ID: 1105993804

View in Genome Browser
Species Human (GRCh38)
Location 13:25650202-25650224
Sequence CACTTGTGTGGTCCACAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105993804_1105993806 0 Left 1105993804 13:25650202-25650224 CCATGCTGTGGACCACACAAGTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1105993806 13:25650225-25650247 ACTCTGACTTATTCCTAACTTGG 0: 1
1: 0
2: 0
3: 7
4: 94
1105993804_1105993808 2 Left 1105993804 13:25650202-25650224 CCATGCTGTGGACCACACAAGTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1105993808 13:25650227-25650249 TCTGACTTATTCCTAACTTGGGG 0: 1
1: 0
2: 1
3: 4
4: 177
1105993804_1105993807 1 Left 1105993804 13:25650202-25650224 CCATGCTGTGGACCACACAAGTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1105993807 13:25650226-25650248 CTCTGACTTATTCCTAACTTGGG 0: 1
1: 0
2: 1
3: 8
4: 153
1105993804_1105993810 16 Left 1105993804 13:25650202-25650224 CCATGCTGTGGACCACACAAGTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1105993810 13:25650241-25650263 AACTTGGGGAGTTTTCACCAAGG 0: 1
1: 0
2: 0
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105993804 Original CRISPR CACTTGTGTGGTCCACAGCA TGG (reversed) Intronic
901469701 1:9447836-9447858 CCCTTGTTTCATCCACAGCAGGG - Intergenic
902858522 1:19227279-19227301 CAGCTGTCTGGTCTACAGCAAGG - Intronic
902932709 1:19742674-19742696 CACGGGTGTGACCCACAGCAAGG + Intronic
904356376 1:29942716-29942738 CCCTTATGTGTTCCAGAGCAGGG - Intergenic
905678331 1:39846232-39846254 CAGTTTAGTGGTCAACAGCAGGG + Intronic
906019189 1:42612361-42612383 CCCATGTGTGTTTCACAGCAAGG + Intronic
908532797 1:65049630-65049652 CACTGCTGTGGTCCACAGATGGG + Intergenic
909221584 1:72969183-72969205 CACATGTGTGGTTCACAATAAGG + Intergenic
909784030 1:79586883-79586905 CTGTTCTGTGGTCCACAGAATGG - Intergenic
911268210 1:95768568-95768590 AACATGTGGGGTCCAAAGCAGGG - Intergenic
913277007 1:117147973-117147995 CACTGGAGTGGACCACAGAATGG - Intronic
914923238 1:151861337-151861359 CACTTCTGCTGTCCACAGCTGGG + Intergenic
919824303 1:201492819-201492841 CACATGTGTGGCCCACTGGAGGG - Intronic
922204722 1:223436371-223436393 CACTTGGGTCTTCCACTGCATGG - Intergenic
923738734 1:236636127-236636149 CACTTATCTTGTCCACAGCCGGG - Intergenic
1065516241 10:26527129-26527151 CACCTTTATGGTCCCCAGCATGG + Intronic
1074637537 10:115337958-115337980 CACATGTGTAGTTCACAGTAGGG + Intronic
1077019080 11:409585-409607 CACTGCTGGGGCCCACAGCAGGG - Intronic
1078425619 11:11248440-11248462 CACTTGTGTGATGCAGAGTAGGG - Intergenic
1079134058 11:17766200-17766222 CACTTGGGTGCTGCACTGCAAGG - Intronic
1089791764 11:120950604-120950626 CACTAGTGTGGTCCACTCCTGGG - Intronic
1091581290 12:1791772-1791794 CACCTGTGCGGCACACAGCAGGG - Intergenic
1091703406 12:2678610-2678632 CCCCTGTGTGTTCCACAGCCTGG - Intronic
1092554578 12:9543428-9543450 CACATGTGCAGTTCACAGCAGGG + Intergenic
1094574218 12:31669357-31669379 CACTTGTGAAGGTCACAGCAGGG - Exonic
1100493929 12:95107005-95107027 CACTGGTGTTGTATACAGCAGGG + Exonic
1103701345 12:122850274-122850296 CACCTATGTGGGCCACAGCCTGG + Intronic
1104970706 12:132529420-132529442 CACTTGGCTGGGTCACAGCAGGG + Intronic
1105031661 12:132888149-132888171 CACGTGTGTGCTCCAGAGAAGGG + Intronic
1105772654 13:23627572-23627594 CGCTTGTCTGTGCCACAGCAGGG + Intronic
1105993804 13:25650202-25650224 CACTTGTGTGGTCCACAGCATGG - Intronic
1106142199 13:27020756-27020778 CACATGTGTAGTCCACAATAGGG - Intergenic
1106558647 13:30830848-30830870 CACCTGTCTGGACCACATCAGGG - Intergenic
1108472268 13:50779414-50779436 GACTTGTGTGCTACACAGCCAGG + Intronic
1116476069 14:45341150-45341172 AACTTGTGTGTTACATAGCAAGG + Intergenic
1121412334 14:93756697-93756719 CACTGGGGTGGTCCACAGGCCGG + Intronic
1124925415 15:34065772-34065794 CAGTAGTGTGGTACACAGCAAGG + Exonic
1126237346 15:46401430-46401452 TACGTGTGGGGTCCACAGAATGG - Intergenic
1130312544 15:82767899-82767921 CACCCCTGTGTTCCACAGCAGGG + Intronic
1132263853 15:100449044-100449066 CACATGCGTGCACCACAGCAGGG + Intronic
1136612840 16:31377723-31377745 GGCATGTGTGGTCCACAGCTTGG + Intronic
1137555762 16:49469345-49469367 CACTTCTGTGCCCCCCAGCACGG + Intergenic
1137802194 16:51271501-51271523 CACTTGGGTGCTGCACAGCTGGG + Intergenic
1138070318 16:53986471-53986493 CATTTGTGTGGTACACAGGAAGG + Intronic
1143580717 17:7824168-7824190 CACTGGTGGGGTCCACACCAGGG - Exonic
1147113800 17:38283703-38283725 GAACTGTATGGTCCACAGCAGGG + Intergenic
1148090169 17:45018734-45018756 ACCTTGTGGGGTCAACAGCATGG - Intergenic
1148415805 17:47505485-47505507 GAACTGTATGGTCCACAGCAGGG - Intergenic
1151231882 17:72690811-72690833 CACTTGTGAAGGTCACAGCAGGG + Intronic
1151935448 17:77258178-77258200 CCCGTGTGTGGCCCACAGCAAGG + Intergenic
1154205291 18:12330954-12330976 TATTTGTGTGGTCCAATGCATGG - Intronic
1161125063 19:2551149-2551171 CACTTGTGTGTCCCAGAGGACGG + Intronic
1161670800 19:5607844-5607866 CATTTGTGTGGTCAAAACCAAGG - Intronic
1164548464 19:29188220-29188242 AATTTCTGTGGTCCAAAGCAGGG - Intergenic
925049999 2:806026-806048 AACCTGTGTGTTCCACAGCTGGG + Intergenic
926914662 2:17879781-17879803 CACTCGGGTGGCCCGCAGCAGGG + Intronic
927207602 2:20619885-20619907 CACCCGTGTGGCCCACAGCGGGG - Intronic
928235751 2:29537916-29537938 CACAAGTGTGGAACACAGCAGGG - Intronic
928675233 2:33644545-33644567 CACATGTGTGGTGCACAATAGGG - Intergenic
929594699 2:43168833-43168855 CACTTGACTGGCCCACAGCCAGG + Intergenic
932459065 2:71870805-71870827 CTCTTGTCTCTTCCACAGCAGGG - Intergenic
938115671 2:128601708-128601730 CACTTGGAGGGTCCACAGAAGGG + Intergenic
939739109 2:145884384-145884406 CACATGTGTGTTAGACAGCATGG + Intergenic
942495107 2:176531979-176532001 CTCTTGTGTGTGCCACATCAGGG - Intergenic
943248143 2:185482938-185482960 CACATGTGTAGTTCACAGTACGG - Intergenic
945239164 2:207660665-207660687 CACCAGTGAGGTCCACAGGAAGG + Intergenic
947571649 2:231240361-231240383 AAATTGTGTGGTCTAAAGCAGGG + Intronic
948151757 2:235750000-235750022 CACCTGCGTGGTGCACAGAAGGG + Intronic
1168997579 20:2144621-2144643 CTCTTGTGTGGAACACAGCTGGG + Exonic
1169335490 20:4752546-4752568 CACTTGCATGGTCCCCACCAAGG + Intergenic
1169977844 20:11350646-11350668 CACCTGTGTGGGGCACAGCACGG + Intergenic
1171937538 20:31289546-31289568 CACCTGAGTGCACCACAGCAAGG - Intergenic
1175378172 20:58543616-58543638 CACTTGCGTGGACCCCAGAAAGG + Intergenic
1176118029 20:63441674-63441696 CATCTGTATGGTCCACAGCCTGG + Intronic
1178348699 21:31854343-31854365 CACTTGGGTGTGTCACAGCAGGG + Intergenic
1182129436 22:27840172-27840194 CACTTGTAAGGGCCACAGGAAGG + Intergenic
1183221606 22:36517567-36517589 CGCTTATGTGTTCCACACCAGGG - Intronic
1185048002 22:48538559-48538581 AGCTTCTGTGGCCCACAGCAGGG + Intronic
950458628 3:13107708-13107730 CAATTGAGTGGTCCCCACCAGGG - Intergenic
951029702 3:17867787-17867809 CACATGTGTAGTTCACAGAATGG - Intronic
951288538 3:20846231-20846253 CACATGAATGGGCCACAGCATGG + Intergenic
951315116 3:21180094-21180116 CACTTGTGTGGACCCCACCTTGG - Intergenic
952494069 3:33900757-33900779 CATTGGTGGGTTCCACAGCAGGG + Intergenic
956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG + Intergenic
967291343 3:187923691-187923713 CACTTGTGAACTACACAGCATGG + Intergenic
967992079 3:195138984-195139006 CACCTGTGTGGGCAACAGCCAGG + Intronic
968800713 4:2741887-2741909 CACTTGTATGGTCCCCAGGGTGG - Exonic
969300407 4:6293974-6293996 CACTTGTGTGGGCCCCCCCAAGG + Intronic
972908370 4:43780325-43780347 CATTTCTATGGTCCTCAGCAGGG - Intergenic
980974600 4:139598710-139598732 CACGTGTGTGGTTCACAATAGGG - Intronic
981432426 4:144677052-144677074 CTCTTCTGTGGTAAACAGCAAGG + Intronic
989154327 5:38329770-38329792 CACTTTAGTGGCCCATAGCAAGG - Intronic
990263245 5:54048069-54048091 AACTTCTGTGCTCAACAGCAGGG - Intronic
993697586 5:91079939-91079961 CACCTTGGTGGTCCACATCATGG + Intronic
997341606 5:133149467-133149489 CAATTGTGTGCTCCTCAGCAGGG + Intergenic
1002033339 5:176447212-176447234 CACCTGTGTGATTCTCAGCAAGG - Intergenic
1003257074 6:4483891-4483913 CAAGTGTGTAATCCACAGCATGG + Intergenic
1003516144 6:6820778-6820800 TGATTGTGTGGTTCACAGCAGGG + Intergenic
1005607963 6:27494414-27494436 CATATGTGTGGACCAAAGCATGG - Intergenic
1005677918 6:28174886-28174908 CACTTGTGTAGCCCACACCCAGG + Intergenic
1006276044 6:33006471-33006493 CACCTGTGTGGGCCCCAGGATGG + Exonic
1006283518 6:33076110-33076132 CACATCTGTGGTCCAGGGCAGGG + Exonic
1006287959 6:33112584-33112606 CATATCTGTGGTCCAGAGCAGGG + Intergenic
1014976588 6:127892262-127892284 CACTTGTTCTGTCCTCAGCAGGG + Intronic
1016041468 6:139436184-139436206 AAAATGTGTGATCCACAGCAGGG + Intergenic
1018459791 6:163986610-163986632 CTCTTGTGTGGTGCTCACCATGG + Intergenic
1019582890 7:1776607-1776629 CACCTCTGGGGTCCAGAGCATGG - Intergenic
1024039656 7:45542372-45542394 CACCTGTGGGGTGCACAGAAGGG - Intergenic
1027990698 7:85357017-85357039 CATTTCTGTGCTCCACTGCAAGG + Intergenic
1033962828 7:146934855-146934877 CATTTGTTCGGTCCACAGCACGG - Intronic
1034135245 7:148761925-148761947 CACGTGTGTAGTTCACAGTAGGG + Intronic
1034705769 7:153142353-153142375 CACTAGTGTGGTCAACAAAATGG + Intergenic
1039079994 8:33724540-33724562 TACTTGTGTTGTGCAAAGCAAGG + Intergenic
1041691310 8:60690668-60690690 CACCTGTGTGCTCCACAGTGTGG - Intronic
1045972955 8:108100583-108100605 CACTCTTGTGGTCTACAGAAAGG - Intergenic
1047178421 8:122564390-122564412 CACATGTGTAGTCTATAGCAAGG - Intergenic
1048556101 8:135478026-135478048 CACATGTGCAGTTCACAGCAGGG - Intronic
1050207054 9:3208193-3208215 CACTTGTTTGTTCAACAGCAGGG - Intergenic
1051552275 9:18343395-18343417 CACTGGTGGGGTCCAGATCATGG - Intergenic
1052235590 9:26210451-26210473 CACATGTGCGTACCACAGCAGGG + Intergenic
1052274441 9:26661560-26661582 CAGTTGGGTGGACCAGAGCACGG - Intergenic
1057310401 9:93939343-93939365 CTGTGGAGTGGTCCACAGCATGG - Intergenic
1057548679 9:96036436-96036458 CACTTGGGTTGTCCACCTCATGG + Intergenic
1060410450 9:123396416-123396438 CCCCTGTGTGATCCACAGCTGGG + Intronic
1061256792 9:129458298-129458320 CACATGTGAGGCCCAGAGCAGGG + Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185885007 X:3774704-3774726 CATTTGTCTGTTCCACAGCAAGG - Intergenic
1189417913 X:40831449-40831471 CACTTGTATGGTCCCCAGGGTGG - Intergenic
1190257601 X:48775132-48775154 CACTTGCGTGGACCACTGCAGGG - Intergenic
1192274367 X:69615192-69615214 TACAAGTGTGGTCCACAGAATGG - Intergenic
1199646348 X:149917034-149917056 CACTTGTGCAGGTCACAGCAAGG - Intergenic
1201077602 Y:10199355-10199377 CACATGTGGGGGCCACGGCAGGG - Intergenic
1201238875 Y:11938656-11938678 CACATGTGTAGTTCACAGGAGGG - Intergenic