intergenic
1164922568 19:32100152-32100174 GTTGCAGCCATGGAGATGGGAGG - Intergenic
1165657299 19:37545070-37545092 GTGGCAGCCTTGGGGCGAGGTGG + Intronic
1166799023 19:45444452-45444474 CTGGCGGCCCTGGGGCGGGGCGG - Intronic
1166889255 19:45980382-45980404 GTGGGAGCCATGGGGGTGGGGGG + Intergenic
1167124385 19:47539206-47539228 GTGCCAGGCCCTGTGCTGGGTGG - Intronic
1167127466 19:47559980-47560002 GTGGGTTCCCTGGTGCTGGAGGG + Intergenic
1167290650 19:48623554-48623576 TTGGAAGCCCAGGGGCTGGGAGG - Intronic
1167597506 19:50435355-50435377 GGGTCAGCCCTGGGGCTGTGCGG - Intronic
1167851485 19:52205808-52205830 GTGGCAGCCCAGGTGGAGAGTGG + Intronic
1168387586 19:55978464-55978486 GTGAGAGCCTTAGTGCTGGGGGG + Intronic
1202680787 1_KI270712v1_random:4855-4877 GTAAAAGCCCTGGCGCTGGGGGG + Intergenic
1202709944 1_KI270714v1_random:13294-13316 CTGGGAGCGCGGGTGCTGGGTGG + Intergenic
926118062 2:10225723-10225745 CTGGCGGCCCAGGTGCAGGGAGG - Intergenic
926772928 2:16394150-16394172 CTGGCAGAACTGGAGCTGGGAGG - Intergenic
927089628 2:19700658-19700680 GGGGCTGCCCTTCTGCTGGGTGG - Intergenic
927940292 2:27099343-27099365 GAGTCCGCCCTGGAGCTGGGAGG + Intronic
929457433 2:42075813-42075835 GAGCCAGCCCTGGTCCTAGGTGG + Intergenic
931778745 2:65562167-65562189 GGCCCAGCCCTGGTGCTGGTGGG - Intergenic
934717013 2:96550239-96550261 GTGGCCGCGCTGGTGCTGCCTGG - Exonic
934728030 2:96637865-96637887 GGGGCAGCCGGGGTCCTGGGCGG - Intronic
935502378 2:103857168-103857190 CTGGCAGCCTTGGTGGAGGGAGG + Intergenic
936462524 2:112723504-112723526 GGGGCAGCCCTGCTGCTTTGGGG - Intronic
936785952 2:116094518-116094540 GCAGCAGTCCTGCTGCTGGGAGG + Intergenic
937320273 2:120956743-120956765 GGGGCAGCCCTGGTGCCTGCAGG + Intronic
937328227 2:121005062-121005084 GAGGGAGCCCGTGTGCTGGGAGG - Intergenic
937905353 2:127050296-127050318 GCGGGAGCCCTGGTGCTCGCGGG + Intronic
938118405 2:128617545-128617567 GTGGGAGCCCTCCAGCTGGGGGG + Intergenic
938140006 2:128787475-128787497 GAGGCAGGCCTGGTGATGGACGG - Intergenic
942077080 2:172365808-172365830 GTGGCATCGATGGTGCTGGAAGG + Intergenic
942921006 2:181373565-181373587 TTGCCAGGCCTGGTGCTTGGAGG - Intergenic
943511838 2:188836045-188836067 GGGGCAGCTGTGGTGCTGGGAGG - Intergenic
944511410 2:200469773-200469795 TTTCCAGCCCTGTTGCTGGGAGG - Intronic
945144541 2:206723632-206723654 GTGGCTGCCCAGGTTCTGGCTGG - Intergenic
946122278 2:217526534-217526556 GTTCCAGCCCTGGAGCAGGGAGG + Intronic
946407994 2:219502330-219502352 GTGGCTGCCCTGGAGCAGGCGGG + Intronic
946571601 2:221029784-221029806 GTGGCAGGCATGGTGTTTGGAGG + Intergenic
947005699 2:225508895-225508917 GTGGCAGCCATGGAGGTGTGTGG - Intronic
947844189 2:233231021-233231043 CTGGCCTCCCTGGAGCTGGGTGG + Intronic
948264491 2:236627090-236627112 ATGGCAGCTCCTGTGCTGGGGGG - Intergenic
948362422 2:237432540-237432562 CTGGCAGCCCTGTTGCAGGAGGG - Intergenic
948370514 2:237486670-237486692 CGGGCAGCCCTGCTGCGGGGAGG - Intronic
948662707 2:239516775-239516797 GTGGCATCACTGGTGCTGCAGGG - Intergenic
948835430 2:240623993-240624015 ATGGCTGGCCTGGTGGTGGGGGG + Intronic
948945563 2:241217512-241217534 GAGGCGGCCCTGGCGCTGCGCGG + Intronic
949014331 2:241701409-241701431 GTGCCCTCACTGGTGCTGGGCGG + Intergenic
1168819563 20:763823-763845 GCGTCAACCCAGGTGCTGGGAGG - Exonic
1169118667 20:3082944-3082966 GGGGCGGGCCTGGGGCTGGGGGG - Intronic
1169217018 20:3799961-3799983 GTGGAAGGCCTGGTGCAGGCTGG + Intronic
1169644347 20:7792725-7792747 GTGACTCCCCTGGTGCTGGAAGG + Intergenic
1170329465 20:15192507-15192529 GTGGCAGAGGTGGTGCTGGTAGG - Intronic
1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG + Intronic
1170885124 20:20334057-20334079 CTGGCAGCACTGGTGCTGGGAGG - Intronic
1171810637 20:29742740-29742762 GGGGCCGCCTTGGTGCTGGAAGG - Intergenic
1172050049 20:32110200-32110222 GAGGCAGCGCTTGGGCTGGGAGG - Intronic
1172132387 20:32664443-32664465 GTGGCAGGGCTGGGGCTGGAAGG - Intergenic
1172183390 20:33016986-33017008 AGGGCAGCCCTGGGGCTGGAGGG - Intronic
1172409082 20:34709250-34709272 GGGGCGGCCCCGGGGCTGGGTGG - Exonic
1172445242 20:34989961-34989983 GTGGGAGACCTGGAGCAGGGCGG - Intronic
1172786604 20:37472920-37472942 GTGGCAGGGATGGTGCTGGTGGG + Intergenic
1173341257 20:42154843-42154865 GTGGGAGAACTGGAGCTGGGGGG + Intronic
1173546172 20:43899805-43899827 GTGGCAGCTCTGGGGCCTGGAGG - Intergenic
1173751746 20:45481802-45481824 GTGCCAGACACGGTGCTGGGAGG + Intergenic
1175179004 20:57131784-57131806 CTGGCATCCACGGTGCTGGGCGG - Intergenic
1175903971 20:62370905-62370927 GTGGCAGCCCTGGGGGAAGGCGG - Intergenic
1176210834 20:63920487-63920509 GTGGCTGCCCTGGCGTAGGGAGG + Intronic
1177427917 21:20949139-20949161 TGGGCAGCCCTGCTGGTGGGTGG - Intergenic
1178293332 21:31387688-31387710 GTGCCAGCCCCAGTGGTGGGCGG + Intronic
1179090532 21:38261163-38261185 GGAGCTGCCCTGGTGTTGGGCGG + Intronic
1179813090 21:43884678-43884700 CTGGGTGGCCTGGTGCTGGGTGG + Intronic
1180006255 21:45022253-45022275 GTAAGACCCCTGGTGCTGGGAGG - Intergenic
1180082379 21:45492880-45492902 CTGGCAGGCCCTGTGCTGGGTGG + Intronic
1180832101 22:18911609-18911631 AAGGCAGCCCTGGGGCTAGGAGG + Exonic
1181557182 22:23677905-23677927 CTGGCTGCCCTGGTGGTAGGAGG - Intergenic
1181572491 22:23775147-23775169 GGGGAAGCCCTGGAGGTGGGAGG + Intronic
1181581943 22:23833459-23833481 GTGCCAGCAGTGCTGCTGGGAGG + Intronic
1181587586 22:23862033-23862055 TTGGCAGCTCTGGTCCAGGGAGG + Intronic
1181609871 22:24005204-24005226 CTGGCAGGCCTGGTCCTGGGGGG - Intergenic
1181822386 22:25486201-25486223 GTGGCTGCCCTGCTGATGGAAGG + Intergenic
1181868245 22:25876343-25876365 GTGGCAGGCAGGGTGCTGGGTGG + Intronic
1181986858 22:26805867-26805889 GTGGCAGATAGGGTGCTGGGTGG + Intergenic
1182012548 22:27012516-27012538 GTGGCAGCCAAGGTTCTGGCAGG + Intergenic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182283523 22:29231444-29231466 CTGGCAGCCCTGGGGTGGGGGGG - Intronic
1182476751 22:30580722-30580744 TGGGCAGCCCTGGTGGTGCGAGG - Intronic
1182521023 22:30884616-30884638 GTGGCATCCCTGGGGCAGGCTGG + Intronic
1182621550 22:31621288-31621310 TAGGCAGCCCTGCTGCTGTGTGG - Intronic
1182747716 22:32618321-32618343 TTGGAAGCTCTCGTGCTGGGAGG - Intronic
1183193072 22:36334300-36334322 GCTGCAGCCATGGTGTTGGGTGG + Intronic
1183268637 22:36846953-36846975 GGGGCAGCACAGGTGCTGGGAGG + Intergenic
1183355863 22:37359043-37359065 TTGGAAGCCCTGGGGCTTGGGGG + Intergenic
1183489444 22:38108832-38108854 GGGGCTGCCCTGGGGCTGTGTGG + Intronic
1183700191 22:39446632-39446654 GTGGCAGCACCTGTGCTGGGAGG - Intergenic
1183703506 22:39463073-39463095 CTGGCAGGCCTGGTGGTGGATGG + Intronic
1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG + Intronic
1184351294 22:43945793-43945815 GGGGCAGCCCTGGTGACTGGTGG + Intronic
1184582086 22:45424709-45424731 GTGGCAGTACTGCTCCTGGGAGG - Intronic
1184647335 22:45903396-45903418 GTGGCGGGGCTGGGGCTGGGTGG + Intergenic
1203282186 22_KI270734v1_random:136914-136936 AAGGCAGCCCTGGGGCTAGGAGG + Intergenic
949981656 3:9505911-9505933 GAGCCAGGCCTGGTCCTGGGAGG - Intronic
950091832 3:10301212-10301234 GGGGCAGTCCTGGAGCTGGCGGG + Exonic
950153707 3:10707580-10707602 GGAGCAGCCCCGGAGCTGGGGGG - Intronic
950971680 3:17195384-17195406 CTGGAGGCCCTGGTGCTGGCTGG - Intronic
952909732 3:38172875-38172897 GTGGCAGCCTAGGTGCTGTCAGG + Intronic
953374495 3:42417257-42417279 GTGGCAGCCCTGGGCCTTGGAGG + Intergenic
953694535 3:45147130-45147152 GTGGCACACCTGCGGCTGGGAGG - Intergenic
954285577 3:49616708-49616730 GTGGCTGCCCTGGTGCACAGTGG - Intronic
954582224 3:51709068-51709090 GAGGGAGACTTGGTGCTGGGTGG + Exonic
954845244 3:53550189-53550211 GTGGGAGCAGTGGTGCTGGCTGG + Intronic
954848139 3:53577702-53577724 GTGGCCGCCCTGGAGATGTGAGG + Intronic
955408668 3:58642086-58642108 GTGGCATCCCTCCTGCAGGGAGG - Intronic
956668631 3:71665074-71665096 GAGGCAGCCCTGATGCATGGTGG + Intergenic
958864678 3:99486519-99486541 GGGGCTGGCCTGCTGCTGGGGGG - Intergenic
961203491 3:125062647-125062669 GTGACATCTCTGGTGCTGTGGGG - Intergenic
961427068 3:126856692-126856714 GTAGAAACCTTGGTGCTGGGTGG + Intronic
962613671 3:137103361-137103383 GTGCCAGGCCCTGTGCTGGGTGG + Intergenic
962888664 3:139652013-139652035 CTGGCAGGCCTGAAGCTGGGTGG - Intronic
963758299 3:149259023-149259045 GTGGTAGCCCTGCTGCTGAAAGG - Intergenic
965827119 3:172742521-172742543 GTGGCAGCCTTGGTGTTGTGGGG + Intergenic
966862801 3:184239840-184239862 GGAGCAGCCCATGTGCTGGGAGG + Exonic
967284862 3:187859179-187859201 GTGGAAGCCCTGTGCCTGGGTGG + Intergenic
967627572 3:191703585-191703607 GCTGCAGCCCTGCTGCTGGTGGG - Intergenic
967784002 3:193470293-193470315 ATGGCAGTGCTGGAGCTGGGTGG - Intronic
968443595 4:636801-636823 GAGGCAGCCCTGGGGCCAGGAGG - Intronic
968756243 4:2417865-2417887 GGGGCATTCCTGGTGCAGGGAGG + Intronic
969443938 4:7233537-7233559 CTGGCAGCTGTGGTGGTGGGTGG + Intronic
969639620 4:8389048-8389070 GGGGCAGCAGTGGTGGTGGGAGG - Intronic
969950453 4:10830159-10830181 GTGACAGCATGGGTGCTGGGAGG - Intergenic
970104410 4:12564326-12564348 GTGGGGGCCCTGGTTCTAGGAGG + Intergenic
972396798 4:38664574-38664596 GGTGCAGCGCTGGTGTTGGGGGG + Intronic
974691766 4:65305832-65305854 GTGGCAATCCTGGTCCTGGCTGG - Intergenic
978414018 4:108456848-108456870 GTGGCAGCAATGGTGGAGGGTGG - Intergenic
983697811 4:170554281-170554303 CTGGCTGCCCTGGTGCTGGCAGG + Intergenic
983908093 4:173205773-173205795 GAGGCTGGCCTGGTGCTGGGTGG + Intronic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
985542068 5:491993-492015 GTGCTGGGCCTGGTGCTGGGCGG - Exonic
985554533 5:551222-551244 GTGGCTGCCCGGGGGTTGGGAGG + Intergenic
985638699 5:1053069-1053091 AGGGCTGCCCTGGGGCTGGGAGG - Intronic
986579059 5:9244785-9244807 TTGGCAGCCCTTGAGCTGGTTGG + Intronic
987126063 5:14813947-14813969 GTGGCAGCTGTGATGCTTGGGGG - Intronic
987642810 5:20633756-20633778 GTGGCAGCCCTACTGCTGGGAGG - Intergenic
987716140 5:21574134-21574156 GTGGCAGCTGTGGTGGTGGAGGG + Intergenic
987719504 5:21616110-21616132 GTGAGAGGACTGGTGCTGGGGGG + Intergenic
988342137 5:29986356-29986378 GAGCCAGGCCTGGTGGTGGGTGG + Intergenic
992177473 5:74164667-74164689 GTGGGACCCCAGGTGCTGGGAGG - Intergenic
993431786 5:87841342-87841364 ATGGTAGCCCTGCTGCTGGAGGG + Intergenic
997476664 5:134146431-134146453 GTGGGGGCCCTGGGGTTGGGAGG - Exonic
997998462 5:138605326-138605348 CTAGCTGCCCTGGTGCTGAGTGG - Intergenic
1000334166 5:160229546-160229568 GTGAAAGCCATGCTGCTGGGAGG - Exonic
1001746738 5:174098316-174098338 GAGGCAGCCCTGGTGCTGTCGGG - Intronic
1002789632 6:427706-427728 GGGGCAGCCCCGGTGCGGGGAGG - Intergenic
1003194588 6:3903483-3903505 GTGGCAGGGCTGGTGCAGAGTGG + Intergenic
1003564253 6:7208977-7208999 GTGGCAGCTGAGGTGCAGGGAGG - Intronic
1004754880 6:18600635-18600657 GGGGCAGTCATGGAGCTGGGTGG + Intergenic
1005797367 6:29379971-29379993 GGGACAGCCCTGCTGCTGTGTGG - Intronic
1005823875 6:29620488-29620510 GGGGCAGCCCTGCAGCTGAGGGG - Intronic
1007065362 6:38985564-38985586 GGAGGAGCCCTGCTGCTGGGAGG + Intronic
1007429957 6:41770959-41770981 ATGGCGGCCCGGGTGCTGGTGGG + Exonic
1007778481 6:44237510-44237532 TTGGCAGTCCTGGTGCTCGCTGG + Intergenic
1013374784 6:109503922-109503944 GGGGAAACACTGGTGCTGGGAGG - Intronic
1016172957 6:141041877-141041899 GTGCCAGCACTAGTTCTGGGTGG - Intergenic
1017972722 6:159327122-159327144 ATGTGAGCCCTGGTGCTGGATGG - Intergenic
1018390082 6:163335492-163335514 GTGGCAGCCACTGTCCTGGGAGG - Intergenic
1018727866 6:166627403-166627425 TTGGCAGTGCTGGTGGTGGGTGG - Intronic
1019032274 6:169023996-169024018 GCGGCCGCCCTGGGGCTGCGGGG - Intergenic
1019285829 7:222485-222507 GTGCCAGCCCTGGGCCTGGGGGG - Intronic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1019707869 7:2505015-2505037 GTGGCCGCCTTGGGGCTGAGAGG + Intergenic
1019732019 7:2633759-2633781 GGGGCAGCCCTGGGGCGTGGGGG + Intronic
1019924334 7:4182318-4182340 AAGGCAGCCCCGCTGCTGGGGGG - Intronic
1020086556 7:5313593-5313615 GTGGCAGGCATGGTGATGAGGGG + Exonic
1020252978 7:6484088-6484110 GCGGCGGCCCCGGGGCTGGGCGG + Exonic
1020746935 7:12090660-12090682 GTGGCAGCCATGCTGCGAGGAGG + Intergenic
1021621734 7:22555914-22555936 GCCTCAGCCCTGGTGCAGGGAGG + Intronic
1022103580 7:27183409-27183431 GGGGCAGCCCAGGTGCTGGAAGG - Intronic
1022465233 7:30649087-30649109 GAGGCAGGCCTAGGGCTGGGAGG - Intergenic
1022921780 7:35023176-35023198 GTGGGGGCCCGGGTGCTGGTGGG - Intronic
1023529193 7:41135917-41135939 GTGACAGCCCTGGCTCAGGGAGG + Intergenic
1023864333 7:44231774-44231796 GCAGCAGCCCTGGAGCAGGGTGG - Intronic
1025206411 7:56995840-56995862 ATGGAGGCCCTGGTGCTGGGTGG - Intergenic
1025206563 7:56996497-56996519 GAGGCAGTGCTGGTGCTGGTGGG + Intergenic
1025207757 7:57003545-57003567 GTGGCAGGCATGGTGATGAGGGG - Intergenic
1025664179 7:63573327-63573349 GTGGCAGGCATGGTGATGAGGGG + Intergenic
1025665375 7:63580430-63580452 GAGGCAGTGCTGGTGCTGGTGGG - Intergenic
1025665528 7:63581087-63581109 ATGGAGGCCCTGGTGCTGGGTGG + Intergenic
1025778486 7:64578774-64578796 GTGGGTGCCCTGGGGCTGAGAGG + Intergenic
1025788716 7:64667729-64667751 GTGGATGCCCTGGGGCTGAGAGG + Intronic
1026633086 7:72055218-72055240 GGGCCAGACCTGGGGCTGGGTGG + Intronic
1029113429 7:98224646-98224668 GTGCCAGCCCTGCTACTGGAGGG - Intronic
1029551176 7:101237876-101237898 GGGGCAGCCCAGAGGCTGGGGGG - Intronic
1032480092 7:132239265-132239287 CTTGCAGCCCTGGGGGTGGGAGG + Intronic
1033230787 7:139595891-139595913 CTGGCAGCGCTGGGCCTGGGAGG + Intronic
1033842028 7:145386566-145386588 GTGGCAGCTCTGCTGTTGAGGGG + Intergenic
1033842052 7:145386725-145386747 GTGGCATTCCTGTTGCTGGAGGG + Intergenic
1034706736 7:153152451-153152473 CTGGGAGCCCTGAAGCTGGGTGG + Intergenic
1034885195 7:154793805-154793827 GTGGCTGCCCTGGGGGTGAGGGG - Intronic
1035386074 7:158474080-158474102 AGGTCAGCCCTGGCGCTGGGCGG + Intronic
1036913803 8:12785383-12785405 GTGGCAGCCCTGCTGCTGGAGGG + Intergenic
1037741216 8:21610642-21610664 GTCGTAGCCCTGGTTCTGGATGG - Intergenic
1037815480 8:22109542-22109564 GGGGCCGCCCTGGAACTGGGGGG + Intergenic
1039465930 8:37784840-37784862 CTGGCAGCCAGGGTGCTGGTTGG + Intronic
1041082674 8:54228188-54228210 GTGGCAGCCCAGGTGGTGAGAGG + Intergenic
1041179734 8:55235135-55235157 CTGGCAGTCCTGGTGCTCGTTGG + Intronic
1041390457 8:57343120-57343142 GTGCCAGGCCCTGTGCTGGGGGG - Intergenic
1041852362 8:62405612-62405634 GCGGCAGTGCTGCTGCTGGGTGG + Intronic
1042591572 8:70402982-70403004 GTGTCAGCCCCGGGGGTGGGGGG - Intronic
1042633247 8:70844263-70844285 GTGGCAACCCTGATGCTAGAGGG - Intergenic
1042877124 8:73449644-73449666 CTGTCTGCCCTGGGGCTGGGTGG + Intronic
1047314352 8:123718603-123718625 AAGGCAGCACTGGTGCTGGGGGG + Intronic
1049191522 8:141290657-141290679 TTGGCAGCCCTGGAGGAGGGCGG - Intronic
1049253820 8:141603453-141603475 GTGGAGGCCCTGGATCTGGGAGG - Intergenic
1049339711 8:142105591-142105613 GTGAGAGCCCTGGTGGTGGGTGG - Intergenic
1049346911 8:142144057-142144079 GGGGCAGCCCTGGTGCCCAGGGG - Intergenic
1049688577 8:143949118-143949140 GGCGGAGCCCTGGTGCTGGCTGG - Intronic
1049797376 8:144502961-144502983 GTGGCAGCCCTGGTGGCAGGTGG - Intronic
1049826245 8:144670628-144670650 GTGGCAGCCCTGGGGTTAGCAGG - Intergenic
1050684766 9:8155572-8155594 GTGCCAGGCCCTGTGCTGGGGGG - Intergenic
1051991876 9:23161686-23161708 GTGGCAGCAGTGGAACTGGGTGG - Intergenic
1052608979 9:30744295-30744317 GTGGTGGTCCTGCTGCTGGGAGG + Intergenic
1052857914 9:33418440-33418462 GTGTCAGCCATGGGGATGGGTGG - Intergenic
1052929993 9:34048545-34048567 GAGGCACCCCTGGGGCTGGGTGG + Intronic
1056226551 9:84501189-84501211 GTGGCTCCCCTGGTGATGGTAGG - Intergenic
1056534621 9:87516847-87516869 GTGGCAGTCAGGGTGCTGGCAGG + Intronic
1056755906 9:89382006-89382028 GTGGCTGCTCTGGAGCTCGGAGG - Intronic
1056821528 9:89845524-89845546 GGGACAGCCCTTGTGCAGGGAGG - Intergenic
1057666135 9:97046936-97046958 GGGGCAGCACTGGTGTGGGGAGG - Intergenic
1058098324 9:100888788-100888810 GTCTTGGCCCTGGTGCTGGGTGG - Intergenic
1058599748 9:106656477-106656499 GTGACTGCCATAGTGCTGGGGGG - Intergenic
1059061549 9:111038724-111038746 GTGGCAGGGCCGGGGCTGGGGGG + Intergenic
1060344222 9:122802657-122802679 GTAGCAGCTCTGGGACTGGGCGG - Intronic
1060794233 9:126503735-126503757 CTGGCAGCCCTGGGCCGGGGAGG - Exonic
1060945433 9:127567465-127567487 GTGCCAGGCCTGGGGCTGGCTGG - Intronic
1061431378 9:130533413-130533435 GAGCCAGCACTGGGGCTGGGTGG + Intergenic
1061670002 9:132183265-132183287 GTGACAGCCCTAATGCTGGCCGG - Intronic
1061861823 9:133472311-133472333 GGGGGAGCCCTGGTGTGGGGGGG - Intronic
1061967865 9:134026061-134026083 GGGGCAGCCTGGGAGCTGGGTGG - Intergenic
1062028446 9:134351205-134351227 GTGGCAGGTCTGGGGCTAGGAGG + Intronic
1062109796 9:134775880-134775902 GTGGCCGCCCTGGGGCATGGAGG + Intronic
1062136003 9:134928894-134928916 GTGGCAGCTCTGGTGCCTGGAGG - Intergenic
1062247354 9:135576061-135576083 GTGGGGGCCCAGGTGCCGGGGGG - Intergenic
1062332791 9:136051838-136051860 GCGGGAGCCCTGGGGCGGGGAGG + Intronic
1062389824 9:136329535-136329557 GTGGATGCCCTGGAGGTGGGCGG + Intronic
1062431208 9:136527635-136527657 GTGGGAGCCCGAGAGCTGGGTGG - Intronic
1062444789 9:136589035-136589057 GAGGGAGCCCAGCTGCTGGGAGG + Intergenic
1062478949 9:136742686-136742708 CTGGTAGCCCTGCTCCTGGGCGG + Intronic
1062521569 9:136960036-136960058 GTGTGGGCCCAGGTGCTGGGCGG - Intergenic
1062549164 9:137078076-137078098 GTGGCCGTCCTGCTGCTGGCTGG + Exonic
1062568183 9:137172507-137172529 GCCGCAGCCCTTATGCTGGGAGG - Intergenic
1062595738 9:137298386-137298408 GTGGCAGCCATGTGCCTGGGAGG + Intergenic
1062670442 9:137705804-137705826 GTGGCAGTCTTGGGGCTGTGAGG + Intronic
1185616727 X:1426481-1426503 GAGGGACCCCTGGTGTTGGGAGG + Intronic
1187194805 X:17072750-17072772 GAGGCTGCCTTGGGGCTGGGTGG - Intronic
1187405117 X:18996796-18996818 GTGGCAGCCATGGGGCTGGCTGG - Intronic
1188809701 X:34638186-34638208 CTGGCAGACCTGGGCCTGGGAGG - Intronic
1188871915 X:35382897-35382919 GTGGCTGCAGTGGTGGTGGGTGG + Intergenic
1189472803 X:41327377-41327399 GTGGAAGCACAGGTGCCGGGAGG + Intergenic
1190113328 X:47609400-47609422 GGGGGAGCCCTGGGGCTGGGAGG - Intronic
1190879569 X:54483077-54483099 GTGGCGGACCTGGGTCTGGGGGG + Intronic
1192788072 X:74354170-74354192 GTGGCTGGCTTGGTGCTGGGTGG - Intergenic
1192788132 X:74354386-74354408 GGAGCTGGCCTGGTGCTGGGTGG - Intergenic
1195962843 X:110403193-110403215 GTAGAATCCCTGGGGCTGGGGGG - Intronic
1196124734 X:112085106-112085128 TTGTCAGCCTTGGGGCTGGGTGG + Intergenic
1197367981 X:125589795-125589817 GTGGTAGCCTGGTTGCTGGGAGG - Intergenic
1198171500 X:134110138-134110160 GTGGCTGCCCAGGGGCTCGGGGG - Intergenic
1199980313 X:152917132-152917154 GTGGGAGCCCTTGTGCTCGGAGG - Exonic
1200114549 X:153764476-153764498 GTGGTAGCCCTGGGGTTAGGAGG + Intronic
1201176045 Y:11308605-11308627 GTGTCAGGCCTGGAGCTGTGCGG - Intergenic