ID: 1105994249

View in Genome Browser
Species Human (GRCh38)
Location 13:25654968-25654990
Sequence TACCGAAGGGTGATGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105994243_1105994249 2 Left 1105994243 13:25654943-25654965 CCAGGGTTATGTTAACTGCCCAG 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1105994249 13:25654968-25654990 TACCGAAGGGTGATGTGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1105994241_1105994249 19 Left 1105994241 13:25654926-25654948 CCAAAATTGGTACTCATCCAGGG 0: 1
1: 0
2: 3
3: 6
4: 95
Right 1105994249 13:25654968-25654990 TACCGAAGGGTGATGTGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105994249 Original CRISPR TACCGAAGGGTGATGTGGAC AGG Intronic
904023207 1:27484228-27484250 TACTGTAGAGTGAGGTGGACTGG - Intronic
916192247 1:162191133-162191155 TACATAAGGCTGATATGGACGGG - Intronic
916901043 1:169224169-169224191 TACAGAAGGGAGATCTGGCCTGG - Intronic
1065783408 10:29191333-29191355 TACCGAAGGGTGATTTTGTTTGG + Intergenic
1066405843 10:35117235-35117257 TCACGAAGGCTGGTGTGGACTGG + Intergenic
1070499859 10:77062534-77062556 TACAGAAGGGAGATGATGACTGG - Intronic
1071138000 10:82473682-82473704 CACCGAAGGGAGCTGAGGACTGG - Intronic
1077972113 11:7205379-7205401 TACTGGAGGGTGGTGTGCACAGG + Intergenic
1081097108 11:38950732-38950754 TACTGAAGGCTGATGAGAACTGG + Intergenic
1090711829 11:129393279-129393301 TCCCAAAGGGTGATCAGGACCGG - Intronic
1102489401 12:113280359-113280381 TACAGATGGGTGATGGGCACGGG - Intronic
1105994249 13:25654968-25654990 TACCGAAGGGTGATGTGGACAGG + Intronic
1109775286 13:67032458-67032480 TTACGAAGAGTGATGTTGACCGG - Intronic
1111334270 13:86800761-86800783 TGCAGAAGGGTGATGTGGGTGGG + Intergenic
1116131235 14:40857244-40857266 TACCAAAGGGTGATGTGCTGGGG + Intergenic
1116734178 14:48668177-48668199 TACTTAAGCTTGATGTGGACAGG - Intergenic
1122709883 14:103648538-103648560 TTTCGGAGGGTGAAGTGGACAGG + Intronic
1124388153 15:29227017-29227039 TGCCGAAGGGTGATCTGAGCAGG - Intronic
1135944383 16:26852986-26853008 TAGCGAAGGGTGATGTTGGGTGG - Intergenic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1151955051 17:77376009-77376031 CAGCCAGGGGTGATGTGGACAGG + Intronic
1155169046 18:23253608-23253630 TCCCAGAGGGTGATCTGGACTGG - Intronic
1157311606 18:46557203-46557225 CACCTAAGGGTGAGGTGTACTGG - Intronic
1159549208 18:69877369-69877391 TCCTGGAGGGTGATGTGGACAGG - Intronic
1162464638 19:10832472-10832494 TAACAAAGGGTGGTGTGGCCTGG - Exonic
926702634 2:15813885-15813907 TACCCAAAGGTGATGTCCACAGG - Intergenic
940468479 2:154063062-154063084 TACAGAAGGGTGTTGGGGAGAGG + Intronic
944019638 2:195086715-195086737 TAGCAGAGGGTGATGGGGACTGG - Intergenic
946535490 2:220623319-220623341 TACTGAAGAGTGATGGGGATGGG + Intergenic
1179655059 21:42839690-42839712 CACCGAGGGGTGATGTGCAGAGG + Intergenic
949350273 3:3118760-3118782 TAGGGAAGGCTGATGTGGAGGGG + Intronic
949840072 3:8310969-8310991 TACCGATGGGTGGTCTGGAAGGG - Intergenic
950983302 3:17332152-17332174 TACAGAAGAGTGAAGTGGCCTGG + Intronic
953768176 3:45759954-45759976 TACTGGAAGGTGATGTGGGCTGG - Exonic
954860262 3:53682283-53682305 TTCAGAAGGGTGAGGTGGAAGGG + Intronic
955378181 3:58415506-58415528 TCCTGAAGGGTGATGTGCCCAGG - Intronic
957954867 3:87173472-87173494 TACCTAGGAGTGATGTGTACAGG + Intergenic
961759263 3:129153539-129153561 TACGGGAGGGTGAGGTGGGCAGG + Intronic
962166521 3:133054993-133055015 TACTGAAGGGTGATGGAGATTGG + Intronic
963066548 3:141268979-141269001 TACCTAGGGGTGGTGTGGACGGG - Intronic
967258166 3:187614287-187614309 TACAGAAGAGTCATGTGGAAGGG - Intergenic
983273296 4:165588552-165588574 AACCCAAGGGTGCTGTGCACAGG - Intergenic
1000889686 5:166787780-166787802 TCCCCAAGGGTGATGTGGAGTGG + Intergenic
1004414608 6:15414113-15414135 TACAGTAGGGTGATGGGGAAAGG + Intronic
1007625560 6:43244249-43244271 TAGCGAGGGGTGATGGGAACAGG - Intronic
1024350667 7:48359575-48359597 TCCCCATGGTTGATGTGGACTGG + Intronic
1028907763 7:96174131-96174153 GACCCAAAGGTGATGGGGACAGG - Intronic
1029090596 7:98045093-98045115 CACTGAAGGGTGATGTGGTTAGG + Intergenic
1029857538 7:103532806-103532828 TATCGTAGGGTGATGTGACCTGG - Intronic
1040338439 8:46427859-46427881 GGCCGAAGGGTGGTGTGGTCTGG + Intergenic
1040338944 8:46430200-46430222 GGCCGCAGGGTGGTGTGGACGGG + Intergenic
1049298295 8:141855489-141855511 TACCGGAGGGTGAGGGTGACAGG + Intergenic
1051072760 9:13192784-13192806 TAATGAAGGGTGATGAGAACTGG + Intronic
1052722035 9:32183601-32183623 GAGAGAATGGTGATGTGGACAGG + Intergenic
1058674898 9:107391966-107391988 CAATGAAGGGTGCTGTGGACTGG + Intergenic
1059554345 9:115264147-115264169 TACAGGAGGGAGATGTGGAGTGG + Intronic
1062034849 9:134378461-134378483 TCCCGAAGGGTCCTGTGGCCTGG + Intronic
1186722608 X:12321956-12321978 TTCTGCAGGGTGATGTGGAAGGG + Intronic
1188708833 X:33369004-33369026 TACCAAAGGGTCAAGTGCACTGG - Intergenic
1198609699 X:138383804-138383826 TACAGAAGGGTCATGTGGCTGGG + Intergenic