ID: 1106001781

View in Genome Browser
Species Human (GRCh38)
Location 13:25730368-25730390
Sequence CTTTTGTTTTGAAGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 7, 3: 62, 4: 688}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106001781 Original CRISPR CTTTTGTTTTGAAGAACAAA AGG Intronic
900775829 1:4584885-4584907 CTCTTGTTTTGAAGGAAAACAGG + Intergenic
901238299 1:7679193-7679215 TTTTAGTTTTGCAGAACAAATGG + Intronic
901731519 1:11283630-11283652 ACTTTGTTCTGAAGAACTAAGGG + Intronic
902189534 1:14752410-14752432 ATTTTGTTTTGTAGCACAAATGG - Intronic
903449878 1:23445800-23445822 ATTTTGTTTTAAAGTAGAAACGG - Intronic
903598156 1:24512655-24512677 CTTTTATTTCAAAGAACAGAAGG - Intronic
903865065 1:26391974-26391996 CTTTTGCTTTGAATAAGAATAGG + Intergenic
904510797 1:31005535-31005557 CTTTTATTTTAAAGTAAAAATGG + Intronic
906812785 1:48846205-48846227 CCTTTCTTTTAAAGTACAAATGG - Intronic
906861554 1:49366146-49366168 CTTTTTTTTTGAAGAATGAGGGG - Intronic
907948737 1:59160215-59160237 CTCTAAGTTTGAAGAACAAAAGG + Intergenic
908096426 1:60743658-60743680 CTTTTATTTTGAAGCACCACTGG - Intergenic
908757164 1:67479605-67479627 ATTTTGTTTGGAAGAGCAAGGGG - Intergenic
909731621 1:78899246-78899268 CTTTTGCTATGAACAACAGATGG + Intronic
909822663 1:80085907-80085929 ATTGTGCTCTGAAGAACAAAGGG - Intergenic
910328980 1:86047042-86047064 ATTTTGTTTTGAAGAAGGAAAGG - Intronic
910946471 1:92597208-92597230 ATTTAGTTATGAAGAACAAGAGG - Intronic
911265863 1:95742736-95742758 CTTTTGTTTTCAGCAACCAAGGG + Intergenic
911648546 1:100361088-100361110 TTTTTTTTTTTAAGCACAAAGGG - Intronic
911904831 1:103553864-103553886 CTCTTGTTTAGAAAAAGAAAGGG - Exonic
912186920 1:107288405-107288427 CATTTGCATTGAAGTACAAACGG + Intronic
912442180 1:109707649-109707671 CATTTGTCTTAAAGGACAAAGGG - Intronic
913175275 1:116267578-116267600 CTTTTGCCTTGAAGGACAATGGG + Intergenic
913426292 1:118734593-118734615 CCTTTCTTTTGAAAAACAAATGG + Intergenic
915162431 1:153929948-153929970 TTTTTGTTTTAAAAAACAACTGG - Exonic
915919568 1:159964268-159964290 CTTTTGTTTCCAATCACAAAGGG + Intergenic
916009168 1:160689071-160689093 CATTTGTTTTAAAGGAGAAAGGG + Intronic
916456130 1:164972579-164972601 CTTTTGTTTTGTAGATCTGATGG - Intergenic
917334245 1:173912165-173912187 CTTGTGTTCTGATGAATAAAAGG + Intronic
917489718 1:175487798-175487820 CTCTTGTTTTTAATACCAAATGG + Intronic
918003050 1:180515809-180515831 TTACTGGTTTGAAGAACAAAGGG + Intergenic
918423286 1:184385765-184385787 CTTTTAATTTGAAAAAAAAAGGG + Intergenic
918735141 1:188052132-188052154 CTTGTGTTTTGACTAACACATGG + Intergenic
918857906 1:189782158-189782180 CTTTTATTTGAAAGAAAAAAAGG - Intergenic
919677484 1:200398031-200398053 CTTCAGTTTTGTAGAACAAATGG + Intergenic
919679078 1:200416530-200416552 ATGTTGTAGTGAAGAACAAATGG - Intergenic
920943785 1:210509419-210509441 CCTTGGTTTTGAGGAATAAATGG - Intronic
921379855 1:214513433-214513455 TTTTTTTTTTGAAGAACTAATGG - Intronic
921434148 1:215097418-215097440 TTTTTTTTTTTAAGAAAAAAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921711207 1:218375159-218375181 CTTTTGCTTTGTATAACAGACGG + Intronic
921915288 1:220602319-220602341 ATGTTGTTTGAAAGAACAAAAGG - Intronic
921956729 1:220992750-220992772 CTTCTGGTAGGAAGAACAAAAGG - Intergenic
923218566 1:231872657-231872679 TTTTTTTTTTTAAGAACAGATGG - Intronic
923234499 1:232019580-232019602 CATTTGATTTAAAGTACAAATGG + Intronic
923607312 1:235456035-235456057 CCTTTGTTATTAAGAACACACGG - Intronic
923803743 1:237236061-237236083 CTGTTGTTTTGAAAAATACATGG - Intronic
923867258 1:237953000-237953022 CTTTTTTTTTAAAGTACAGAAGG + Intergenic
924838454 1:247679954-247679976 CTTTTTCTGTGAAGACCAAAAGG + Intergenic
1062780601 10:202281-202303 CTTTACTTTTGAAGAAAAATAGG + Intronic
1063703543 10:8409086-8409108 CTCTTATTTTGAAGAATAATTGG - Intergenic
1063974100 10:11401663-11401685 CTTTTGTTTTGGGGAAAAATGGG + Intergenic
1064108061 10:12517929-12517951 CTTCTGTTTTCTAGAAGAAATGG + Intronic
1064488410 10:15822095-15822117 CTTTGATTTTGAAAAACAAATGG + Intronic
1064696131 10:17967137-17967159 TTTTTTTGTTGAAAAACAAAGGG + Intronic
1064831361 10:19470594-19470616 CTATTGTTTTGAAAAATAAAAGG - Intronic
1065208303 10:23378023-23378045 GTTTTGTTTTGAAGTACAGGTGG - Intergenic
1065349057 10:24779198-24779220 CTTTAGTTTTCAAGAATTAAGGG + Intergenic
1065475421 10:26132056-26132078 CTTTTATTTTGCAGCTCAAATGG + Intronic
1066433421 10:35374158-35374180 CCTTTCCTTTGTAGAACAAATGG + Intronic
1066505920 10:36042790-36042812 GGTGTGTTTTGAAGCACAAAAGG + Intergenic
1066558670 10:36644015-36644037 CATTTATTTTGAAAAATAAAAGG + Intergenic
1067747656 10:48948298-48948320 AGTTTGGTTTGGAGAACAAATGG + Intronic
1067964408 10:50893193-50893215 CTTCTGTTTTGAAGAAGAGGAGG + Intergenic
1068280854 10:54867580-54867602 CTTTTATTTTCAAGAAGATATGG + Intronic
1068317963 10:55372132-55372154 GGTTTGTTATGAAGATCAAATGG - Intronic
1068569484 10:58613604-58613626 CGTTAGATCTGAAGAACAAAGGG - Intronic
1068739380 10:60451485-60451507 CTTGCCTTTTGAAGAACACATGG + Intronic
1068782605 10:60937722-60937744 CTGTTGTGTTCAAGAAAAAAAGG + Intronic
1069009815 10:63359933-63359955 CCTTTTTTTTAAGGAACAAAAGG - Intronic
1069162525 10:65108947-65108969 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1069277286 10:66608644-66608666 GTTTTTTTTTGAAGATCAGATGG - Intronic
1069803241 10:71096051-71096073 ATTAAATTTTGAAGAACAAAAGG + Intergenic
1070109662 10:73472695-73472717 CTTTTATTTTTCAGAAAAAATGG - Intronic
1070277863 10:75024962-75024984 CTTTTGTACTAAAGAAGAAAAGG + Exonic
1070588440 10:77783659-77783681 CATTGGTTTTTAAGAACAAGAGG + Intergenic
1070878316 10:79837453-79837475 GTTTTGATTTGATGAGCAAATGG + Intergenic
1071141933 10:82519638-82519660 AGTATGCTTTGAAGAACAAAAGG + Intronic
1071644868 10:87353774-87353796 GTTTTGATTTGATGAGCAAATGG + Intergenic
1071883502 10:89924948-89924970 TTCTTGTTTGGAAAAACAAAAGG - Intergenic
1072226170 10:93371733-93371755 CTTTTTTTTTAAAGTATAAAGGG + Intronic
1072520873 10:96228923-96228945 CTTTTTTTTTAAAGACCAACAGG - Intronic
1073663784 10:105507618-105507640 CCTTAATTTAGAAGAACAAAAGG - Intergenic
1074021417 10:109588398-109588420 CTTTTGTTTTGTAGCACTACAGG + Intergenic
1074632449 10:115273534-115273556 ATTCTGTTTGGAAGAAGAAATGG - Intronic
1075052123 10:119190266-119190288 CTTTTGTTGGAATGAACAAAAGG - Intergenic
1075350657 10:121721850-121721872 TTTTTGTATTGGAGCACAAAAGG - Intergenic
1075749843 10:124757706-124757728 TTTTTTTTTTGAAGAAATAAGGG - Intronic
1076136534 10:128049072-128049094 TATTTGTTATGAAGAAGAAAAGG + Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077448590 11:2618633-2618655 ATTCTGTTCTGAAAAACAAAGGG - Intronic
1077970965 11:7189547-7189569 CTTTTCTTTAGTAGAACAAAAGG + Intergenic
1077974663 11:7235253-7235275 TGTGTGTTTTGAAAAACAAATGG + Intergenic
1078736044 11:14021894-14021916 CTTTATTTGTAAAGAACAAAGGG + Intronic
1078839531 11:15065486-15065508 CATTTGTTTTAAAGGAGAAAGGG + Intronic
1078987818 11:16612251-16612273 TTTTTTTTTTCAGGAACAAAGGG - Intronic
1079396814 11:20070844-20070866 CTTTTGTTTAGCAGAAAAATGGG + Intronic
1079419609 11:20273731-20273753 CTTTTGGTTTTAAAAACAGAAGG - Intergenic
1079421012 11:20288069-20288091 CTTTCCTTTTGCACAACAAAGGG - Intergenic
1079458937 11:20662657-20662679 GGGTTGTTTTGAAGAATAAATGG + Intergenic
1079653535 11:22960747-22960769 CTTTTAGTTCGAAGAACAGAAGG - Intergenic
1079849961 11:25519979-25520001 CTTTTGTTTTATACAGCAAATGG + Intergenic
1079985168 11:27192504-27192526 CATTAGTTTTGAAGGTCAAAAGG + Intergenic
1080138583 11:28888118-28888140 CTTTTGCTTTGTAGAAGAGAAGG + Intergenic
1080771835 11:35348999-35349021 CTTTTGGTTGGAAGAGGAAAGGG + Intronic
1082299617 11:50490343-50490365 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1082955411 11:58864550-58864572 CCTTTGTGTTGAAGAAGAAAAGG - Intronic
1082976505 11:59077429-59077451 CCTTTGTATTGAAGAAGAAAAGG - Intergenic
1083460632 11:62808983-62809005 CTTTTGTTTTAAATATCAAATGG + Intronic
1084206977 11:67600926-67600948 CTTTTGTGTTAAGGGACAAAGGG + Intergenic
1085387716 11:76166598-76166620 GTTTTGTTTTGAAGCAAAAAGGG + Intergenic
1085836101 11:79958294-79958316 TGTTTCTTTTGAAGAACACAAGG + Intergenic
1085869932 11:80337547-80337569 TTTTTCTTTTGAAGTACACATGG - Intergenic
1086751208 11:90496092-90496114 TTTTTTTTTTGAAGATCAGATGG + Intergenic
1087570744 11:99924523-99924545 CATTTTTTTTGAAGATCAATTGG + Intronic
1088082193 11:105932083-105932105 CATTTGTTTTCAATAACAAGGGG - Intronic
1088356300 11:108947473-108947495 CCATTGTTTTGGGGAACAAATGG + Intergenic
1088709351 11:112493190-112493212 TTTTTTTTTTGAAGAAAAAAAGG - Intergenic
1088761401 11:112932280-112932302 CATGTGTGGTGAAGAACAAATGG - Intergenic
1088836937 11:113585462-113585484 CTTTTGTTTTTAACAAAAGAAGG - Intergenic
1089031394 11:115333065-115333087 CTTTGATTTTGAAGAACTGATGG - Intronic
1089217578 11:116844102-116844124 CTCTTGTTTTGAAGATCAGAAGG + Intronic
1089441495 11:118521447-118521469 CTTTTGTTTTGCTGTAGAAAGGG + Intronic
1089820173 11:121218609-121218631 TTTTTTTTTTCAAGAAAAAATGG + Intergenic
1090149231 11:124364613-124364635 CTTTTGTTTAGAAAAACAACTGG - Intergenic
1090178629 11:124673872-124673894 TTTTTTTTTTAAAGAAAAAACGG + Exonic
1090233101 11:125124257-125124279 CTTTTCTTTGGAAGGAGAAAGGG + Intergenic
1090980738 11:131719312-131719334 CTTATATATTCAAGAACAAAGGG - Intronic
1091245088 11:134086246-134086268 CTATAGTTTTGAAGAACCAGAGG - Intronic
1091532442 12:1372455-1372477 CTTTTATTTTCACAAACAAAAGG - Intronic
1091661108 12:2384489-2384511 CTTTTGTTAGAAAGAAAAAAAGG - Intronic
1091904167 12:4169597-4169619 CTTTTGTTTCTAGGAGCAAATGG + Intergenic
1092603666 12:10095528-10095550 CTTTTTTTTTGAAGATAAAATGG - Intronic
1093103321 12:15054519-15054541 CTCTCTCTTTGAAGAACAAAAGG + Intergenic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093397147 12:18696610-18696632 CTTTTGTTTTGAAAAATGAATGG - Intronic
1094448352 12:30558026-30558048 CTTTTTTTTTTAATAACAGAGGG - Intergenic
1094750388 12:33399380-33399402 TTTTTGTTTTGTAAAACAGAAGG + Intronic
1094865745 12:34528417-34528439 CGTTTGTTTTAAAGGAGAAAGGG - Intergenic
1095406172 12:41869733-41869755 ATTTTGTTTTGAAGGACACTGGG - Intergenic
1096299765 12:50416493-50416515 TTTTTGTTTTTAAGTACAGACGG - Intronic
1096931835 12:55219432-55219454 CTTTTGTTTTGAAAAAATATGGG - Intergenic
1097335801 12:58381902-58381924 ATTTGGTTTTGAAGAACACCTGG + Intergenic
1097469905 12:59976535-59976557 CTTTGGCTTTGGGGAACAAAAGG + Intergenic
1097571803 12:61342580-61342602 CTTTTGTTATAAAGAAAAGAGGG + Intergenic
1098218994 12:68248605-68248627 CTTTTGTTTATAAGACCAGAAGG - Exonic
1099133814 12:78867118-78867140 CTTTTGGTTACAAGGACAAAGGG + Intronic
1099456448 12:82868705-82868727 TTTTTTTTTTGAAAAAAAAAGGG + Intronic
1099555334 12:84102786-84102808 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1099950896 12:89302883-89302905 TTTTTTTTTTTAAGAAAAAAAGG + Intergenic
1100113404 12:91272744-91272766 CTTTTCCCTTGAAAAACAAAAGG + Intergenic
1100297200 12:93274110-93274132 TTTTTTTTTTCAACAACAAATGG + Intergenic
1100794673 12:98168724-98168746 AATTTGATTTGAAGAATAAATGG - Intergenic
1100945707 12:99781398-99781420 GATTTGTTTTAAAGATCAAAAGG - Intronic
1101072691 12:101093030-101093052 ATTTTGTTTTTATGATCAAATGG + Intronic
1101208460 12:102512758-102512780 CTTCTGTTTAGAAGGAGAAAGGG - Intergenic
1101501894 12:105311894-105311916 CATTTGTTTTAAACAAGAAAGGG - Intronic
1103375778 12:120454845-120454867 TTTTTTTTTTGAATAACACAAGG - Intronic
1103650530 12:122428516-122428538 CTTTTTTTTTAAAGAACAATAGG + Intergenic
1104282269 12:127388941-127388963 TGTTTGTTTTCCAGAACAAATGG - Intergenic
1104949039 12:132430570-132430592 CTTTTCTTTAAAAGAACAGAAGG - Intergenic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106750660 13:32762957-32762979 CTTTTGTGTTGAATAACAAATGG - Intronic
1106860915 13:33907346-33907368 TTATTATTTTTAAGAACAAATGG - Intronic
1107063852 13:36190930-36190952 CTACTGTTTTGAACAAGAAAGGG - Intronic
1107072943 13:36291794-36291816 TCCTTGTTTTGAAAAACAAATGG + Intronic
1107283917 13:38768140-38768162 TTTCTAGTTTGAAGAACAAAAGG + Intronic
1107352721 13:39532736-39532758 CTTATGTTTAGAAGAACACTAGG + Intronic
1107368298 13:39711043-39711065 TTTTTTTTTTGAGAAACAAATGG + Intronic
1107504021 13:41012427-41012449 GTTTTGTTTTTAAGAAAAAAAGG + Intronic
1107679032 13:42828808-42828830 CTTTTCTATTGAAGGATAAAAGG - Intergenic
1107844334 13:44496004-44496026 CTTTCATTTTGATGTACAAAAGG - Intronic
1108183946 13:47870114-47870136 CTTTTGTTTTGAATAAAATATGG - Intergenic
1108932205 13:55839344-55839366 ATTTTGTTTAGCAGACCAAATGG - Intergenic
1109049121 13:57455414-57455436 TTCTTCTTTTGAAGAAGAAAAGG + Intergenic
1109052366 13:57500101-57500123 CTTTGTTATTGAAGCACAAATGG - Intergenic
1109174464 13:59137518-59137540 CTTTGATATTGAAGAAGAAAGGG - Intergenic
1109460863 13:62656116-62656138 ATTGTGTTTTCAAGAACAAAAGG + Intergenic
1109472288 13:62824653-62824675 CTTCTGTTTTGAATGCCAAATGG - Intergenic
1109481388 13:62959887-62959909 CTTTGTTTTTGATGAACAATGGG + Intergenic
1109530111 13:63631748-63631770 CCTTTCTTTTGAAGGACTAAAGG + Intergenic
1109570890 13:64188160-64188182 CTTTTGTTTTCATGAGCAATGGG - Intergenic
1109961537 13:69638535-69638557 CTTTTGTTTGGAAGAAAGTAAGG - Intergenic
1110092833 13:71475254-71475276 CTTTTTTTTTAAAGGACAATAGG - Intronic
1110114389 13:71794054-71794076 CTTTTTTTTTAAGGAAAAAATGG - Intronic
1110260662 13:73481365-73481387 GTTTTGTTTTGAGGAAAAACAGG + Intergenic
1111694611 13:91607543-91607565 CTTTTGGATTGAGGAATAAATGG + Intronic
1112247029 13:97744713-97744735 CTTTTGTGATGCAGAACAGATGG - Intergenic
1112393297 13:99004344-99004366 CTTTATTGTTGAAGAACAACTGG - Intronic
1112688124 13:101855907-101855929 TTTTTTTTTTTAAGAACACAGGG + Intronic
1112732772 13:102384937-102384959 CTTTTATGTAAAAGAACAAAAGG - Intronic
1112790580 13:102998336-102998358 CTTATGTTTTGAGAAACAGAGGG + Intergenic
1112956439 13:105064644-105064666 CTCTTGTTTTGGGGAAGAAACGG + Intergenic
1112956568 13:105066326-105066348 CCCTTGTTTTGGAGAAGAAAAGG - Intergenic
1113237311 13:108293445-108293467 TTTTCATTTTGGAGAACAAAAGG + Intronic
1113383101 13:109821411-109821433 CTGATGTTATGAAAAACAAAGGG - Intergenic
1114863632 14:26558924-26558946 CTTCTGATTAGAAGAACACAAGG + Intronic
1114882283 14:26800786-26800808 TATTTGCTTTGATGAACAAATGG - Intergenic
1115142319 14:30186380-30186402 CTTTTGTTTTGAATAGTAAAAGG + Intronic
1115251886 14:31357646-31357668 CTTTGGTTTTGAAAAACCAAAGG - Intronic
1115310801 14:31975999-31976021 ATTTTGCTTAGAAGAAGAAATGG - Intergenic
1115744298 14:36420136-36420158 CTTCTGTTTATAAGAAAAAATGG - Intergenic
1115817173 14:37176048-37176070 TTTTTGTTTTAAATAACAACAGG - Intergenic
1116666707 14:47785660-47785682 CTTTTGTATTGAAGAACTAATGG + Intergenic
1116776690 14:49189425-49189447 CTTTTGTTTTGAAGTCAACAAGG - Intergenic
1117375847 14:55117604-55117626 CTTTTTTTTTAAAGTACAAAGGG + Intergenic
1117673465 14:58131713-58131735 GTTGTGTTTGGCAGAACAAATGG - Exonic
1118034104 14:61848399-61848421 CTTTTGTTTTGGAGAAAGTAAGG - Intergenic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1120010525 14:79408255-79408277 GTTTGGTTTTGAGGAGCAAAGGG - Intronic
1120122929 14:80703939-80703961 CTTTTATTTTAAAGAAAAATAGG - Intronic
1120187406 14:81408284-81408306 ATTTTATTTTAAAAAACAAAAGG + Intronic
1120559027 14:85968358-85968380 ATCTTGTTTTGAAGAATAACAGG - Intergenic
1120978306 14:90268830-90268852 ATTTTGTTTAGCAGCACAAATGG - Exonic
1121386736 14:93534279-93534301 CTTTTCTTTTCAATAAGAAATGG + Intronic
1122012563 14:98763043-98763065 CTTATTTTTTGAAGAATACATGG - Intergenic
1122163793 14:99805782-99805804 ATTTTTTTTTGAAAAAAAAAGGG - Intronic
1122530060 14:102419112-102419134 CTTGTGTTCTGAAGAGGAAAGGG + Intronic
1122726535 14:103758572-103758594 GATTTGTTTTGAAGAGCATATGG - Intronic
1123908434 15:24943192-24943214 ATTTTGTTTGGAAGGACATATGG - Intronic
1124213292 15:27782032-27782054 ATTTTATTTTGAAGAAGAACTGG + Intronic
1124412387 15:29447125-29447147 TTTGTGTTTTAAATAACAAAAGG - Intronic
1124428680 15:29586990-29587012 ATTTGGTTTTCAAGAACACAAGG - Intergenic
1124920410 15:34020863-34020885 ATTTTGTATTAAAAAACAAATGG + Intronic
1124996682 15:34730111-34730133 TTTTATTTTTGAAAAACAAAAGG - Intergenic
1125103706 15:35946176-35946198 GTTTTGTTTTGAAAAACAAATGG + Intergenic
1125410563 15:39401741-39401763 CTTTTATTTTGAAATACAAATGG - Intergenic
1125567670 15:40689490-40689512 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1125773933 15:42193840-42193862 TTTTTTTTTTTATGAACAAAGGG - Intronic
1125789332 15:42351460-42351482 CTTCTGTTTATAAAAACAAATGG - Intronic
1126250683 15:46565000-46565022 CATTTGTTTTGGAGAACGTAAGG - Intergenic
1126405992 15:48323150-48323172 CATTTATTTGGAAGAACAATGGG - Intergenic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1127453397 15:59137568-59137590 TTTTTGATTTAAAGAACAAAGGG - Intronic
1127685440 15:61338880-61338902 CTTTTGCTTGGAAAGACAAAGGG + Intergenic
1127818716 15:62636567-62636589 CTTCAATTTTGAAGAAAAAAAGG - Intronic
1127829827 15:62740614-62740636 CTTTTGTCTGGAAGGTCAAAAGG - Exonic
1127939286 15:63677594-63677616 GTTTTGTTTTGGGGAAAAAATGG - Intronic
1128776610 15:70325121-70325143 CTTTTGTTTTGTTGAATAAAAGG - Intergenic
1129542032 15:76358294-76358316 CCTCTGCTTTGAAGACCAAAAGG - Intronic
1129577829 15:76770461-76770483 GTTTTGTTTTGACAAACCAAGGG - Intronic
1130042470 15:80416502-80416524 TTTTTGTTATGAGGAACAATTGG - Intronic
1130083766 15:80759653-80759675 AATTTGTATGGAAGAACAAAGGG + Intergenic
1131055754 15:89373459-89373481 CTTTTTTTTTTAAGTACCAAGGG - Intergenic
1131209948 15:90486145-90486167 CTTTTGCCTGGAAGATCAAAAGG + Intronic
1132356627 15:101175566-101175588 CCTTTGTTTTGAAGAACGTGGGG + Intergenic
1133176239 16:4016993-4017015 CTGTTTTTTTGAAAAAGAAAAGG + Intronic
1133691041 16:8215617-8215639 ATTTTGCTTTGAAGACCAAGAGG + Intergenic
1133726419 16:8541913-8541935 CTGTTCTTTCCAAGAACAAAGGG + Intergenic
1133908305 16:10041503-10041525 CTTGTGTTTTAAAGAACTGAGGG - Intronic
1134355038 16:13474452-13474474 CTGTAGTTTTGAAGATTAAACGG - Intergenic
1135014413 16:18912192-18912214 TTTTTTTTTTGAAAAAGAAAAGG + Intronic
1135478671 16:22802080-22802102 CTGTTGTTTTGAAAAAGAAGTGG - Intergenic
1135691970 16:24545435-24545457 ATTTTGTTTTGAAGTGCAACAGG - Intronic
1135896846 16:26413564-26413586 TTTTTGATTTAAAGAAAAAATGG - Intergenic
1136331575 16:29581504-29581526 TTTTTTTTTTGAAAAAGAAAAGG + Intergenic
1137368658 16:47883867-47883889 CTTTGGCTTCTAAGAACAAAAGG - Intergenic
1137817789 16:51415590-51415612 TTTTTTTTTTGAAAAAAAAAGGG + Intergenic
1138462306 16:57157623-57157645 TTTTTTTTTTTAAGAACATAAGG + Intronic
1138477490 16:57280488-57280510 CTTTTGGTTTTAAAAAAAAAAGG - Intronic
1138495936 16:57409502-57409524 CTTGTGTTTTGGAGATCAATGGG + Intronic
1138767763 16:59624461-59624483 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1138771403 16:59668170-59668192 ATTATCTTTTGAAGAACATAAGG + Intergenic
1138957430 16:61988118-61988140 CTCTTCTCTAGAAGAACAAAGGG - Intronic
1139169097 16:64609575-64609597 CATTTTTTTAGAAGAACTAAAGG - Intergenic
1144278582 17:13701043-13701065 CTTTGGCTTTGAAGATTAAATGG + Intergenic
1144602751 17:16632910-16632932 CTTTTGATTTCCAGAACACATGG + Intronic
1144745556 17:17611894-17611916 TTTTTTTTTTTAAGCACAAAGGG + Intergenic
1144931580 17:18863394-18863416 CATGTGTGTTTAAGAACAAAAGG - Intronic
1145046166 17:19618358-19618380 CTTTTTTTTTAAAGAAATAATGG + Intergenic
1145801486 17:27688758-27688780 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1145944573 17:28763541-28763563 CTTCTGTTTTGAAGGTCAGAGGG + Intronic
1146474188 17:33149173-33149195 TTTTTGTTTTGTAGAAAAATGGG + Intronic
1147350978 17:39843532-39843554 CTTTTGATTTGGTGAACTAAAGG + Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148979096 17:51555824-51555846 CTTTTGGTATGAGGAGCAAATGG + Intergenic
1149325845 17:55529135-55529157 CATTTATTCTGAAGAAAAAATGG + Intergenic
1149454999 17:56780570-56780592 CTCTGGTTTGGAAGAGCAAATGG - Intergenic
1149586865 17:57794960-57794982 CTTTAAATATGAAGAACAAACGG + Intergenic
1150169890 17:62982346-62982368 TTTTTGTTTTTAAGTATAAAGGG - Intergenic
1151755211 17:76071646-76071668 CTTTTGAAATGAATAACAAATGG - Intronic
1153256370 18:3175637-3175659 CTCTTGTTTTTAATAACTAAAGG - Intronic
1153364105 18:4234609-4234631 TTTATAATTTGAAGAACAAAAGG - Intronic
1153767184 18:8385712-8385734 CTTTTGCTTTGAAGGAAATAAGG + Intronic
1153836605 18:8969580-8969602 CTTGTGTTTTGAAAAGGAAATGG + Intergenic
1155085994 18:22458521-22458543 TTTTTTTTTTGAAGGACAATAGG + Intergenic
1155209914 18:23591627-23591649 TTTTTTTTTTGAAGGAAAAAGGG - Intergenic
1155369869 18:25087478-25087500 TTTTTGTTTTCAAGAACACTAGG + Intronic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1156107740 18:33685999-33686021 CTTTTGTAATGAAGAAATAACGG + Intronic
1156363186 18:36402177-36402199 TTTCTGTTTTTAAAAACAAAAGG - Intronic
1156576016 18:38315994-38316016 ATTTTGTATTGAATAAAAAATGG - Intergenic
1156623137 18:38876702-38876724 CTTTGGTCTTGATGTACAAATGG - Intergenic
1156779570 18:40835314-40835336 GTTCTGTTTTCAAAAACAAATGG - Intergenic
1156864983 18:41878736-41878758 CTTTTATTTTCAAGAAAACAGGG - Intergenic
1156892504 18:42205851-42205873 TTTTTTTTATGAAGAAGAAAAGG - Intergenic
1157689370 18:49668637-49668659 TTTTTGTTTTAAAAAAAAAAGGG - Intergenic
1158008764 18:52704304-52704326 CTCTTTTTTTAAAAAACAAATGG - Intronic
1158052467 18:53239815-53239837 ATTTTATTTTGAATAACCAAGGG + Intronic
1158347774 18:56533139-56533161 ATTTAGTTTTGGAGAAAAAAAGG + Intergenic
1158646179 18:59249781-59249803 TTTTTTTTTTGGAGAGCAAATGG - Intergenic
1158788607 18:60746650-60746672 CATTTCCTTTGAACAACAAAGGG - Intergenic
1159500449 18:69262200-69262222 CTTATATTTTGAAGATCAAAAGG - Intergenic
1159795599 18:72839372-72839394 ATTTTGTTTTGAAAAATCAAGGG + Intronic
1162677988 19:12314732-12314754 CTTTTGTTTTCAAGGACCCACGG - Intergenic
1162877918 19:13634599-13634621 TTTTTTTTTTAAAGAACAGATGG - Intergenic
1163451838 19:17382679-17382701 TTTCTGTTTAGAAAAACAAAAGG - Intergenic
1164330242 19:24247504-24247526 CATTTGTTTTAAAGGATAAAGGG - Intergenic
1164590275 19:29503014-29503036 CTTCTGTCTTGAAGAATCAAAGG + Intergenic
1164766317 19:30774666-30774688 TTTTTTTTTTCCAGAACAAAAGG - Intergenic
1164948652 19:32317744-32317766 CTTTTTCTTTTAAGAAAAAAGGG - Intergenic
1165218936 19:34298772-34298794 CTTTTGTTTGGGAGAGCAGATGG + Intronic
1165291974 19:34893121-34893143 CTTATGTCTAGAAGAAAAAAAGG + Intergenic
1165423336 19:35732893-35732915 ATTTTGTGTTGAAGAACCTAGGG + Exonic
1166345699 19:42163958-42163980 CTGTTGTTAGGAAGAAGAAAAGG + Intronic
1167118796 19:47504080-47504102 CTTTTTTTTTTAAACACAAATGG - Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
925585839 2:5463357-5463379 CTTTTGTGTTTTTGAACAAATGG + Intergenic
925656925 2:6159154-6159176 GTTGTGTTTTCAAGAAAAAATGG + Intergenic
925674260 2:6343608-6343630 TTAGTGTTTTGAAAAACAAATGG + Intergenic
925702644 2:6654319-6654341 CTGTGGTTTTAAAGAACAGACGG + Intergenic
926164343 2:10510100-10510122 GTTGTCTTTTGAAGCACAAAAGG - Intergenic
926808045 2:16730331-16730353 CCTTTTTTTTGAAGAATGAATGG - Intergenic
927556913 2:24041507-24041529 CTTTTCTTTTAAACAAAAAATGG + Intronic
928792056 2:34969289-34969311 CTTTTGATTTGAAGCACAAGAGG + Intergenic
928811303 2:35230635-35230657 CTTTAGTTTAGAATAAAAAAGGG + Intergenic
928992026 2:37242909-37242931 CTTCTGATTTGAAGAAGTAAGGG + Intronic
929179521 2:39020598-39020620 CATTTGTTTTTAAGAACTACTGG - Intronic
929327205 2:40630039-40630061 TTTCTGTTTTGAAAAACCAAGGG - Intergenic
930068539 2:47346742-47346764 CCTTTGTTTTGAAGGTCAGAAGG - Intronic
930257150 2:49105471-49105493 CTTTGTTTTTTAAGCACAAAAGG - Intronic
931294518 2:60908372-60908394 TCTTAGTTTTAAAGAACAAATGG - Intronic
932264639 2:70357111-70357133 CTTTTAATTTGAAGAACCTAAGG + Intergenic
932375739 2:71234294-71234316 CTGTTGTTTTGAAAATTAAATGG - Intergenic
932948075 2:76261147-76261169 CTTTTTTCTTGAAAAAAAAAAGG + Intergenic
933066138 2:77799641-77799663 GTTTTGTTTTGCAGAAGACATGG + Intergenic
933352642 2:81174780-81174802 GATATGTTTTCAAGAACAAAAGG + Intergenic
934901681 2:98164839-98164861 CTTTGGTTTATAAGAAAAAAAGG - Intronic
935042203 2:99443073-99443095 TTTTAGTTCTGAAGTACAAAAGG - Intronic
935142337 2:100364396-100364418 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
935497879 2:103804066-103804088 CTTCTGGTTTGAAGATGAAAGGG + Intergenic
935531518 2:104238518-104238540 TTTTAGTTTTGAAGAACATGTGG + Intergenic
937103224 2:119287572-119287594 TTTTTGTTGAGAACAACAAAGGG + Intergenic
937175248 2:119924846-119924868 CTTTTGTTTGAAATACCAAAAGG - Intronic
937602283 2:123753142-123753164 GTTTTGTTTTTTAGAAGAAAAGG + Intergenic
938215936 2:129515102-129515124 TTTTTGTTGTCAAAAACAAATGG + Intergenic
938744454 2:134263903-134263925 TTTTTTTTTTAAAGAACTAAAGG - Intronic
938759516 2:134411505-134411527 CTTTTGTTTTGAACAGAATAGGG - Intronic
939906599 2:147923734-147923756 TTTTTGTTTTGAATAATATAAGG + Intronic
939953219 2:148500908-148500930 CTTTTTTTTTAAACAACACATGG + Intronic
939992952 2:148893134-148893156 GTTTTGTTTTTAATCACAAATGG + Intronic
941213549 2:162674974-162674996 GTTGTGTTTTGATGAATAAAAGG - Intronic
941639019 2:167967523-167967545 TTTTTGTTTTGGAGAACATTTGG + Intronic
941868547 2:170359702-170359724 CTTGGGTCTTAAAGAACAAAAGG - Intronic
942519948 2:176793123-176793145 CCTTTGTTTTGTAGATGAAATGG - Intergenic
942555132 2:177164941-177164963 CTTTTGTCTTAAAAAAAAAAAGG + Intergenic
942673232 2:178399662-178399684 ATGTTGTTTTGGAAAACAAAAGG - Intergenic
942986532 2:182149664-182149686 CTTTTTTTATGAAGTACTAAGGG - Intronic
943095572 2:183424821-183424843 TCTGTGTTTTGAAAAACAAAGGG + Intergenic
943197021 2:184766041-184766063 CATTTCTTTTAAAGAAAAAATGG + Intronic
943305025 2:186250289-186250311 CTTTTGTATTGTTTAACAAATGG + Intergenic
943826407 2:192399335-192399357 CTTTTCTTTTCATGAACAAATGG + Intergenic
943919527 2:193686032-193686054 GTTTTATTTTTAAGGACAAATGG + Intergenic
944127665 2:196312806-196312828 ACTTTGTTTTGAGGAAAAAATGG - Intronic
944666837 2:201965841-201965863 CTTTTTTTTTGTAGAAACAAGGG - Intergenic
945662044 2:212698496-212698518 GTGTTGTTTTGAAGAACTGAGGG - Intergenic
946076632 2:217078962-217078984 AGATTGTTTTGAAGATCAAATGG + Intergenic
946278269 2:218646970-218646992 TTTCTGTTTTCTAGAACAAAAGG + Intronic
946491647 2:220154486-220154508 CTTTTTTTTTAAGGAACAGAAGG - Intergenic
946671951 2:222114557-222114579 CTTTTCCTTTCAAGAACAGATGG - Intergenic
947686013 2:232085450-232085472 CATTTGTTTGAAAGAATAAAAGG + Intronic
947765454 2:232634417-232634439 CTTTTGTTTTAAAAGATAAAAGG - Intronic
948285359 2:236780316-236780338 CTTTTGGTGAGAAGATCAAAGGG + Intergenic
1169350351 20:4863494-4863516 GTTTTGTTTTGAGGATTAAACGG + Intronic
1169561641 20:6807781-6807803 GTTTTTTTTTGAAGTACTAAAGG - Intergenic
1169751561 20:8999796-8999818 CTTTTGCTTTCATGAAAAAACGG - Intergenic
1169912289 20:10656795-10656817 CTTTTCATTAGAAGAAAAAAAGG + Intronic
1169957663 20:11123809-11123831 CTCTTGCTTTGAAGAATGAATGG - Intergenic
1170055683 20:12200355-12200377 ATTTTGTTTTTAAGAGGAAAGGG - Intergenic
1170519963 20:17174960-17174982 CTTTTTATTTGAAAAAGAAATGG + Intergenic
1172091560 20:32436423-32436445 CTTTAGTTGTGAAGATCAGAAGG + Exonic
1173106184 20:40136785-40136807 GATTTATTTTGAAGAGCAAAGGG - Intergenic
1173504843 20:43578634-43578656 CAGCTGTTTTGAAGATCAAATGG + Intronic
1174526894 20:51179565-51179587 CTTTTGTATTAAAATACAAAAGG + Intergenic
1174746025 20:53064229-53064251 CTCTGGTTTAGAAGACCAAATGG + Intronic
1175425983 20:58867316-58867338 ATTTTGTTTTGCAAAACAAATGG + Intronic
1175474357 20:59260121-59260143 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175474550 20:59262155-59262177 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175557904 20:59885732-59885754 CTTTTTATTTGAAAAACAGAAGG + Intronic
1175613970 20:60376793-60376815 TTTTTTTTTTGAAAAATAAATGG + Intergenic
1177291853 21:19122890-19122912 ATTTTCTTTAGAATAACAAATGG - Intergenic
1177698952 21:24611895-24611917 CTCTTTTTCTGAAGATCAAAAGG - Intergenic
1177876643 21:26641170-26641192 CTTTTAGTTTGAATACCAAAAGG - Intergenic
1178068173 21:28930502-28930524 CTTTTCTTTTTCAGTACAAATGG - Exonic
1178287142 21:31335097-31335119 TTTTTGTTTTGTGGCACAAACGG - Intronic
1178784562 21:35641212-35641234 CTTTTTTTTTTAACAAAAAAAGG + Intronic
1179229077 21:39484590-39484612 CTCTTGTTTTGTGGAAGAAAGGG + Intronic
1179284266 21:39963203-39963225 CTTGAGTTTTGAAGGCCAAATGG - Intergenic
1181688532 22:24545264-24545286 ATTTTGTTTCAAAGACCAAATGG - Intronic
1182191820 22:28468878-28468900 CATTTGGTTTTAAGAGCAAAGGG + Intronic
1182246548 22:28962822-28962844 CTTTAGTTTGCAAGAATAAAAGG + Intronic
949137266 3:582489-582511 GGTTTGTTTTTTAGAACAAATGG + Intergenic
949191377 3:1253245-1253267 CTTTTGCTTTCAAAAACACAAGG - Intronic
949318591 3:2784384-2784406 ATTGTGTTTCGAAGATCAAACGG - Intronic
949460895 3:4292604-4292626 CTTTGGCTTTCAAGCACAAAGGG - Intronic
949505473 3:4723693-4723715 CTTTTGTTTTGATTGGCAAAGGG + Intronic
949530535 3:4950883-4950905 CTGTTGTTTTCAAGAATGAAGGG - Intergenic
949897033 3:8775588-8775610 CTGTTCTTTTGCAGAAGAAAGGG + Intronic
950169896 3:10831186-10831208 CTGTTGTTTAGAAAAAAAAATGG - Intronic
950762132 3:15240644-15240666 GTTTTTTTTTGAAGAATAAATGG - Intronic
951008521 3:17648188-17648210 CTGCTGTTTTGAAGATCAGATGG - Intronic
951828086 3:26890742-26890764 CTTGTGTTTTGAGGAACGAGAGG + Intergenic
951963778 3:28358699-28358721 CTTTTTATTTCAAGTACAAAGGG - Intronic
952053163 3:29410956-29410978 TTTTTTTTTTTAAGAAGAAAGGG - Intronic
952113148 3:30148009-30148031 CTCTTGTTTTCAGGAAGAAAAGG + Intergenic
952587656 3:34912146-34912168 ATTTTGTCTAGAAGAAGAAATGG - Intergenic
952713955 3:36459476-36459498 CTTTTATTTTAAAGAAAATATGG - Intronic
952776680 3:37053148-37053170 CAGTTGTATTGAAGAAAAAAAGG + Exonic
954871103 3:53767997-53768019 ATTCTGTTTAAAAGAACAAAAGG - Intronic
954941607 3:54378122-54378144 CTTTCATTTTGGAGAACAAATGG + Intronic
955525205 3:59812858-59812880 TTTATGCTTTAAAGAACAAAAGG - Intronic
955638309 3:61054361-61054383 CTTTTTTTTTCCAGAAAAAAAGG + Intronic
955720270 3:61873031-61873053 CTTTTTTTTTGAAGAGCCATTGG + Intronic
955772422 3:62398924-62398946 TTTATTTTTTGAAAAACAAAAGG - Exonic
955918086 3:63926475-63926497 CTGGTGTTTTGAAGAACAGCAGG + Intronic
956130033 3:66044375-66044397 CTTTTGGTCTGAGGAACCAAGGG + Intergenic
957206744 3:77208398-77208420 CTTTTGTTTTAAAGGACATGGGG + Intronic
957303779 3:78429497-78429519 TCTTTGTTATGAATAACAAAAGG + Intergenic
958062548 3:88502977-88502999 GGATTGTTTTGAAGATCAAATGG + Intergenic
958436907 3:94108020-94108042 CTTTTATGTTATAGAACAAATGG - Intronic
958507781 3:95003290-95003312 CCTTTGATTTGAATAACCAAAGG - Intergenic
958509533 3:95028846-95028868 CCTTTGTTATGGAGAACATATGG - Intergenic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
958995331 3:100898109-100898131 ATTTTCTTTGGAAGAACAAATGG - Intronic
959010037 3:101064667-101064689 AATTTGTTCTGAAGAACAGATGG + Intergenic
959473131 3:106777213-106777235 ATTTTGTTTTCAAGAACTCAAGG + Intergenic
959603301 3:108213312-108213334 CTTGTGATTTGAAGCAGAAATGG - Intronic
959667317 3:108936327-108936349 CTTTTTTTTTGAAAAATTAATGG - Intronic
959696241 3:109252094-109252116 CTTTTGATTTGAAAAGTAAATGG + Intergenic
960468790 3:118033533-118033555 CTTTTGCTTTAAAAAACACATGG + Intergenic
960658668 3:120034187-120034209 ATGGTGTTTTGAAGCACAAATGG + Intronic
960710674 3:120524712-120524734 TTTTTGTTTTTAACCACAAAAGG + Intergenic
960854563 3:122089939-122089961 TTTTTATTTTTAAGCACAAATGG - Intronic
961922838 3:130446006-130446028 CATTTGTTTTAAAGGAGAAATGG + Intronic
962361682 3:134748427-134748449 TTTTTTTTTTTAAGATCAAAGGG + Intronic
963100197 3:141594364-141594386 ATTTTTTTTTGAAGAAATAATGG + Intronic
963166508 3:142209952-142209974 TTTTTTTTTTTTAGAACAAAAGG + Intronic
963388827 3:144631912-144631934 GGTTGGTTTTGAAGAACAAAGGG + Intergenic
963898425 3:150710650-150710672 TTTTGTTTTTGAAGCACAAATGG + Intergenic
964312488 3:155409655-155409677 ATTTTGCTTTGAAGATAAAAAGG - Intronic
964706896 3:159628063-159628085 CTTAAGTTTTGAAGAGCAAGAGG + Intronic
965486875 3:169288955-169288977 CTTTTTTTATGAAAGACAAAAGG + Intronic
965761853 3:172086384-172086406 CTTTTAATATAAAGAACAAATGG + Intronic
965922309 3:173932039-173932061 GTTTTGTTTTCCAGAGCAAATGG + Intronic
966054967 3:175675802-175675824 CTTTTGGTTTCAATAAAAAATGG + Intronic
966110070 3:176390355-176390377 CTTTTATTTTGATGGACAATTGG - Intergenic
966532666 3:180998163-180998185 TTTTTTTTTTAAAGAACTAAAGG - Intergenic
966545247 3:181138845-181138867 GTTTTGTTTTGAAAAAAAAAAGG - Intergenic
967436000 3:189446997-189447019 TTTTTGTTTTCATGTACAAATGG - Intergenic
967592177 3:191291275-191291297 CATGTCTTTTGAAGAACAAAGGG + Intronic
967706618 3:192658843-192658865 TGTTTGTTTTTTAGAACAAATGG - Intronic
967753002 3:193136056-193136078 ATTTTATGCTGAAGAACAAAAGG + Intergenic
967993448 3:195149266-195149288 TTTTTGTTTTGAATAGCATATGG - Intronic
969008895 4:4044635-4044657 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
969940860 4:10729946-10729968 ATTTGTTTTTGAAAAACAAATGG + Intergenic
970158363 4:13164296-13164318 CTTTTATTTTGAAGAAGAAAGGG - Intergenic
970529185 4:16964920-16964942 GTTTTTTTTTAATGAACAAATGG + Intergenic
971350841 4:25854600-25854622 ATAGAGTTTTGAAGAACAAAAGG + Intronic
971460418 4:26890028-26890050 ATTTTGCTTGGAAGAAGAAATGG - Intronic
971767162 4:30847367-30847389 CTTCTGGTGTGAAGCACAAAGGG - Intronic
971808431 4:31391680-31391702 CTTTTTTTCTGAAAAACAATTGG - Intergenic
972012018 4:34195374-34195396 TTTTAATTTTGAAGAAAAAATGG + Intergenic
972023684 4:34349292-34349314 ATTGTTTTTTAAAGAACAAATGG - Intergenic
972040083 4:34582789-34582811 CTTTTGTCTCAAACAACAAAGGG + Intergenic
972169088 4:36323033-36323055 GTTTTGTTTTGAAGGAAAGAAGG + Intronic
972393171 4:38632305-38632327 CTTTGTTTTTTAAGAAAAAAAGG + Intergenic
973607373 4:52600820-52600842 TTATTCTTTTGAAGAACACAGGG - Intronic
974293024 4:59958917-59958939 ATTTTGTTTGGAAGAAAAATGGG - Intergenic
974475368 4:62372311-62372333 TTTTTGTTTTAAAGAAATAATGG + Intergenic
974708862 4:65561208-65561230 CATTTATTTTTAAGAACAAGGGG - Intronic
974716394 4:65673096-65673118 TTATTGTTTTGCACAACAAAAGG + Intergenic
974998932 4:69196542-69196564 CATTTGTCTTAAAGAAGAAAGGG - Intronic
975063120 4:70028371-70028393 ATGTTATTTTGAAAAACAAAAGG + Intergenic
975070513 4:70132070-70132092 CTTTTGTTTTTAAAAATAAGAGG + Intergenic
975164276 4:71160344-71160366 TTTTTCTTTTCAAGAACACAAGG + Intergenic
975192954 4:71487589-71487611 CTTTTGTATTGGAGAAAAAGGGG + Intronic
975259871 4:72285660-72285682 CTTTTGTGTGGAGGAGCAAAAGG + Intronic
975938590 4:79612491-79612513 CTTTTCTTTTGAGTAGCAAATGG - Intergenic
975955049 4:79826904-79826926 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
976786141 4:88823638-88823660 GTTTTGTTTTAAGGAAGAAAGGG - Intronic
977244664 4:94617262-94617284 GTTTGGTTTTGAAGATCATATGG - Intronic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
977438084 4:97026207-97026229 CTTTTAGTTTTCAGAACAAAAGG - Intergenic
977483883 4:97616885-97616907 ATTTTGTTTTCAGGAAGAAAGGG + Intronic
978131800 4:105207321-105207343 CTCTCCTTTTGAAGTACAAAGGG + Intronic
978755726 4:112301029-112301051 TTTTTTTTTTGTAGAAAAAAAGG - Intronic
978895673 4:113884764-113884786 TCTTTGTTTTCAGGAACAAAGGG - Intergenic
978986162 4:115015428-115015450 ATTTTGTTTGGAAGGAGAAATGG + Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979345651 4:119583898-119583920 CTTTTGTTTTCAAAAGCAGATGG + Intronic
979508328 4:121523556-121523578 TTTTTCTTTTTAAGTACAAAAGG - Intergenic
979630467 4:122896185-122896207 TTTTTTTTTTAAAGAAAAAAAGG + Exonic
980011927 4:127605506-127605528 TTTTAGTTTTGAAAAGCAAAAGG - Intergenic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
980328845 4:131384880-131384902 ATCTTCTTTTGAAGAAGAAAAGG - Intergenic
980345915 4:131619628-131619650 CCTCTGTTTTGAATAATAAAAGG - Intergenic
980456503 4:133050767-133050789 CAACTTTTTTGAAGAACAAATGG - Intergenic
980486373 4:133462298-133462320 CTTATGTTTTGAGGGGCAAAAGG - Intergenic
980797675 4:137705906-137705928 TTTTTTTTTAGAAGAATAAAAGG - Intergenic
980841810 4:138271095-138271117 CTTTTGTTATGAGGATTAAATGG - Intergenic
980938678 4:139251229-139251251 CTTTTGTTTAGAAAAAGACAAGG + Intergenic
980978751 4:139635909-139635931 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
981379457 4:144056283-144056305 CATTTTTCTTGAAGAAAAAATGG - Intergenic
982191848 4:152865624-152865646 CTTATGTTTAGAAAAATAAAGGG + Intronic
982555309 4:156854211-156854233 CATTTGTTTTGAAGCAAAATAGG - Intronic
982558216 4:156896349-156896371 GGGTTGTTTTGAAGAATAAATGG - Intronic
982609574 4:157556992-157557014 CTTATGTTTTAAAAATCAAAGGG + Intergenic
982865310 4:160502871-160502893 CTTTTGTTTAGAACAAAGAAAGG + Intergenic
983111662 4:163757797-163757819 CTTTTGTCTTGAAGCCAAAATGG - Intronic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984347241 4:178544409-178544431 TATTTGTTAAGAAGAACAAATGG - Intergenic
984966529 4:185144651-185144673 TTTTTTTTTTGAAGAAAAAAAGG - Intronic
986630156 5:9764149-9764171 CTTGTGTTTTAAAAAATAAAAGG + Intergenic
986873246 5:12075635-12075657 CTTTTGGCTTGAAGAATCAAAGG + Intergenic
987584625 5:19838785-19838807 CTTTGTTTTAGAAGAACATATGG - Exonic
987645307 5:20663436-20663458 ATTTTCTTCTGAAGAACATATGG + Intergenic
987767875 5:22258295-22258317 CTATAGTTTTGAAAGACAAAAGG + Intronic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
988366526 5:30307725-30307747 ATTCTGTTTTGAAGAAGGAATGG + Intergenic
988424324 5:31045676-31045698 CTTTTAATTTTAAGCACAAATGG + Intergenic
988521148 5:31946647-31946669 CCTTTCCTTTGAAGAAAAAAAGG - Intronic
988964433 5:36402221-36402243 CTTTGATTTGGAAGAACACATGG + Intergenic
989183883 5:38604357-38604379 CATTTGTTTTGTAAACCAAAGGG + Intronic
989318674 5:40110238-40110260 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
989739351 5:44751907-44751929 CTATTGTTCTGAAAATCAAATGG + Intergenic
990949450 5:61283803-61283825 GTTTTGTTTTGAAGAAACAAGGG + Intergenic
990961443 5:61397920-61397942 CTTTTGTTTTGAAGGTAAAGTGG - Intronic
990979140 5:61586123-61586145 CTTTCGGTCTGAAGGACAAAGGG - Intergenic
991358490 5:65794915-65794937 CTTTTGTTTTAAAAAACAGAGGG + Intronic
991607134 5:68413999-68414021 CTTTTGTGATGCAGAAGAAAGGG - Intergenic
992082293 5:73246455-73246477 CCATTCTTTTGAAAAACAAACGG - Intergenic
992093033 5:73336258-73336280 TTTATCTTTTGATGAACAAATGG - Intergenic
992118225 5:73563555-73563577 CTTTGGTTTTGATGAACTGAAGG + Intronic
992345314 5:75869821-75869843 CGTTTGTTTGGGAGAACATAAGG + Intergenic
992603767 5:78434032-78434054 CTTTTGTTTGGAAGAGTTAAAGG + Intronic
993716918 5:91284130-91284152 CTCTTGTTTTCAAGAAAAACTGG + Intergenic
994211843 5:97095789-97095811 TTTTTATTTTCAAGAACATATGG + Intronic
994794470 5:104278052-104278074 CTTTTATTTTGAATGACAAGAGG + Intergenic
995074209 5:107961889-107961911 CTTGGGGTTTGAAGAAGAAAAGG + Intronic
995084603 5:108092858-108092880 GTTTTGTTTTGAGGAAAGAAAGG + Intronic
995974686 5:118019346-118019368 CTTGTGAGTTGAAAAACAAAAGG - Intergenic
996417424 5:123225546-123225568 CTTTTCTTTTGAAAAATAAATGG - Intergenic
996524327 5:124461872-124461894 CTTTTGATGTCAACAACAAAAGG - Intergenic
996985632 5:129560226-129560248 TTTTGTTTTTGTAGAACAAATGG - Intronic
997335479 5:133106078-133106100 TTTTTTTTTTTAAGAAGAAATGG - Exonic
998219277 5:140263165-140263187 GGCTTGTTTGGAAGAACAAAGGG + Intronic
998506533 5:142676887-142676909 TTTTTGTTTTGAAGTAAAAATGG - Intronic
998553574 5:143101454-143101476 CTTTGGTTTTTATTAACAAAAGG + Intronic
998617451 5:143755994-143756016 GTTTTGTTTTGCATCACAAATGG - Intergenic
998806720 5:145924322-145924344 CTTTGGTTTTCAGTAACAAATGG - Intergenic
999161030 5:149499284-149499306 CTTTTTTTTTAAGGAATAAAGGG - Intronic
999249400 5:150173127-150173149 GATTTGGTTTCAAGAACAAAAGG - Intronic
999575829 5:152975408-152975430 GGGTTGTTTTGAAGAATAAATGG + Intergenic
999608376 5:153342170-153342192 GTTTTGTTTTACAGAACTAAGGG + Intergenic
999689368 5:154133645-154133667 CTTTTGTTAGGAAGAAAAAGAGG + Intronic
999807176 5:155092946-155092968 TTTTTGTTTTGTATAACCAAAGG + Intergenic
999817907 5:155196347-155196369 TTTTTGTTTTCAAGAAGTAATGG + Intergenic
1000127509 5:158260852-158260874 TTTTTCTTTTGATGAACAATTGG + Intergenic
1001293491 5:170483041-170483063 CTTTTGTTTCCAAGGACAGATGG + Intronic
1002683061 5:180983768-180983790 CATTTGAGTCGAAGAACAAAAGG - Intergenic
1003717214 6:8660587-8660609 ATATTGTTTTGAAAAAAAAAGGG - Intergenic
1003890000 6:10555722-10555744 CTCTTGTTTTGAAAAACAGTGGG + Intronic
1004955568 6:20724244-20724266 GTATTATTTTGAATAACAAAGGG + Intronic
1005231126 6:23702976-23702998 CATTCGTTTTGAAAAACAGAAGG + Intergenic
1005245544 6:23880373-23880395 GTGTTGTTTTGAAGATTAAATGG - Intergenic
1006924138 6:37645052-37645074 CTATAGTTTTGAAATACAAATGG + Intronic
1008207380 6:48678959-48678981 CTTTTATTTAGAAAAACTAAAGG - Intergenic
1008446337 6:51596253-51596275 TGTATGTTTTCAAGAACAAATGG + Intergenic
1008490714 6:52083962-52083984 CTTTTGTTTAAAAAAAAAAAAGG + Intronic
1008830754 6:55758176-55758198 CTTTTGTATTTAAGAAGAATGGG - Intronic
1010492150 6:76489349-76489371 CATTTGTTTTAAAGGAAAAAGGG + Intergenic
1010863631 6:80944647-80944669 CTTTTTTTTTTAGGAAGAAAAGG - Intergenic
1011107193 6:83795631-83795653 TTTTTATTTTAAATAACAAATGG - Intergenic
1011534882 6:88366006-88366028 GTTTTGTTATTAAGAAGAAATGG - Intergenic
1011991446 6:93523871-93523893 CATTTATTTTAAACAACAAATGG + Intergenic
1012102111 6:95103344-95103366 CTTAAGTTTTGAAGGAAAAAAGG - Intergenic
1012221145 6:96650852-96650874 TTTTTTTTTTTAAGAAGAAATGG + Intergenic
1012801172 6:103830778-103830800 GTTTTGTTTTGTAGAGCAGAGGG + Intergenic
1012841549 6:104334677-104334699 CTTATCATTGGAAGAACAAAAGG - Intergenic
1013370388 6:109465469-109465491 TTTTTGTTTTCTAGGACAAAGGG - Exonic
1013586613 6:111584393-111584415 CCTTTGTTTTCAACAATAAAAGG - Intronic
1013839107 6:114368983-114369005 CTTTTTTTTTGGAAAAAAAAAGG - Intergenic
1014651965 6:124050935-124050957 CTTTCCCTTTGAAAAACAAAAGG - Intronic
1014847760 6:126299750-126299772 GTTTTGTTATGTAAAACAAAGGG - Intergenic
1015128349 6:129780825-129780847 CTTTTGCTTTTTAGAAAAAATGG - Intergenic
1015209790 6:130683945-130683967 CTCTTGTTTTGAAGAAGCAGTGG - Intergenic
1015363507 6:132370092-132370114 CTTTTTGTTTGCAGAAGAAAAGG + Intronic
1015474558 6:133645737-133645759 CCTTTGTTTTGGAAAAGAAATGG + Intergenic
1015757102 6:136618911-136618933 ATTTTGTTTGGAGAAACAAATGG + Intronic
1016466250 6:144328192-144328214 CTTTTGTTTAAAAAAAAAAAAGG - Intronic
1017023673 6:150162764-150162786 CATTTGTTTTTAAGAGCACAGGG - Intronic
1017518074 6:155175754-155175776 TTTTTGTTATGAATTACAAAAGG + Intronic
1017740517 6:157402731-157402753 CTTTTGTCTGGAAAAAGAAAAGG - Intronic
1018375925 6:163212574-163212596 CATTTATTTTGAAGGTCAAAGGG - Intronic
1018674293 6:166205738-166205760 CTTTAGATATGAAGACCAAAAGG + Intergenic
1019670704 7:2276630-2276652 TTTTTTTTTTAAAGTACAAATGG - Intronic
1019951813 7:4379246-4379268 TTTTAGTTTTGAAGAGCTAAGGG - Intergenic
1020459842 7:8417046-8417068 CATGTGTGTTCAAGAACAAAGGG + Intergenic
1020495786 7:8851879-8851901 TTTTCGATTTGAAGATCAAAAGG + Intergenic
1022085617 7:27064595-27064617 CTTTTTTTTTAAAGAAAAAATGG - Intergenic
1022634264 7:32117189-32117211 GTTTTGTTTTAAAGGTCAAAAGG + Intronic
1022673286 7:32475953-32475975 TTTTTTTTTTTAAGAAAAAATGG - Intergenic
1023210666 7:37800999-37801021 CTTCTGTTTTCAGGAAGAAAAGG + Intronic
1023502877 7:40869295-40869317 CTTCAGATTTGAAGCACAAAGGG + Intergenic
1023707156 7:42953118-42953140 CTTTTGTTTAGCAAAACCAATGG - Intergenic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024292365 7:47813891-47813913 CTTTTGCTTCCAAGAATAAATGG - Intronic
1024489709 7:49966387-49966409 ATATTCTTTTGAAGTACAAATGG + Intronic
1024538008 7:50454300-50454322 CTCTTGTTTTCAAGAAAAACTGG + Intronic
1024553274 7:50581492-50581514 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1024697152 7:51869447-51869469 TTTTTTTTTTGAAGAACATATGG + Intergenic
1024784264 7:52887813-52887835 CTTTTGTGAGAAAGAACAAAAGG + Intergenic
1025185735 7:56856849-56856871 CTTCTGTTTTGCTGAACACAAGG + Intergenic
1025557139 7:62323063-62323085 TTTTTATTTTGAAGATCATATGG - Intergenic
1025686194 7:63720095-63720117 CTTCTGTTTTGCTGAACACAAGG - Intergenic
1026587946 7:71672098-71672120 CTTTTATTTTGGAGAAGAAAAGG - Intronic
1027568624 7:79831764-79831786 CTTTTCTTTTAAAGAAAATAAGG + Intergenic
1027847338 7:83398637-83398659 TCTTTGTTTTAAAAAACAAAAGG + Intronic
1028000030 7:85482770-85482792 CTTTTCTTTTTAACAATAAATGG + Intergenic
1028490482 7:91405924-91405946 ATTTTTTATTGAAAAACAAATGG + Intergenic
1028823496 7:95241684-95241706 CATTTCTCTTGAAGAAAAAATGG + Intronic
1030382430 7:108827704-108827726 CTATTGTGGTGAAAAACAAATGG + Intergenic
1031334119 7:120504979-120505001 CTTTTGCTTTTAAAAATAAAGGG + Intronic
1031571785 7:123368414-123368436 CTGTTATTTTGAAGAACAGAGGG + Intergenic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1032462787 7:132124239-132124261 CTTTTCATTTTAAGAACAGAAGG + Exonic
1032657507 7:133947512-133947534 TTGTAGTTTTGAAGAACAAAAGG - Intronic
1032885795 7:136136912-136136934 CTTCTGTTTGGGAGAACAATAGG + Intergenic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033252849 7:139776199-139776221 CTTTGATTCTGAAGAACACAAGG - Intronic
1033910108 7:146252720-146252742 CTTTTCTTTTTAAGAATATAAGG - Intronic
1034947811 7:155274886-155274908 TTTTTGTTTAGAAGAAAGAAGGG - Intergenic
1035208404 7:157309849-157309871 GCTTAGTTCTGAAGAACAAAGGG + Intergenic
1036344874 8:7954863-7954885 CTTTCTTTTGGAAGATCAAATGG - Intergenic
1036375632 8:8197048-8197070 TTTATGTTTTGAAGAGGAAAGGG - Intergenic
1036526952 8:9543752-9543774 CTTATGCTGTGAAAAACAAAAGG + Intergenic
1036599517 8:10247524-10247546 CTTATGTTTAGAAGGAAAAAGGG + Intronic
1036634908 8:10542497-10542519 GTTTTGTATTTAAGAATAAAGGG + Intronic
1036840214 8:12115630-12115652 CTTTCTTTTGGAAGATCAAATGG - Intergenic
1036853899 8:12226096-12226118 TTTATGTTTTGAAGAGGAAAGGG + Intergenic
1036862003 8:12361867-12361889 CTTTCTTTTGGAAGATCAAATGG - Intergenic
1036875271 8:12468606-12468628 TTTATGTTTTGAAGAGGAAAGGG + Intergenic
1036878908 8:12495753-12495775 TTTAGGTTTTGAAGAACACAGGG + Intergenic
1037036237 8:14170927-14170949 CATTACTTTTGAAGAAAAAAAGG + Intronic
1037200309 8:16244269-16244291 ATGTTGTTTTGAGGATCAAATGG + Intronic
1037353430 8:17990821-17990843 CTTTTGTTTTGGCGAACAGTAGG - Intronic
1038197623 8:25382660-25382682 GTTTTGTTTTCCAGAAAAAAAGG + Exonic
1038304618 8:26388034-26388056 CTTTTGTTTTTATAAAGAAATGG - Intronic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1038954618 8:32453901-32453923 TGTTTGTTTTGAAGAACACAGGG - Intronic
1038980126 8:32750698-32750720 TTTTTTTTTTGAGGAAGAAATGG - Intronic
1039121562 8:34153400-34153422 TTTTGCTTTTGAAGAAGAAATGG + Intergenic
1039367847 8:36950481-36950503 TTTTTGTTTTCAAAAACAAGAGG - Intergenic
1039997730 8:42548643-42548665 ATTTTGTGTTTAGGAACAAAAGG + Exonic
1040021823 8:42747619-42747641 CATTTGTTCAGAAGAACCAAAGG - Intergenic
1041586162 8:59522355-59522377 CCTTTCTTTTCAAGAACAAATGG + Intergenic
1041758315 8:61337662-61337684 CATTTGTTTTGCAGATTAAATGG - Intronic
1042140550 8:65674310-65674332 TTTTTTTTTTAAAGAAAAAAAGG + Intronic
1042789489 8:72587964-72587986 CATTTGCTTTCAAGAAAAAATGG + Intronic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1043251588 8:78080642-78080664 TTTTTATTTTGAAAAAAAAATGG - Intergenic
1043710247 8:83407457-83407479 GTTTCATTTTGAAGAACACAGGG - Intergenic
1043874684 8:85472186-85472208 CTTTGGCATTGCAGAACAAAGGG - Intronic
1044112569 8:88293700-88293722 CTTTTTTTTAGAAAACCAAAAGG + Intronic
1044138467 8:88617670-88617692 CTTTTGTTTTGCTGAGAAAAAGG + Intergenic
1045205744 8:100038262-100038284 CTTTTGTGGGGAAGAAGAAAAGG - Intronic
1045268704 8:100643558-100643580 GTGCTGTTTTGAGGAACAAATGG - Intronic
1045886763 8:107107868-107107890 CTTAAGATTTGAGGAACAAAGGG + Intergenic
1046012903 8:108572016-108572038 GTTATGTTTGGAAGAAAAAATGG + Intergenic
1046020492 8:108659145-108659167 CTTTAGTTTTGAAGGAGAAATGG - Intronic
1046541272 8:115586951-115586973 CATTTGTTTTGAAGGGCAAAAGG - Intronic
1046620825 8:116527925-116527947 TTTCTGTATTGAACAACAAAAGG + Intergenic
1047021395 8:120778478-120778500 CTTTTCATTTTCAGAACAAAAGG + Intronic
1047242345 8:123102357-123102379 CTTTTTTTTAGAATAAAAAAAGG - Intronic
1047541275 8:125768766-125768788 CTTTTGTGTGGAAGACCACAGGG + Intergenic
1047789696 8:128190506-128190528 CTCTTGGTTTCAAGAACATAGGG - Intergenic
1048431187 8:134372853-134372875 TTTTTGTCTTGAATAACTAAAGG - Intergenic
1048703533 8:137122764-137122786 ATTATATTTTGAAGATCAAATGG + Intergenic
1049125696 8:140785569-140785591 CTTTGGTTGTGAAGAAAAATGGG + Intronic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1049667734 8:143854498-143854520 CATTTATTTTGAAGAAATAATGG + Intergenic
1050093563 9:2040316-2040338 TTTTTGTTATGAAGAACATCTGG + Intronic
1050167847 9:2784922-2784944 TTTCTGTTTTGAAGTACAGAAGG - Intronic
1050565632 9:6879593-6879615 CTTTTGTTTTTAAGAAAATCTGG - Intronic
1050605608 9:7297907-7297929 CTTTTTATCTGAACAACAAATGG - Intergenic
1051461441 9:17321019-17321041 AATTTGTTTTGAAAAACAAAAGG - Intronic
1052261058 9:26516729-26516751 CTATTGTTGTGAAGCACTAAAGG + Intergenic
1052687943 9:31777913-31777935 CATTTGTCTTGAAGGAGAAAGGG - Intergenic
1053109159 9:35441989-35442011 CTTTCTTTTTGTAGAACACATGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1055644303 9:78348303-78348325 CTTCTGTTTTTAGGAAGAAATGG + Intergenic
1055997131 9:82172261-82172283 CTTTTTTTTTAAAAAAAAAAAGG + Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1056017495 9:82405894-82405916 CTTTTGTTTTGAAGACCAATAGG + Intergenic
1057257849 9:93565683-93565705 TTTTTTTTTTTAAGATCAAAGGG - Exonic
1057746035 9:97752131-97752153 CTTTTCTTTTGAAGGAAAAAGGG + Intergenic
1058192123 9:101931081-101931103 CTTTTGATATGAAAATCAAAAGG - Intergenic
1058626345 9:106937094-106937116 ATTTTATTTTAAAGAAGAAAAGG + Intronic
1059276500 9:113101730-113101752 TTTATATTTTGGAGAACAAAAGG - Intergenic
1059641489 9:116220957-116220979 TTTTTATTTTGTAGAACTAAAGG + Intronic
1059734994 9:117091773-117091795 CTTTTGTTTTCAGGATGAAATGG - Intronic
1059745630 9:117198057-117198079 CTTTTGTTTAGAAGAAATAAAGG - Intronic
1059758275 9:117313985-117314007 CTTTTGTTTTGCACAAAACAAGG - Intronic
1059841418 9:118221782-118221804 CATTTTTCTTTAAGAACAAAAGG - Intergenic
1059951561 9:119468371-119468393 CATTTGTGTTGATTAACAAAAGG - Intergenic
1059964918 9:119604156-119604178 CTTTTGTTTAAAAGTACAAGGGG - Intergenic
1060135773 9:121152102-121152124 CCTGGGTTTTGAAGAACGAACGG - Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1060932248 9:127496491-127496513 ATTCTGTTTTGAAGAATAAGTGG - Intronic
1061349259 9:130051344-130051366 CTTTTGATAAGAAAAACAAATGG + Intergenic
1061921666 9:133785816-133785838 CTTCTGTTTTGCAGAAAAACTGG + Exonic
1062516306 9:136938413-136938435 TTTTTTTTTTTAAGTACAAAAGG + Intronic
1185999787 X:4995881-4995903 TTTTTGTGTTGAAGAATCAAAGG - Intergenic
1186219111 X:7330707-7330729 CATTAGTTTTGCAGAACTAAAGG + Intronic
1186736089 X:12465564-12465586 CATTTGTTTTGAGGCACATAGGG - Intronic
1187231166 X:17424617-17424639 CTTGAGTTTGGAAGAAGAAAAGG + Intronic
1187574056 X:20535140-20535162 CTTCTGTGATGAGGAACAAAAGG - Intergenic
1187593228 X:20741719-20741741 CTATCCTTTTGAAGAACACATGG + Intergenic
1188096088 X:26024117-26024139 CATTTGTCTTCAAGAACACATGG + Intergenic
1188125138 X:26358090-26358112 TTTTTCTCTAGAAGAACAAAAGG - Intergenic
1188639947 X:32488747-32488769 GTCTTGATTTGAGGAACAAATGG - Intronic
1188649411 X:32612880-32612902 CTTCAGTTTTGAATGACAAATGG - Intronic
1189509322 X:41646159-41646181 CATTTGTTTTAAAGGAGAAAGGG - Intronic
1189557836 X:42163853-42163875 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1190706016 X:53028803-53028825 CTTTTTTTTTAAATGACAAATGG + Intergenic
1191125293 X:56947686-56947708 CATTTGTTTTAAAGGAGAAAGGG - Intergenic
1191588179 X:62851510-62851532 ATTTTGCTTGGAAGAAGAAATGG + Intergenic
1193526227 X:82592738-82592760 CATTGGGTTTGAAGAATAAAAGG - Intergenic
1193629432 X:83864070-83864092 CTTTTTCTTATAAGAACAAAGGG - Intronic
1194428943 X:93776600-93776622 CTTTTGTTTTAAAAAAGAAGGGG + Intergenic
1194709930 X:97223130-97223152 GTTTTGTCTTAAAGTACAAAAGG + Intronic
1194791660 X:98158790-98158812 CTTTTATTTTTAAGAACACATGG + Intergenic
1195937021 X:110135227-110135249 CTTTTTTTTTTTAGAAGAAAAGG - Intronic
1197009749 X:121546063-121546085 ATTTTATTTTGAAGAACAATTGG + Intergenic
1197334932 X:125202383-125202405 ATTTGGTTTTAAAGACCAAAAGG - Intergenic
1197919306 X:131574035-131574057 GTATTGTTTTGCAAAACAAAGGG + Intergenic
1197988920 X:132296222-132296244 ACTTTGTTTGGAAGAAAAAATGG - Intergenic
1198564130 X:137885874-137885896 CTTAGGTATTGAAGAACATATGG + Intergenic
1198734198 X:139768495-139768517 TTTTTTTTTTAAACAACAAAGGG + Intronic
1198944092 X:141990509-141990531 CTTTTCTTGTGCAAAACAAAAGG + Intergenic
1199240357 X:145541205-145541227 ATTTTGCTTTGAAGAAGAAATGG + Intergenic
1200314668 X:155119498-155119520 CTTTTGAAATGAAGAACAGAGGG - Intronic
1200440452 Y:3206493-3206515 ACTTTGTTTGGAAGAAGAAATGG - Intergenic
1200550103 Y:4569000-4569022 CTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1201601183 Y:15730234-15730256 TCTTTCTTTTGAGGAACAAAAGG - Intergenic
1202246984 Y:22830084-22830106 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202399973 Y:24463832-24463854 CATTTGTTTTAAAGGAGAAAGGG + Intergenic
1202470808 Y:25206254-25206276 CATTTGTTTTAAAGGAGAAAGGG - Intergenic