ID: 1106000936

View in Genome Browser
Species Human (GRCh38)
Location 13:25722409-25722431
Sequence GTGCTGCCTGCATTTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 252}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106000923_1106000936 27 Left 1106000923 13:25722359-25722381 CCAAGACTTCCTTGAACAAGGCC 0: 1
1: 0
2: 2
3: 13
4: 112
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000930_1106000936 -8 Left 1106000930 13:25722394-25722416 CCCATTCCCTATAGGGTGCTGCC 0: 1
1: 0
2: 0
3: 8
4: 179
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000931_1106000936 -9 Left 1106000931 13:25722395-25722417 CCATTCCCTATAGGGTGCTGCCT 0: 1
1: 0
2: 0
3: 5
4: 213
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000929_1106000936 -7 Left 1106000929 13:25722393-25722415 CCCCATTCCCTATAGGGTGCTGC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000926_1106000936 6 Left 1106000926 13:25722380-25722402 CCATCAGGAAGTTCCCCATTCCC 0: 1
1: 0
2: 2
3: 34
4: 193
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000922_1106000936 28 Left 1106000922 13:25722358-25722380 CCCAAGACTTCCTTGAACAAGGC 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252
1106000925_1106000936 18 Left 1106000925 13:25722368-25722390 CCTTGAACAAGGCCATCAGGAAG 0: 1
1: 0
2: 2
3: 25
4: 212
Right 1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106000936 Original CRISPR GTGCTGCCTGCATTTTGCTG GGG Intronic
900578938 1:3398503-3398525 GGGCTGGCTGCATTGAGCTGGGG - Intronic
900711178 1:4115364-4115386 CTGCTGCCTGCATTCTGCTCAGG + Intergenic
900920254 1:5665584-5665606 GTGCTGGCTGCCTTGTGATGGGG - Intergenic
901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG + Intronic
901876123 1:12167869-12167891 CTGCTGTCTCCATTTTCCTGCGG - Intronic
903293869 1:22331601-22331623 GTGATGCCCCCATTTTGCTGGGG - Intergenic
905515559 1:38559430-38559452 CTGCTACGTGCATTTTGCAGAGG + Intergenic
908749739 1:67409305-67409327 GGGCTGCCTACATTTTTCTGTGG + Intronic
909123416 1:71634353-71634375 GTGCTGCCTGCATTTGGCCATGG - Intronic
910141758 1:84033922-84033944 GTTCTGCCTGAATTGGGCTGTGG - Intergenic
915332773 1:155124043-155124065 GCCCTGCCAGCTTTTTGCTGGGG - Intergenic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
916486510 1:165264593-165264615 GGGATGTCTGCATTTTGCTGCGG + Intronic
916651096 1:166835478-166835500 GTGCTGTCTGCAATTTGGAGAGG - Intergenic
919236541 1:194852010-194852032 GTGCTGGGTGCTTTTTGCTTGGG + Intergenic
919301234 1:195769296-195769318 GGGCTGCCTGAATTTTGCAATGG + Intergenic
923264811 1:232304239-232304261 GGGCTGCTGGCATTTTGGTGGGG + Intergenic
924113926 1:240727163-240727185 ATGCTGCCTCCTTGTTGCTGAGG + Intergenic
924304227 1:242670904-242670926 TTGATGCCAGCATTTTGCTATGG + Intergenic
924554565 1:245107631-245107653 GGGCTGCTTGCATTTGGCAGGGG + Intronic
1062960153 10:1567372-1567394 GTGGTGCCTGGATGTGGCTGTGG + Intronic
1063116122 10:3073237-3073259 GTGATGCCTCCATTCTGCAGAGG - Intronic
1064120110 10:12611230-12611252 GGGTTGCCTGCACTTTGATGGGG - Intronic
1066477006 10:35757292-35757314 GTGCTTCCTCCATCTTCCTGGGG + Intergenic
1066624276 10:37390497-37390519 AGGCTGCCTCCATTGTGCTGTGG - Intergenic
1067700700 10:48569281-48569303 GCACTGGCTGCATTTTGCTGAGG + Intronic
1067742419 10:48905680-48905702 GGGGTGTCCGCATTTTGCTGAGG - Intronic
1068285334 10:54926342-54926364 GGTCTGCCAGTATTTTGCTGTGG + Intronic
1068820034 10:61364504-61364526 GTGATGGATGCATTTTGGTGAGG + Intergenic
1069079527 10:64073359-64073381 GTGCTGCCTGGAATTCCCTGTGG + Intergenic
1069659432 10:70113903-70113925 GTGCTGGCTGCATGGTGCTGGGG - Exonic
1071901511 10:90125354-90125376 CTGTTGCCTGCGTTTTCCTGTGG + Intergenic
1074015631 10:109530832-109530854 TTGCTGCCTGCTTTTTCCTCTGG - Intergenic
1074894320 10:117761932-117761954 CTGCTGGCTGCCTTTAGCTGTGG - Intergenic
1075227502 10:120642944-120642966 GTGGAGCTTGTATTTTGCTGTGG + Intergenic
1076124209 10:127961780-127961802 GTGCTGCCTGCAGTCTTGTGGGG - Intronic
1076193197 10:128497585-128497607 CTGCTGGCTGGTTTTTGCTGAGG - Intergenic
1078754151 11:14192990-14193012 GAGCTGCATGCATTCTGCTCTGG - Intronic
1080041940 11:27768267-27768289 GTGCTGCCTGCTTTTTATTCTGG + Intergenic
1081567788 11:44270502-44270524 TTGCTGCCTCCAATTTACTGGGG - Intronic
1082938716 11:58680826-58680848 GTAGTGACTGCATTGTGCTGGGG - Intronic
1083713356 11:64562031-64562053 GTGCTGCCTGCAGTTGGCCGTGG + Exonic
1084195632 11:67522570-67522592 GGCCTGCCTGCATCTTCCTGCGG - Exonic
1084724863 11:70934877-70934899 GAACTGCCTGCATTTTGCCGGGG + Intronic
1086955653 11:92932357-92932379 GTGCTGCATACATTATGCTACGG - Intergenic
1090026393 11:123171042-123171064 GAGCTGGTTGCTTTTTGCTGTGG - Intronic
1090446020 11:126765505-126765527 GTGTCTCCTGCATTTAGCTGTGG + Intronic
1091470971 12:726870-726892 GAGTTGTCTGCATTTTACTGAGG + Intergenic
1091906576 12:4194399-4194421 TTGCTGTCTCCATTTTGCAGAGG + Intergenic
1092254065 12:6916730-6916752 GTGAGGCCTGCTCTTTGCTGGGG + Intronic
1095239688 12:39842543-39842565 TTTCTGCCTCCATTTTACTGGGG - Intronic
1096536916 12:52280781-52280803 GTGCTCCTTGCATTTTGCTAGGG + Intronic
1097488525 12:60235449-60235471 TTGCTGCCTGCTTTTTCCTCTGG - Intergenic
1099644536 12:85335410-85335432 GTGCTGCCTGAATTATGGTATGG + Intergenic
1099779542 12:87176111-87176133 ATGCTGCCAGCTTTTTGCTTAGG - Intergenic
1100904847 12:99286100-99286122 GTGCTGCCTGGAGTTGGCTGAGG - Intronic
1102027959 12:109724148-109724170 GAGCTGCCAGCAGTTTGCTGAGG - Intronic
1102051355 12:109864331-109864353 GGGCTGCCTGCAATTAGCAGTGG + Intronic
1105940473 13:25142864-25142886 GGGCTGCATGGTTTTTGCTGTGG - Intergenic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1108350861 13:49589657-49589679 GTTCCACCTGCATTTAGCTGTGG + Intergenic
1109104959 13:58239306-58239328 CTTCTGCCTGAATTCTGCTGAGG + Intergenic
1110924861 13:81138367-81138389 ATGCTGCCTCCATTTTGCCCAGG - Intergenic
1111342736 13:86909503-86909525 GTTCTGCCAGCACTTTGTTGGGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1118241421 14:64062805-64062827 GAACTGTCTCCATTTTGCTGAGG - Exonic
1119005117 14:70918686-70918708 GATCTGCCTGCATTTTGCAGAGG + Intronic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1123177958 14:106439853-106439875 GAGCTGCCTGCATTTCTCTTGGG + Intergenic
1124791042 15:32727254-32727276 GTGCTGCCAGTATTTTATTGAGG - Intronic
1128397726 15:67245859-67245881 GTTCTGTCTGAATTTTCCTGGGG - Intronic
1132526367 16:417617-417639 GTGCAGCCTGGATAGTGCTGAGG - Intergenic
1132729488 16:1354314-1354336 GTGGTGCGTGCATGTTGCTCGGG + Intronic
1134355617 16:13479391-13479413 ATACTGCCTTGATTTTGCTGAGG + Intergenic
1136707080 16:32200252-32200274 GTGCTGCCTCCACATGGCTGAGG + Intergenic
1136760830 16:32729165-32729187 GTGCTGCCTCCACATGGCTGAGG - Intergenic
1136807273 16:33141221-33141243 GTGCTGCCTCCACATGGCTGAGG + Intergenic
1138129319 16:54466165-54466187 GTGCTGCCTGCAGATAGGTGTGG + Intergenic
1138585965 16:57970715-57970737 CTGCTGACTGCACTTTGATGAGG + Intronic
1138617086 16:58177339-58177361 TTCCTGCCAGCATTTTGCAGTGG - Intronic
1139446259 16:67000541-67000563 ACGCTGCCTGGATTTTGCTTTGG + Intronic
1141422938 16:83928677-83928699 GTGCTGCCTTCATGATCCTGAGG - Intronic
1142382189 16:89739225-89739247 GGCCTTCCTGCATGTTGCTGTGG - Exonic
1203062982 16_KI270728v1_random:989479-989501 GTGCTGCCTCCACATGGCTGAGG - Intergenic
1143269968 17:5668230-5668252 GTGCTGCCTGCCTTCCCCTGAGG + Intergenic
1143762407 17:9114992-9115014 ATGCTACCTGCATTTTTCTTGGG + Intronic
1145272851 17:21413843-21413865 GTGCTGCCTGCAGTGAGCTGAGG + Intronic
1145311059 17:21701306-21701328 GTGCTGCCTGCAGTGAGCTGAGG + Intronic
1150240056 17:63623359-63623381 GTGCTGCACGCAGATTGCTGGGG + Intronic
1151721370 17:75858199-75858221 ATGCTGCCTGCTCTTTGCTGGGG - Intergenic
1152306555 17:79524370-79524392 GGGCTGCCTCCATTAAGCTGGGG - Intergenic
1152550375 17:81026821-81026843 GTGCTTCCTGCATGTCACTGGGG + Intergenic
1153602551 18:6795669-6795691 GTGCTGCAGGCTTTCTGCTGCGG - Intronic
1153619171 18:6960853-6960875 CTGCTTCCTACATTTTGCTGAGG - Intronic
1153884341 18:9449955-9449977 GTACTGGCTGCCTTTTTCTGAGG + Intergenic
1155210713 18:23598359-23598381 GAGATGCCTGTATTTTGGTGGGG - Intergenic
1158487693 18:57882221-57882243 GTGCAGCCTGCGTGCTGCTGCGG + Intergenic
1158557991 18:58490915-58490937 GTGCTTCCTGCATATTCATGGGG - Intronic
1159018785 18:63125867-63125889 TGGCTGGCTGCCTTTTGCTGTGG - Exonic
1160549135 18:79681848-79681870 GTGCTGCCTGGAATTTGAGGTGG + Intronic
1161160047 19:2756866-2756888 GTTCTGCCTGCATTTTGTGAGGG - Intronic
1162677562 19:12311230-12311252 GTGCTCTCTGCTTTTTCCTGTGG - Intergenic
1163008961 19:14412918-14412940 GTGCCGCCTCCAGTTTGCCGTGG - Intronic
1163728060 19:18933530-18933552 CTGCTGCCTGCACTGGGCTGCGG - Intronic
926888717 2:17620591-17620613 GTGATGACTGCATTCTACTGTGG - Intronic
927212151 2:20645557-20645579 GCCCTGCCTGCACTTTGCTCGGG - Intronic
931184936 2:59940627-59940649 GAGCTGGGTGCATTGTGCTGGGG + Intergenic
931627346 2:64268654-64268676 CTCCAGCCTGCAATTTGCTGAGG + Intergenic
931921249 2:67018451-67018473 GGGATGCATGTATTTTGCTGGGG - Intergenic
932280657 2:70489147-70489169 GTGCTGCCTGTCTGTTCCTGGGG + Intronic
932804610 2:74772589-74772611 TTCCAGCCTGCATTATGCTGTGG - Intergenic
933105960 2:78325450-78325472 TTGTTGCCTACATTGTGCTGGGG + Intergenic
933776084 2:85772118-85772140 GTGCAGGCTCCATTTAGCTGTGG + Intronic
934702827 2:96455507-96455529 TTGCTGCCTGCTTTTTCCTCTGG - Intergenic
935340069 2:102051841-102051863 GTGCTGCCTCCCTCTTCCTGGGG - Intergenic
935707781 2:105871430-105871452 GTGTTGCCTGCAGTCTGCTCAGG + Intronic
936295017 2:111261321-111261343 GTCCTTCCTGCATACTGCTGAGG - Intergenic
936940451 2:117878932-117878954 GTGCTGCCTAGGGTTTGCTGAGG + Intergenic
937113506 2:119385937-119385959 GCTCTGCCTGCATTCGGCTGGGG - Intergenic
939301408 2:140345065-140345087 CTGCTGCCAACATTTTGCTCAGG + Intronic
939987961 2:148850701-148850723 GTGTTGCCTGCATTTTGGAGGGG + Intergenic
939989015 2:148860066-148860088 CTGGTGCTAGCATTTTGCTGAGG + Intergenic
941527780 2:166628240-166628262 GTGCTGCCTCCAATTTGGGGAGG - Intergenic
941848165 2:170152119-170152141 GTGCTGCCTGTGTCTGGCTGAGG + Intergenic
942208306 2:173645899-173645921 GTGCTGCCTGGCTTATGATGAGG - Intergenic
943565870 2:189515543-189515565 GTGCTCCCTGTATTTTGGTCAGG - Intergenic
945769615 2:214025597-214025619 GTGTTTCCGGCATTCTGCTGTGG + Intronic
946171595 2:217898962-217898984 GTGCTGCCTGCATTTGATAGAGG - Intronic
946332029 2:219015318-219015340 GTGCTGCGTGCATTCTCCTCAGG - Intronic
948365110 2:237449725-237449747 GTCCTGCCTGCTTTCTGCTATGG + Intergenic
948484921 2:238274378-238274400 GTGCTTCCTGCAATGTGGTGAGG + Intronic
948574669 2:238942042-238942064 CTGCTTGCTGCATTTTGCTCTGG - Intergenic
948576171 2:238950952-238950974 GGGCTGCCTTCATTCTGCAGGGG - Intergenic
1170164423 20:13346544-13346566 GTGCTGCTAGCATAGTGCTGTGG - Intergenic
1170745931 20:19098957-19098979 GTGTGGCCTCCATTTTGCAGAGG + Intergenic
1170992633 20:21317841-21317863 GGGCTGACTGTATTTTGTTGAGG + Intronic
1171017238 20:21553094-21553116 GAGGTGCCAGCATTATGCTGGGG + Intergenic
1171278612 20:23878864-23878886 TTGCTGTCCTCATTTTGCTGAGG + Intronic
1171411001 20:24949155-24949177 GGGCTGCCTGCGTGGTGCTGGGG - Intergenic
1174093379 20:48067734-48067756 GTGTTGGCTGCATTTTATTGCGG + Intergenic
1175332488 20:58175094-58175116 GGCCTGCCTGCTGTTTGCTGTGG - Intergenic
1175453552 20:59091856-59091878 GTGCTGCCTCCATCCTGCAGAGG + Intergenic
1175947108 20:62564110-62564132 GCCCTGCCCGCATCTTGCTGAGG - Intronic
1175994978 20:62807989-62808011 GTGCTGCCTTCAGGGTGCTGAGG + Intronic
1177125914 21:17192753-17192775 TTGTTGGCTGCAATTTGCTGAGG + Intergenic
1177510725 21:22084198-22084220 TCACTGCCTACATTTTGCTGAGG + Intergenic
1178076060 21:29014122-29014144 ATGGTGCCTGCATTTTGCAAGGG + Intronic
1178617692 21:34147751-34147773 ATGCTGCCTGCATATTTGTGAGG + Intergenic
1180069759 21:45430444-45430466 CTGCTGCCTGCTGCTTGCTGGGG + Intronic
1180156454 21:45979784-45979806 GTGCTGCCTGCTTGGAGCTGTGG - Intergenic
1181696346 22:24594685-24594707 GTGCAGCCAGCATTGTCCTGGGG + Intronic
1183438391 22:37808520-37808542 GCGCTGCCTGCAGCTAGCTGGGG - Intronic
1184825637 22:46948970-46948992 GTTCTGTCTGCCTTTCGCTGAGG + Intronic
1185068138 22:48642176-48642198 GAGCGGCCTGCGCTTTGCTGAGG + Intronic
949158495 3:853972-853994 GTGCTGTCTGCATTTAGGGGAGG - Intergenic
950139006 3:10602165-10602187 GTGCTTTCTCCATTTTGATGAGG - Intronic
951084491 3:18495196-18495218 TGGATGCCTGCATTTTTCTGAGG - Intergenic
952720426 3:36526535-36526557 GTGTTGGCTGGCTTTTGCTGAGG - Intronic
953071817 3:39527977-39527999 GAGCCGCCTGCATTTTGGGGTGG + Intronic
953140721 3:40226989-40227011 GTGCTGCTAGCATTTTACTTTGG - Intronic
954007503 3:47603491-47603513 GTGGTGGCTGCTGTTTGCTGAGG - Intronic
955635432 3:61023540-61023562 GTGATGCCTTCTTTTTGCTTAGG - Intronic
955943295 3:64167001-64167023 ATGCTGCCTGCATTTTCCTCTGG + Intronic
959590982 3:108080969-108080991 TTGCTGCCTATATTTTGCTATGG - Intronic
959652844 3:108768620-108768642 GTGCTGCCTTCATTCTCCAGTGG - Intergenic
961328062 3:126122235-126122257 GTGCTCCTTGCTTTTTCCTGTGG - Intronic
961493812 3:127276015-127276037 TTGCTGGCTGCAATTTGGTGAGG + Intergenic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
963629210 3:147712507-147712529 TTGCTGCCTGCTTTTTCCTCTGG + Intergenic
963912840 3:150829587-150829609 GTGCTGTCTGCATCTGTCTGAGG + Intergenic
965231593 3:166060993-166061015 GTGCTGCCTGGGGTTGGCTGAGG - Intergenic
965425177 3:168514088-168514110 GTGCTGCCTGACTGTTGCTTTGG + Intergenic
967994851 3:195158730-195158752 GTGCAGCCTGCACTGTCCTGCGG + Intronic
968516185 4:1016592-1016614 ATGCTGCATGCAGCTTGCTGGGG + Intronic
969537329 4:7764660-7764682 GTGCTGGCTGCAGATGGCTGTGG + Intronic
971210014 4:24607220-24607242 GATCTGCCTGAATTTTGCAGAGG - Intergenic
971312636 4:25538628-25538650 GTGCTTCCTGCACTTATCTGAGG + Intergenic
971754249 4:30686637-30686659 GTGGTGCCTTCATCTTTCTGGGG - Intergenic
972424649 4:38920945-38920967 GTGCTGGCTGCATTATGCCCTGG + Intronic
974012616 4:56620733-56620755 AGGCTGCATGCATTCTGCTGTGG + Intergenic
974752405 4:66157473-66157495 GTGCTGTCTTCATTTTCCTTCGG + Intergenic
974995668 4:69156323-69156345 GTGCTGGCTGCAATTTGGAGAGG + Intronic
975008747 4:69322697-69322719 GTGCTGGCTGCAATTTGGCGAGG + Intronic
977559618 4:98519113-98519135 CTGCTGTCTCCATCTTGCTGCGG - Intronic
979164692 4:117513602-117513624 GTGCTGCCTGCATTTTCCAGAGG - Intergenic
982564465 4:156971245-156971267 GTGCTCCCAGCAACTTGCTGGGG - Exonic
983396438 4:167203602-167203624 GTCCTCCCTGCATTTGGATGTGG + Intronic
985875643 5:2591877-2591899 GACCTGGCTGCATTTTGCTGGGG - Intergenic
987644339 5:20649009-20649031 GTGTTGACTGCAGCTTGCTGGGG - Intergenic
988434041 5:31152799-31152821 GTGCTTTCTGCTTCTTGCTGAGG + Intergenic
991296466 5:65086436-65086458 GTGTGGCCTGCTTTCTGCTGAGG + Intergenic
991655941 5:68903902-68903924 GTGCTGCCTGTATAATACTGTGG + Intergenic
993537554 5:89105413-89105435 GTACTGCCTGAATTGTGTTGTGG + Intergenic
994042659 5:95275761-95275783 CTGCTACCCGCATTTTGCTATGG - Intronic
997409323 5:133679139-133679161 ATGTTGCATGCATGTTGCTGAGG - Intergenic
997993359 5:138564904-138564926 GTTCTGCAAGCATTCTGCTGGGG - Intronic
998471072 5:142384160-142384182 CTGCTGGCTGCATTTGGGTGTGG + Intergenic
999635794 5:153620855-153620877 GTTCTGCCTTTATTTGGCTGTGG + Intronic
1000240914 5:159407173-159407195 GAGCTGCCTACATTTGGATGTGG - Intergenic
1000280624 5:159778793-159778815 GTGCAGCCTGGATGATGCTGGGG - Intergenic
1000859163 5:166435672-166435694 ATGCTGCCTGCAATGTGGTGAGG - Intergenic
1001829183 5:174771123-174771145 TGGCTGCCTGCCTTTCGCTGGGG + Intergenic
1001950355 5:175812265-175812287 GTGCTGGCTGCATTCTGTGGTGG - Intronic
1002040386 5:176509259-176509281 GTGCAGCCTGTATTTGACTGAGG - Exonic
1002627628 5:180542200-180542222 GTGCTGCTTAGGTTTTGCTGAGG + Intronic
1003200334 6:3954207-3954229 GGTTTGCCTGCATTTTGTTGAGG + Intergenic
1003509595 6:6768482-6768504 GTGCTGGCTACATTTAGCTTGGG - Intergenic
1003564089 6:7207983-7208005 GTGATGCCTCCAGTCTGCTGTGG + Intronic
1006180179 6:32149706-32149728 GTCCCGCCTGCATATGGCTGTGG + Exonic
1008019044 6:46555090-46555112 GGGCTGGCTGTATTCTGCTGTGG - Intronic
1009247129 6:61252369-61252391 GTTCTGCCTTTAGTTTGCTGAGG - Intergenic
1009276355 6:61686182-61686204 GAGCTTCCTTCGTTTTGCTGTGG - Intronic
1010951132 6:82038475-82038497 GGGCAGCATGCTTTTTGCTGTGG - Intergenic
1011657742 6:89566726-89566748 CTGCTGCTTGCATGTTGCAGGGG - Intronic
1014736794 6:125103185-125103207 GTGCTCCCTGGACTGTGCTGTGG - Intergenic
1015122622 6:129716428-129716450 GTACTGCCTTCATTTTGGAGTGG - Intergenic
1015951927 6:138561877-138561899 GTGCTGGCTGCATCTTGCTTTGG - Intronic
1017761975 6:157576074-157576096 GTGCTGCCTGCATGTGGCTTGGG + Intronic
1017765954 6:157607482-157607504 GTGCAGCATGCAGTTTCCTGAGG + Intronic
1019775239 7:2908683-2908705 GTCCTGCCACCATTTTGCAGAGG - Intronic
1019930528 7:4219999-4220021 GTGGTCCCTGCAGTTTGCTAAGG - Intronic
1021930337 7:25574727-25574749 CTGCTGGAAGCATTTTGCTGCGG - Intergenic
1023802387 7:43846262-43846284 GGGCTGCCTGGATTCTGCTTTGG - Intergenic
1024155941 7:46625241-46625263 GTTGTGCCTGCATTGTTCTGAGG - Intergenic
1026353432 7:69537049-69537071 GTACTGCCTTTATTTTACTGTGG + Intergenic
1026874579 7:73871923-73871945 GTGCAGCCAGCATTCTGCCGTGG - Intergenic
1028395960 7:90369142-90369164 TTGCTGCCTGATTTTTGCTCTGG + Intronic
1029285911 7:99466007-99466029 GAGCTGCCTGCCCTTTGCTCAGG - Intronic
1029316576 7:99720938-99720960 GTGCTGTCTGCAGGGTGCTGTGG - Intronic
1032561209 7:132894865-132894887 GTGCTGCCAGCATGTTACTCAGG + Intronic
1033242091 7:139688764-139688786 TTGCTGTCTGGATTTTGGTGAGG - Intronic
1034908149 7:154969469-154969491 GTGCTCCCTGCACCGTGCTGCGG + Intronic
1035229681 7:157457512-157457534 GTGCTGCATGCCTTGTTCTGAGG + Intergenic
1037683179 8:21115793-21115815 GTCCTGCCTCCATTTGGCAGTGG + Intergenic
1038388414 8:27171905-27171927 GATCTGCCTGCACTTTGCTGTGG + Intergenic
1038679935 8:29657481-29657503 GTGCTACCTGGCTTGTGCTGTGG + Intergenic
1039241178 8:35558605-35558627 GTGATGCCTGGATTTGGCTGAGG - Intronic
1039693651 8:39886788-39886810 GTGGGGCCTGCATCTTGCTAGGG + Intergenic
1041084682 8:54245901-54245923 TTCCTGCCTGGAATTTGCTGAGG + Intergenic
1041237221 8:55816320-55816342 TTGCTGCCTGCATCTTCCTTTGG - Intronic
1043255426 8:78130765-78130787 TTGTTCCCTACATTTTGCTGGGG - Intergenic
1043924613 8:86022873-86022895 GTGCTGCCTGGCTGTTCCTGAGG - Intronic
1046014711 8:108590862-108590884 TTGCTGCCTGCCTCTTGCTCTGG - Intergenic
1047188599 8:122657699-122657721 GTGCTGCCTCCATGTGGCAGTGG - Intergenic
1048017990 8:130514463-130514485 GTGCTGCCTGGCATCTGCTGTGG + Intergenic
1048575494 8:135686760-135686782 GAGCTGCCTGCAACGTGCTGAGG - Intergenic
1050181766 9:2930749-2930771 GATATGCCTGCATTCTGCTGGGG - Intergenic
1051054177 9:12964344-12964366 GTCCTGCCTTCATTTTGGAGAGG + Intergenic
1052109847 9:24567791-24567813 GTGCTGTATGCATTATTCTGAGG + Intergenic
1053431487 9:38044608-38044630 GTGCTGCCTGCCTTTTGGTGTGG - Intronic
1053879231 9:42575339-42575361 GTCCAGGCAGCATTTTGCTGTGG - Intergenic
1054232458 9:62526358-62526380 GTCCAGGCAGCATTTTGCTGTGG + Intergenic
1055157244 9:73079341-73079363 CTGCTCCCGGCATTATGCTGTGG - Intronic
1056489231 9:87088438-87088460 GGGCTGGCTGCACTTGGCTGGGG - Intergenic
1057613104 9:96564404-96564426 TTTCTGCCTTCATTTTGATGGGG - Intronic
1057664927 9:97038006-97038028 GTCCTGGCTGCCTTTTGCTTGGG - Exonic
1057873374 9:98734422-98734444 TTTGTGCCTGCTTTTTGCTGTGG - Exonic
1058703961 9:107623754-107623776 GTGCCACCTGCACTTTGCTAAGG + Intergenic
1059768670 9:117407759-117407781 TTGCTGCCTGCCTCTTTCTGGGG + Intronic
1060680575 9:125559772-125559794 CTACTGCCTGCATATTGCTGAGG - Exonic
1061177298 9:129005464-129005486 GGGCTGCCAGCGTCTTGCTGAGG - Exonic
1061643634 9:131980837-131980859 ATGCTGCCTGCTGTCTGCTGCGG - Intronic
1061887440 9:133598982-133599004 GTGCTGCCTGCATCCAGCAGGGG - Intergenic
1062237539 9:135518318-135518340 TGGCTTCCTGCATTTTGATGCGG + Intergenic
1062521716 9:136960633-136960655 GTGCTGCCTGCAGTTGGTGGGGG + Intergenic
1185949614 X:4417096-4417118 GGGCTGCCAACATTTTCCTGTGG - Intergenic
1186073669 X:5852167-5852189 GTGCAGCCTGTATTGTGCTTTGG - Intronic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1189047935 X:37613023-37613045 GTGCTTCCTTTATTCTGCTGTGG + Intronic
1189516591 X:41718785-41718807 GTGCTGCCTCCCTTTTGTTTGGG - Intronic
1191224803 X:58031663-58031685 GAGGTGGCTGCATTTTTCTGGGG + Intergenic
1191651059 X:63537829-63537851 TTGCTGCCTGCTTTTTCCTCTGG - Intergenic
1192760214 X:74088559-74088581 GGGGTGGCTGCATTTTGCTCAGG - Intergenic
1192819591 X:74630469-74630491 CTGCTGCCAGGATTTTGGTGTGG - Intergenic
1192830075 X:74742023-74742045 AGGCTGCCTTCATTTTGCTCTGG + Exonic
1194119901 X:89948864-89948886 GTGATTCCTGCATTTTCCTATGG + Intergenic
1195576985 X:106462383-106462405 GTGCTGCCTGGATTTTTTTTGGG + Intergenic
1197345728 X:125324649-125324671 GCTCTGCCTGCATTTTTGTGAGG - Intergenic
1199627061 X:149750585-149750607 GTTCTGCCTGGATTTGGGTGGGG - Intergenic
1200472765 Y:3606379-3606401 GTGATTCCTGCATTTTCCTATGG + Intergenic