ID: 1106003546

View in Genome Browser
Species Human (GRCh38)
Location 13:25747628-25747650
Sequence TCCCCACGCATTGTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106003546_1106003553 12 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003553 13:25747663-25747685 GGGAAGAATTTCAGGATGTCAGG 0: 1
1: 0
2: 3
3: 17
4: 232
1106003546_1106003551 -8 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003551 13:25747643-25747665 CGTGGGGAGGGGTTTGTTTAGGG 0: 1
1: 0
2: 2
3: 9
4: 180
1106003546_1106003552 4 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003552 13:25747655-25747677 TTTGTTTAGGGAAGAATTTCAGG 0: 1
1: 0
2: 3
3: 25
4: 422
1106003546_1106003550 -9 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003550 13:25747642-25747664 GCGTGGGGAGGGGTTTGTTTAGG 0: 1
1: 0
2: 0
3: 22
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106003546 Original CRISPR TCCCCACGCATTGTATCCCC AGG (reversed) Intronic
900587224 1:3439066-3439088 TCCCCACGCTTTTTAGCACCAGG + Intergenic
910697332 1:90033380-90033402 TCCCCCTGAATTGTTTCCCCAGG - Intronic
911953671 1:104209360-104209382 TCCCCAAACCTTGTATCCACTGG + Intergenic
912801520 1:112722694-112722716 TCCCCACGCATTGTAAGCCCTGG + Intronic
914385615 1:147167042-147167064 TCCTAAGCCATTGTATCCCCTGG + Intronic
916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG + Intergenic
918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG + Intergenic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1081506820 11:43726325-43726347 TCCTCACCCACTCTATCCCCTGG - Intronic
1083698264 11:64457048-64457070 TCCCCACAGAGTGAATCCCCTGG - Intergenic
1085032846 11:73283200-73283222 TCCTCACATTTTGTATCCCCAGG + Intronic
1085051962 11:73384600-73384622 ACCCCATACTTTGTATCCCCAGG + Intronic
1089340275 11:117752629-117752651 TCCAGACCCATTGTTTCCCCGGG - Intronic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1101560487 12:105853121-105853143 TCCCCACCCCTGGTATCCCCAGG - Intergenic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106171277 13:27290751-27290773 TCCCAAATCATTGTCTCCCCGGG + Intergenic
1106239742 13:27901547-27901569 CCCCCACACATTTTATCCCCTGG - Intergenic
1106692831 13:32136864-32136886 TCCTCAGGCCTTGTACCCCCTGG + Exonic
1107962527 13:45571135-45571157 TCCCCAAGCATTGAATGCTCAGG - Intronic
1117514587 14:56488180-56488202 GTCCCACTCTTTGTATCCCCAGG + Intergenic
1117677169 14:58166725-58166747 TCTCCACTCAGTGTATCCCAAGG - Intronic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1123787978 15:23691230-23691252 TCACTTCTCATTGTATCCCCAGG - Intergenic
1128593097 15:68920079-68920101 TTCCCTCTCATTGCATCCCCTGG - Intronic
1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG + Intronic
1129971423 15:79780869-79780891 TCCCCAGGCACTGTGTCCCAGGG - Intergenic
1132229092 15:100168743-100168765 TCCCCACTCAATGCATCCTCTGG + Intronic
1133463771 16:6010123-6010145 GCCCCACACCTCGTATCCCCAGG + Intergenic
1138313331 16:56046975-56046997 TCTCCCACCATTGTATCCCCTGG - Intergenic
1142399727 16:89852563-89852585 TCCCCACCCCCTGGATCCCCTGG + Intronic
1156474576 18:37397538-37397560 TCCCCACCCATGGACTCCCCAGG - Intronic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
926775568 2:16419184-16419206 TCCCCATGCACTGTATTACCAGG + Intergenic
927885282 2:26714444-26714466 TCCCCAAGCACTGTGTCCCAGGG - Intronic
938392385 2:130916143-130916165 TCCCCACGCAGTCTCTCTCCCGG - Intronic
948823998 2:240565692-240565714 TCCCCACGCCTTGTGTACCTGGG + Intronic
1169661804 20:7986722-7986744 TCCCCAGGTATTTTCTCCCCAGG - Intronic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1176105159 20:63382432-63382454 TCCCCACCCATTTTACCCCCAGG + Intergenic
1178297384 21:31421653-31421675 TCCCCAAGCTTTTTATCACCAGG - Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
957827571 3:85468701-85468723 TCCCCACTTAATGTATCCCACGG - Intronic
958806539 3:98817878-98817900 TCCCCAGGCATTATAACCACTGG - Exonic
961145500 3:124589623-124589645 GCCCCAAGGATTTTATCCCCTGG - Intronic
967194135 3:187012067-187012089 TCCCCACTCACTGTTTGCCCAGG + Intronic
978522541 4:109631723-109631745 CCACCATGCATTGTCTCCCCAGG - Intronic
983109733 4:163734661-163734683 TCCCCACTGCTTTTATCCCCAGG - Intronic
995956430 5:117782479-117782501 TCCACACAGATTGTATTCCCAGG - Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG + Intergenic
1029694281 7:102202762-102202784 TCCCCAAGCTGTGTGTCCCCGGG - Intronic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1039374945 8:37023880-37023902 TCCCTAGACATAGTATCCCCAGG - Intergenic
1045523007 8:102919697-102919719 TCCTCACGCGTTGCTTCCCCAGG - Intronic
1046594795 8:116248681-116248703 TGCCCATGCATTGTAGCTCCTGG - Intergenic
1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG + Intronic
1049855955 8:144862015-144862037 TCCTCACACATATTATCCCCCGG - Intergenic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1056591541 9:87969241-87969263 TCCCCAGGCATTGGATCTGCTGG - Exonic
1057549918 9:96044904-96044926 TCTCCTCGCATTCTTTCCCCAGG - Intergenic
1057802856 9:98200496-98200518 TCCCCACACATTGTGCCTCCAGG - Intronic
1061486945 9:130924830-130924852 TCACCACGCCTCGTCTCCCCTGG + Intronic
1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG + Intergenic
1191660184 X:63641498-63641520 TCCCCACCCTATGTATCTCCAGG - Intronic