ID: 1106003546

View in Genome Browser
Species Human (GRCh38)
Location 13:25747628-25747650
Sequence TCCCCACGCATTGTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106003546_1106003551 -8 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003551 13:25747643-25747665 CGTGGGGAGGGGTTTGTTTAGGG 0: 1
1: 0
2: 2
3: 9
4: 180
1106003546_1106003550 -9 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003550 13:25747642-25747664 GCGTGGGGAGGGGTTTGTTTAGG 0: 1
1: 0
2: 0
3: 22
4: 228
1106003546_1106003552 4 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003552 13:25747655-25747677 TTTGTTTAGGGAAGAATTTCAGG 0: 1
1: 0
2: 3
3: 25
4: 422
1106003546_1106003553 12 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003553 13:25747663-25747685 GGGAAGAATTTCAGGATGTCAGG 0: 1
1: 0
2: 3
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106003546 Original CRISPR TCCCCACGCATTGTATCCCC AGG (reversed) Intronic