ID: 1106002377

View in Genome Browser
Species Human (GRCh38)
Location 13:25736386-25736408
Sequence GATTCCTACCCAGGAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106002377_1106002380 3 Left 1106002377 13:25736386-25736408 CCCTGTGTTCCTGGGTAGGAATC 0: 1
1: 0
2: 1
3: 9
4: 157
Right 1106002380 13:25736412-25736434 TATTAACTGAACGCGACATGAGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106002377 Original CRISPR GATTCCTACCCAGGAACACA GGG (reversed) Intronic
900482905 1:2907991-2908013 GATTCAGACCCAGACACACAGGG + Intergenic
901881094 1:12194256-12194278 GATTCCTATCCAGGAAGCCTGGG + Intronic
902817169 1:18922946-18922968 CATCCCTGCCCAGGAGCACAGGG + Intronic
905921185 1:41719989-41720011 GATTTATTCCCAGGTACACAAGG + Intronic
906183097 1:43838417-43838439 GAGTCCTTTCCAGGAACCCATGG - Intronic
906835538 1:49079707-49079729 GAATCCTACCCAGGTAAAAATGG + Intronic
910784904 1:90985907-90985929 CATTCCTAACAAGGTACACAAGG + Intronic
911877081 1:103180189-103180211 GATTCCTTCCCATGTATACAAGG + Intergenic
912248520 1:107987297-107987319 GATTGCTACACAGGCACAGAGGG + Intergenic
913373955 1:118130868-118130890 GATTCTTTCCCAAGAACACAGGG + Intronic
915940121 1:160113741-160113763 AATTCCAACCCAGGAACCTACGG + Intergenic
918650992 1:186962920-186962942 GATTCCAAGCCAGGTTCACAAGG - Intronic
918885486 1:190187996-190188018 TATTCCAACTCATGAACACAGGG + Intronic
920928186 1:210362573-210362595 GTTTCCAACACAGGAAAACATGG - Intronic
921606951 1:217167108-217167130 GATTCCTAGCGGGAAACACATGG + Intergenic
922931888 1:229396499-229396521 GTTTCCTACACTAGAACACAAGG - Intergenic
1064887763 10:20130828-20130850 GATCACTACCCATGATCACATGG - Intronic
1065178900 10:23105454-23105476 GTTTCCTACCCTGGAAAGCAGGG - Intronic
1067328164 10:45289511-45289533 CATTGCTACCTAGTAACACAAGG - Intergenic
1070553006 10:77505683-77505705 GGTTGCAGCCCAGGAACACAGGG + Intronic
1070791245 10:79190670-79190692 GATTTCTACCTAGCCACACAGGG - Intronic
1072087038 10:92090206-92090228 GATTCCTATCTAGGAAAAAAAGG + Intronic
1074507382 10:114083462-114083484 GATTGCTGGCCAGGAACAAAAGG - Intergenic
1075569699 10:123530859-123530881 GATTCAGACACAGGCACACAGGG + Intergenic
1075907180 10:126091840-126091862 CATTCCTCCCCACGAGCACAGGG + Intronic
1075927086 10:126260298-126260320 GAATCCCAGCCAGGAACAGAGGG - Intronic
1076750437 10:132539466-132539488 CATTCCCACCCAGGATCCCAGGG + Intronic
1077729836 11:4718660-4718682 GCTTCCAGCCCAGGAACACCAGG - Intronic
1077844810 11:6013091-6013113 GACTCCTGCCCAAGAGCACAGGG + Intergenic
1082629320 11:55522412-55522434 GATATCTTCCAAGGAACACAAGG + Intergenic
1085155094 11:74286219-74286241 GAATCCTACCTGGGAACCCAGGG + Exonic
1085621101 11:78038499-78038521 GATTCCTCTCCAGGAACCCAAGG - Intronic
1088011438 11:105006104-105006126 GAGTCCTTCCCTGGAAAACATGG + Intronic
1089740630 11:120579491-120579513 AATTCCTTCCCTGGCACACAAGG - Intronic
1089771274 11:120804955-120804977 GATTCCTCCCCAAGAAGGCATGG + Intronic
1091831825 12:3555529-3555551 GATTTGTAACCAGGAAAACAAGG + Intronic
1092490193 12:8937987-8938009 GATTACTGGACAGGAACACAGGG - Exonic
1094071155 12:26414527-26414549 GATTTCTACCCAGCAAAGCAGGG + Intronic
1096946162 12:55411928-55411950 GATTACTGGACAGGAACACAGGG + Intergenic
1097175454 12:57139951-57139973 GACTCCCATCCAGGCACACATGG + Intronic
1097415703 12:59313631-59313653 CATTCCCACCCAGAAAAACAGGG + Intergenic
1102521942 12:113483343-113483365 GATTCCAACACAGGAGCACTGGG - Intergenic
1102961455 12:117096193-117096215 GATTCCTCCCCAGAAAGTCAGGG + Intronic
1105350028 13:19606657-19606679 CATTCCTCCCCAGGACTACAAGG + Intergenic
1106002377 13:25736386-25736408 GATTCCTACCCAGGAACACAGGG - Intronic
1113199927 13:107855700-107855722 AATTCAAACCCAGGAACACCTGG - Intronic
1113892990 13:113746205-113746227 GCTCCCTGCTCAGGAACACAAGG - Intergenic
1114583603 14:23788689-23788711 CAATCCCACCCAGGAACAGAAGG + Intergenic
1114928594 14:27437681-27437703 GATTCCCACTTATGAACACATGG + Intergenic
1116496605 14:45568454-45568476 GATTCTTAGCCAGGCAAACAAGG - Intergenic
1118363298 14:65073784-65073806 GCTTCCTGGGCAGGAACACAGGG - Intronic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1126036817 15:44553971-44553993 GATTTGTACCCAGGAAGACTGGG - Intronic
1126298135 15:47165109-47165131 GACTCCTCCCCAGGAATGCAAGG - Intergenic
1126431212 15:48587019-48587041 GATGCCTCCCCAAGAAGACATGG + Intronic
1126796755 15:52265876-52265898 GATTTCAATCCAAGAACACAGGG + Intronic
1127534790 15:59880114-59880136 CATTTCTACCCAGCAACACTTGG - Intergenic
1128333672 15:66772690-66772712 GTTTCCTAACCTGTAACACAGGG - Intronic
1128505325 15:68266305-68266327 AATTCTTGCCCAGGAAGACAAGG - Intergenic
1128988454 15:72238188-72238210 GATTCCTCTCCAGAAACTCAGGG + Intergenic
1129384414 15:75188092-75188114 GATTTGAACCCAGGAAGACAGGG + Intergenic
1131417212 15:92270749-92270771 ATGTCCTACCCAGGAACACCTGG + Intergenic
1132534549 16:471580-471602 GATTCCTGCCCAGGCTGACAGGG - Intronic
1133012986 16:2925224-2925246 GGTGCCTCCCCAGGAACAAAGGG + Intronic
1135428244 16:22358534-22358556 GAATCCTAACCTGGAACGCAGGG + Intronic
1135558327 16:23455314-23455336 GATTCCTACTAGGGAACACTTGG - Intergenic
1136033082 16:27517510-27517532 GCTTTCTTCCCAGGAACAAAAGG + Intronic
1144131631 17:12252242-12252264 GATGGCAACTCAGGAACACAAGG - Intergenic
1144365431 17:14540166-14540188 GATTTCCACCGAGGAGCACAAGG + Intergenic
1146681289 17:34810277-34810299 ACTTCCTATGCAGGAACACAGGG + Intergenic
1147637311 17:41972034-41972056 GAGTCTTCCCCAGGGACACATGG + Intronic
1147675298 17:42201164-42201186 CATTCCTACCCAAGAACACAGGG + Exonic
1147770692 17:42866183-42866205 GATTCTTCCCCAGGTACACGAGG + Intergenic
1148330216 17:46809664-46809686 GATTTCCAACCAGGGACACATGG - Intronic
1152190090 17:78883057-78883079 GGTTCCTGCCCAGCACCACAGGG - Intronic
1152190832 17:78886247-78886269 GATTCCTCACCTAGAACACATGG + Intronic
1152525195 17:80884501-80884523 GACTTCTCCCCAGGACCACATGG + Intronic
1154238793 18:12632283-12632305 GAAGCAGACCCAGGAACACATGG - Intronic
1161572996 19:5040546-5040568 GGCGCCTACCCAGGTACACATGG + Intronic
1161703496 19:5806982-5807004 GATTTAGACCCAGGGACACAGGG + Intergenic
1162809596 19:13155906-13155928 GATTCCTTCCTGGGAACACGTGG + Intergenic
1165175298 19:33925165-33925187 GATTCCTTTCCAGCCACACAGGG + Intergenic
1165719259 19:38067407-38067429 AATTCCTACCCAGGGACCCAGGG - Intronic
1167704996 19:51076763-51076785 GTTCCCTACCCTGGACCACAGGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926424270 2:12727048-12727070 CATTTCTACCCAGCAGCACAAGG - Intronic
927152421 2:20203696-20203718 TATTCCTCACCAGGAAGACAGGG - Intronic
927300039 2:21501713-21501735 AATTCACACCCAGGAACAGAAGG + Intergenic
929303313 2:40331104-40331126 GATTCCTACCTAGGAAAATGAGG + Intronic
929917767 2:46150527-46150549 GTTTCCTCTCCAGGAGCACAGGG + Intronic
931135997 2:59401928-59401950 TATTCTTATCCATGAACACAAGG - Intergenic
936518017 2:113194303-113194325 AATTCAAACCCAGGAACACCAGG - Intronic
938508322 2:131911026-131911048 GATTCCAACCAAAGAACAAAAGG + Intergenic
942605242 2:177683574-177683596 GGTTCCCACACAGGAACAGAAGG - Intronic
943723368 2:191228508-191228530 CATGCCTAACCAGGACCACAGGG - Intergenic
944898118 2:204186672-204186694 GATTCCTTTCCAAGAACAGAGGG + Intergenic
945972434 2:216243728-216243750 GATTCCTATCAAGGAAGAGAGGG - Intergenic
946779762 2:223181793-223181815 GATTCCTGGGAAGGAACACATGG + Intronic
948004463 2:234595816-234595838 CAGTCCCACCCAGGAACAGAAGG - Intergenic
948352460 2:237352260-237352282 GATTTCCACCCAGGGACACTTGG + Intronic
948540953 2:238691203-238691225 GGATTCTGCCCAGGAACACAGGG - Intergenic
1168879307 20:1193200-1193222 GATTTCTTACCTGGAACACAAGG - Intergenic
1168966193 20:1899610-1899632 GATTCAGACACAGGAAGACAAGG - Intronic
1174289142 20:49495121-49495143 TATTCTTACCCAGGAATTCATGG - Intergenic
1176785173 21:13247537-13247559 GATTCCAACCAAAGAACAAAAGG - Intergenic
1177560000 21:22738487-22738509 GTTTCTGTCCCAGGAACACAAGG + Intergenic
1177983210 21:27941295-27941317 GATTCCAACCAAAGAACAAAAGG - Intergenic
1179032195 21:37730331-37730353 GATTCCAACCCAGGCCCACCAGG - Intronic
1179126831 21:38598438-38598460 GTTTCCTAACCTGGAAAACAGGG + Intronic
1183081202 22:35457845-35457867 AATTCCTAGCCAGGCACAAAAGG - Intergenic
1183574723 22:38680572-38680594 TATTCCTACCAAGTAAAACATGG + Intergenic
952519503 3:34142468-34142490 GTTTCTTACCAAGGGACACACGG - Intergenic
955423693 3:58765541-58765563 AATTCCTTCACAGGAACAAATGG - Intronic
955908080 3:63828843-63828865 GTTTCAAACCCAGGAACACCTGG + Intronic
956745380 3:72307042-72307064 GCTTTCTCCCCAGGAAGACAGGG - Intergenic
959760086 3:109951726-109951748 AAATTCTACCCAGGAACTCAGGG + Intergenic
960786102 3:121373904-121373926 GCATCCTACCCAGGGACTCAAGG + Intronic
962614941 3:137116327-137116349 GAGTACTACCCAGGAAACCAGGG - Intergenic
964674521 3:159262810-159262832 ATTTGCTACCCAGGAACCCATGG + Intronic
964965840 3:162492413-162492435 AATTCCTACCCAGGAAGATAAGG - Intergenic
966535277 3:181026219-181026241 GATATTAACCCAGGAACACAGGG - Intergenic
967531018 3:190549177-190549199 GGTTCCCACCCAGGAACAAGAGG + Intronic
967845954 3:194042946-194042968 GATTTGTCCCCAGGAACTCAGGG - Intergenic
971666517 4:29493671-29493693 GGTTCCTGCTCAGGAAAACAGGG + Intergenic
972311474 4:37887693-37887715 GAGTATGACCCAGGAACACAAGG - Intergenic
974446096 4:61984055-61984077 AATGCCTACCCAGGAAAAAAGGG - Intronic
975972081 4:80051581-80051603 GATTTCTATCCAGGCAAACATGG - Intronic
979404723 4:120295417-120295439 GATTGCAACCAAGGAGCACAGGG - Intergenic
985024609 4:185728355-185728377 GATTCCCATCCAGAAATACAGGG - Intronic
985481952 5:118408-118430 GAATCCTTCCCAAGTACACATGG + Intergenic
986897152 5:12384724-12384746 GAGTTCTTCCCAGGAAAACATGG + Intergenic
988968880 5:36446099-36446121 GGTTCCCACGCAGGAACACTAGG + Intergenic
994439270 5:99781591-99781613 GACTCGTACCAAGGAACTCATGG + Intergenic
999818418 5:155200549-155200571 CATTCCTGCCCAGCACCACAGGG + Intergenic
1002858827 6:1061823-1061845 GATTCCAACCCAACACCACAGGG + Intergenic
1010864395 6:80956101-80956123 GATTCCTACCCCAAGACACAAGG - Intergenic
1011730546 6:90258163-90258185 AACTCCTACACAGGAACATAGGG - Intronic
1011832768 6:91393424-91393446 CATTGCTACCCAGGAAGTCATGG - Intergenic
1012115106 6:95286664-95286686 AATTGCTAGCCAGGGACACAGGG - Intergenic
1014631034 6:123790081-123790103 GATTCCTCCACAGGGCCACAGGG - Intergenic
1017798737 6:157872422-157872444 GATTCCTAAGCAGTAACAAATGG - Intronic
1018480584 6:164185506-164185528 GCTCCCTCCCCAGGGACACAAGG - Intergenic
1018714238 6:166519654-166519676 GTTTCCTTCCCAGGAAAACACGG + Intronic
1021924016 7:25517797-25517819 GCTTTCTACCCAGGAGCAAAAGG - Intergenic
1024419549 7:49147603-49147625 GATTTCATGCCAGGAACACAGGG + Intergenic
1026262993 7:68771904-68771926 GATTCCAACACACGAACATATGG + Intergenic
1028511829 7:91633898-91633920 GAATCCTCCCCAGTAAGACAGGG + Intergenic
1029104527 7:98164637-98164659 GAGTCCTAACCAGGATCACTGGG + Intronic
1040458959 8:47628356-47628378 GAATTCTACCCATGAAAACATGG - Intronic
1041272388 8:56122003-56122025 GATACCTACCCAAGACCAGAGGG + Intergenic
1041401296 8:57448200-57448222 GGTTCCCACCCAGGAACAGAAGG + Intergenic
1044013503 8:87023660-87023682 GATGGGTATCCAGGAACACAAGG - Intronic
1044935225 8:97287434-97287456 GATTCATGCCCAGGACCAGATGG - Intergenic
1045887164 8:107112438-107112460 GAGTCCCTCCCAGGAAAACATGG - Intergenic
1047820537 8:128514966-128514988 GCTCCCTGCCCAGAAACACAAGG + Intergenic
1049370838 8:142265434-142265456 GAGTTCTACCCAGGAACAAAAGG - Intronic
1050602098 9:7263224-7263246 CATTCCTTTCCAGGAACACATGG + Intergenic
1053391572 9:37740065-37740087 GATTCATAGCCTGCAACACAGGG - Exonic
1054851731 9:69853358-69853380 AATTCGTACTCAGGAAAACAGGG + Intronic
1057014767 9:91642118-91642140 GATTCCTACCCAGGGAAGCCTGG + Intronic
1057832745 9:98419421-98419443 CTTTCCTACCCAGAAACACATGG - Intronic
1058119130 9:101119272-101119294 GCTTACCACCCTGGAACACAAGG - Intronic
1060350767 9:122857527-122857549 GATTCCTACCCTGTAAAATATGG + Intronic
1062319967 9:135986074-135986096 GATGCCTGCGCAGGGACACAGGG - Intergenic
1185461661 X:335473-335495 GATTCCTGCCAAGCAGCACAGGG - Intronic
1186298396 X:8172826-8172848 GAGTGCTACCCAGGAAAAAAAGG - Intergenic
1194447555 X:94007214-94007236 GATTCCTAACCAAGAACTCCAGG + Intergenic
1196647957 X:118138429-118138451 AATTCCAATCCATGAACACAGGG + Intergenic