ID: 1106003551

View in Genome Browser
Species Human (GRCh38)
Location 13:25747643-25747665
Sequence CGTGGGGAGGGGTTTGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106003546_1106003551 -8 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003551 13:25747643-25747665 CGTGGGGAGGGGTTTGTTTAGGG 0: 1
1: 0
2: 2
3: 9
4: 180
1106003539_1106003551 21 Left 1106003539 13:25747599-25747621 CCAAAAGCTCTGCAAGGGGTTTA 0: 1
1: 1
2: 0
3: 14
4: 79
Right 1106003551 13:25747643-25747665 CGTGGGGAGGGGTTTGTTTAGGG 0: 1
1: 0
2: 2
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106003551 Original CRISPR CGTGGGGAGGGGTTTGTTTA GGG Intronic
900360946 1:2288852-2288874 CGGGGGGAGGGGGTAGTTTTTGG - Intronic
900849388 1:5130491-5130513 TGTGGGGAGGTGGTTGTTGAGGG + Intergenic
902196277 1:14800905-14800927 CGTGGGTAGGGGTTTCTTTTGGG + Intronic
902664062 1:17925203-17925225 TGTGGGGAGGTGTGTGTTTGGGG + Intergenic
905238358 1:36565937-36565959 CAAGGGGAGGGGTTTGGTTTGGG - Intergenic
906089884 1:43169981-43170003 CTTGGGGAGGGGATAGTTTTGGG - Intronic
908221410 1:62010423-62010445 GGTGGGGAGGGGGTTTTTTGGGG - Intronic
909170131 1:72283658-72283680 TGTGAGTAGGGGATTGTTTATGG + Intergenic
911976464 1:104502922-104502944 GTTGGGGAGGGGTTTATTTTAGG + Intergenic
912385384 1:109268782-109268804 GTTGGGGAGGGGTTTGTGGAGGG + Intronic
915737490 1:158094238-158094260 CGTGGGGAGGGGTTGGTGAGGGG + Intronic
919962106 1:202481851-202481873 GATGGGGAGAGGTTGGTTTATGG - Intronic
919972205 1:202588328-202588350 GGTGGGGTTGGGGTTGTTTAGGG + Exonic
921367687 1:214389158-214389180 AGTGGGGAGGGATTTGTACAAGG + Intronic
922505513 1:226123350-226123372 CCTGGGGCTGGGTGTGTTTAGGG + Intergenic
922533300 1:226361248-226361270 TGTGGGGAGGGGTTGTTTTGGGG - Exonic
922882866 1:228995416-228995438 CATGGGGTGGGGTTTCTTTTTGG + Intergenic
924513648 1:244748900-244748922 CGTGTGGAGTGGTTTGTGCAGGG - Intergenic
1062792466 10:317452-317474 CGTGGGAAGGCTTTAGTTTAGGG + Intronic
1068124620 10:52823937-52823959 AGAGGGGAGGAGTTTGTCTATGG + Intergenic
1068813741 10:61286121-61286143 CGTGGGGAGGAGATTATATAAGG + Intergenic
1070377405 10:75846712-75846734 GGTGGTGGGGGGTTTGTTTTTGG - Intronic
1073116912 10:101096469-101096491 TGTGGGGAGGGGGTTGTGGAGGG - Intronic
1074426311 10:113354549-113354571 CCTGGGGAGGGGTGTGTGAAGGG + Intergenic
1074659118 10:115631056-115631078 GGTGGGGAGGGGGGTGTGTACGG + Intronic
1083620046 11:64044770-64044792 CTTGGGGAGGGGTCTGGTGAGGG - Intronic
1084501981 11:69540381-69540403 CATGGGGAGGGGATGGTCTATGG - Intergenic
1085036753 11:73305615-73305637 GGTGGGGAGGGGGGTGTTTAAGG - Intergenic
1085475245 11:76784813-76784835 AGTGGGGAGGAGGGTGTTTACGG - Intronic
1087685087 11:101253423-101253445 AGTGGGGAGGAGTTAGTTAAAGG + Intergenic
1089432321 11:118435204-118435226 GGTAGGGAGGGGTTTGTGTCGGG - Exonic
1089492464 11:118892514-118892536 CCTGGGGAGGGGCTTGGGTAGGG + Intronic
1090068632 11:123525298-123525320 CGGGGTGAGGGTTCTGTTTAAGG + Intergenic
1090796516 11:130140280-130140302 CGTGGGGAGGTGCGTGTTGAGGG + Intronic
1092200245 12:6577535-6577557 AGTGCAGAGGGGTTTGTTTGGGG - Intronic
1095385696 12:41647225-41647247 AGAAGGGAAGGGTTTGTTTATGG - Intergenic
1096229641 12:49889804-49889826 AGTGGGGAGGGGTTTGTGCCGGG + Intronic
1096503830 12:52080869-52080891 CGTGGGGAGGGGGTGGTGAAGGG + Intergenic
1096795892 12:54077349-54077371 CGTGGGCAGGGGTGTGTGGAGGG + Intergenic
1099178075 12:79445435-79445457 GGTAGGGAGAGATTTGTTTAAGG - Intronic
1101755719 12:107619154-107619176 GGTGGGGAGGGGTTAGTCTGTGG + Intronic
1103225409 12:119283333-119283355 CATGGAGAGGGGTGTGCTTACGG - Intergenic
1103278428 12:119733653-119733675 CGTGGGAAGGGGGTTGTTGGTGG + Intronic
1104470191 12:129024006-129024028 TGTGGGGAAGGGTTTGCTGATGG - Intergenic
1105786826 13:23758221-23758243 TGTGGGGAGGGATTTGATTTAGG - Intronic
1106003551 13:25747643-25747665 CGTGGGGAGGGGTTTGTTTAGGG + Intronic
1106291235 13:28364589-28364611 TTTGGGGAGGGGTATGTGTATGG + Intronic
1115242327 14:31261875-31261897 AGTGGGGAGGGGTTTGTTCAGGG + Intergenic
1115334388 14:32230646-32230668 CGTGGGGAGTGGGATGTTTTGGG - Intergenic
1118144787 14:63123656-63123678 TGTGGGGAGGGGTTGTTTTGGGG + Intergenic
1119274391 14:73340349-73340371 CCTGGGGTGGGGTTGGTTTTTGG - Intronic
1119885340 14:78135830-78135852 GGTGGGGAGGGGAGTGTTGATGG - Intergenic
1121626134 14:95386686-95386708 CGCAGGGAGGGGCTTGTTTGGGG - Intergenic
1124151254 15:27180507-27180529 CGTGGAGCAGGGTTTGTTGAGGG - Intronic
1126778148 15:52117472-52117494 GGTGGGGAGGAGTTGGTTAATGG - Exonic
1129142218 15:73610027-73610049 AATAGGGAGGGATTTGTTTAAGG - Intronic
1129244496 15:74271334-74271356 CCTGGGGAGGGGTTGGGCTAGGG - Intronic
1129262252 15:74374896-74374918 CTTGGAGAGAGGTTTCTTTAAGG - Intergenic
1129455616 15:75674916-75674938 TCTGGGGATGGGTTTATTTAAGG - Exonic
1131229821 15:90651693-90651715 CCTGGGCATGGGTTTGGTTAAGG - Intergenic
1131972442 15:97906020-97906042 CGCAAGGAGGGGTGTGTTTAAGG + Intergenic
1132841244 16:1979353-1979375 CGAGGGGCGGGGTGTGGTTAGGG + Exonic
1133268866 16:4600627-4600649 AGAGGGGAGGGGTCTGTGTAGGG + Exonic
1134558917 16:15190614-15190636 CATGGTGAGGGGATTGTATAAGG - Intergenic
1134919450 16:18102213-18102235 CATGGTGAGGGGATTGTATAAGG - Intergenic
1135601323 16:23786125-23786147 TGTGGGGAGGGGGTGGATTATGG + Intergenic
1136785687 16:32932719-32932741 TGTGGGGAGTGTATTGTTTATGG + Intergenic
1137955448 16:52824658-52824680 GGTGGGGAGGGGTTTATATGTGG - Intergenic
1139268269 16:65659635-65659657 CCTGGGGAGGGGGTTGCTTCAGG + Intergenic
1139749740 16:69102406-69102428 GGTGGGGAGGGGTTTCTTTAAGG - Intergenic
1146261647 17:31425937-31425959 CGGGGGGAGGGGTTTGCTCAAGG - Intronic
1146558821 17:33850595-33850617 CTGGGGGAGGGGATTGTTCATGG + Intronic
1146658556 17:34649513-34649535 CGAGGGGAGGGCATTGGTTATGG + Intergenic
1147146018 17:38484865-38484887 TGTGGGGAGTGTATTGTTTATGG + Intronic
1148135150 17:45287190-45287212 CCTGGGGAGGGGTTTGGCCAAGG + Exonic
1148865927 17:50628579-50628601 CGAGGGGAGGGGGCTGTTCAAGG - Intergenic
1148887572 17:50784961-50784983 TGTGGGGAGGGGTTTGTCTCAGG + Intergenic
1149995250 17:61402711-61402733 TGTGGGGAGGGGTTGTTTTTTGG + Intronic
1150461444 17:65356902-65356924 CGTGAGTAGGGGTCTGTGTAGGG + Intergenic
1150532389 17:65997781-65997803 TGTGGGGGGGGGGATGTTTAGGG - Intronic
1154351887 18:13590192-13590214 TGTGGGTAAGGGTTTGTGTATGG + Intronic
1155471100 18:26193685-26193707 AGTGGGGTGGGGTTGGTTTTGGG + Intergenic
1157622678 18:49025364-49025386 GGTGGGGAGGTGTTTCTTAAAGG - Intergenic
1158984296 18:62798231-62798253 CGTGGTGAGGTGTTAGTTTTGGG - Intronic
1160938875 19:1610650-1610672 CCTGGGGAGGGCGTTGTGTAGGG + Exonic
1162311145 19:9908050-9908072 CGTGGGGAGGGGGATCTTTCAGG - Intronic
1163642173 19:18468054-18468076 GGTGTGGAGGGGTTTGTGTGTGG - Intronic
1164716483 19:30394416-30394438 AGTGGGGAGAGGGCTGTTTAGGG - Intronic
1165937018 19:39395536-39395558 CGTGTGCAGGGCTTTGTATATGG + Intronic
1166678011 19:44751058-44751080 CGTGGAAGGGGGTTTGTTTTAGG + Intronic
1166810110 19:45509296-45509318 CCTGGAGAGGGGTCAGTTTAGGG + Intronic
925209167 2:2032471-2032493 ACTGGGGAGGGGTGTGTGTAAGG - Intronic
926706998 2:15843995-15844017 CATGGTGAGGGGCTGGTTTATGG + Intergenic
928015779 2:27655725-27655747 CAATGGGAGGGATTTGTTTAAGG + Intronic
928137262 2:28696936-28696958 CGTGGGATGGGGATTGTTGAAGG + Intergenic
928434059 2:31242314-31242336 TGTGGGGAGGGGTGTGTGTGTGG + Intronic
928586155 2:32760585-32760607 GGCGGGGAGGGGTTGGTTTTTGG + Intronic
929852156 2:45601992-45602014 CCTTGGGAGGGGGCTGTTTACGG + Exonic
932235695 2:70119444-70119466 CGTGGGGAGGATTTTGAGTAGGG + Intergenic
933240049 2:79910241-79910263 CGTGTGGATAGGGTTGTTTAAGG + Intronic
934764739 2:96874351-96874373 CTTGGGGATGGGTATGTTTGGGG + Intergenic
934769067 2:96896397-96896419 CCTGGAGAGGGGTTTGTGTGTGG - Intronic
935954915 2:108366388-108366410 CTTGAGGAGGGGTTGGTGTAGGG + Intergenic
936243046 2:110804854-110804876 AGTGGGGTGGGGTTTCTTTTTGG + Intronic
936558429 2:113515775-113515797 TGTGGGGAGAGGATTGGTTAAGG + Intergenic
937364294 2:121249519-121249541 CGGGGAGAGGGGCTTGATTAGGG - Intronic
938235281 2:129701065-129701087 TGTGGGGAGGGGTTGGTCAATGG - Intergenic
939316607 2:140558616-140558638 AGTGGGGAAGGGTTTCTTTTTGG + Intronic
942588196 2:177509973-177509995 TGTGGGGAGGGGTTGTTTCAGGG - Intronic
943333975 2:186590967-186590989 AGTGGGGGAGGGCTTGTTTAGGG - Intronic
944537189 2:200722831-200722853 CGTGGGGCTGGGTTTGAATATGG - Intergenic
945230842 2:207587812-207587834 CATGGGGAGAGGTTGGTTAATGG + Intronic
947904793 2:233753095-233753117 GCTGGGGATGGGTTTGCTTATGG - Intronic
948850832 2:240704528-240704550 GCTGGGGAGGGGCTTGTTTGGGG - Intergenic
1169321166 20:4634444-4634466 GCTGGGGAGGAGTTGGTTTATGG - Intergenic
1171472451 20:25382961-25382983 CATGGGGCTGGCTTTGTTTATGG - Intronic
1172114997 20:32568520-32568542 CATGGGGAGGGAGGTGTTTAGGG - Intronic
1174151870 20:48491747-48491769 CGTGGGGAGGGGTCTGTGACTGG - Intergenic
1174394776 20:50240215-50240237 CGTGGAGATGGGAATGTTTAAGG + Intergenic
1174886377 20:54339671-54339693 CATGGGGAAGGATTTGTTTTAGG - Intergenic
1175144029 20:56882336-56882358 CTTTGGGAGGGGCTAGTTTACGG + Intergenic
1179215108 21:39360771-39360793 CGAGGGGATGAGTATGTTTATGG + Intergenic
1179728662 21:43354963-43354985 GGTGGGGAGGGGTTGGTCTCGGG - Intergenic
1182697272 22:32205829-32205851 AGTGGGGAGGGGGTTGTTGAGGG + Intergenic
951466316 3:23003988-23004010 CTTGGGAAGTGATTTGTTTAGGG + Intergenic
954493364 3:50929364-50929386 AGTGGGGAGGGGGCTGCTTAAGG + Intronic
954808087 3:53231814-53231836 CGTGGGCAGGTGTGTGTTTCTGG + Intronic
954906673 3:54069133-54069155 CTTGGGGAGAGATTTGTTAAAGG - Intergenic
956514628 3:70033370-70033392 TGTGAGGAGGGATTTGTTCATGG + Intergenic
959443999 3:106414426-106414448 ATTGGGGAGGTGATTGTTTAAGG - Intergenic
960444352 3:117729584-117729606 GGTGGGGTGGGGGTTGTTGAGGG - Intergenic
962345818 3:134618421-134618443 CCTGGGGAGGGGTTCTTTGATGG + Intronic
965452979 3:168861258-168861280 CGTGTGGTAGGGTTTATTTAAGG + Intergenic
965661611 3:171047848-171047870 CTTGGAGAGCGATTTGTTTAGGG + Intergenic
967320431 3:188189846-188189868 GGTGGGGAAGGGTTTATTTTTGG + Intronic
968434441 4:577032-577054 TGGGGGGAGGGGGTTGTTCAAGG + Intergenic
971345289 4:25806436-25806458 GCTGGGGATGGGTTTATTTAAGG + Intronic
971409143 4:26351950-26351972 CGGGGGGAGGTGTGTGGTTATGG + Intronic
971956230 4:33422723-33422745 TGTGGGGAGGGGCTCGGTTAAGG + Intergenic
972517644 4:39823237-39823259 GATGGGGAGGGACTTGTTTACGG - Exonic
975858678 4:78652460-78652482 CATGTGAAGGGCTTTGTTTAAGG + Intergenic
979051690 4:115943202-115943224 CGTGAGGTGGGGTTTATTGATGG - Intergenic
980166332 4:129232482-129232504 GGTGGGGAGGGGGTTGCTGATGG + Intergenic
981937083 4:150249860-150249882 TGTGTGGAGGGGCTTGTGTAGGG + Intronic
982788227 4:159560353-159560375 GGTAGGAAGGGGTTTGTTTTGGG + Intergenic
990378573 5:55198314-55198336 TGTGGGGAGGAGTATTTTTATGG + Intergenic
990798623 5:59573467-59573489 ACTGGGGAGGGATCTGTTTATGG + Intronic
992685379 5:79194466-79194488 AGTGGGCAGGGGTTGGTTTCAGG - Intronic
995548070 5:113252652-113252674 AGTGGGTAGGGGATTGTTTCAGG - Intronic
997200573 5:132007726-132007748 TGTGTGGAGGGGTGTTTTTATGG - Intronic
997879307 5:137575040-137575062 GGTGGGGAGGGGTTGACTTAGGG - Intronic
998819705 5:146047580-146047602 GGTGGGGAGGAGCTGGTTTATGG - Intronic
999828750 5:155299197-155299219 AGTCATGAGGGGTTTGTTTATGG - Intergenic
1002717676 5:181238427-181238449 AGTTGGGAGGGGTTTTTTGATGG - Intronic
1009530193 6:64803376-64803398 TGTGTGGGGGGGTTGGTTTATGG + Intronic
1010108692 6:72198489-72198511 CATGGGGAAGGGTGTGTTGAGGG + Intronic
1016608359 6:145960879-145960901 AGTGGAGAGGGGGTTGTTTAGGG + Intronic
1018067212 6:160132440-160132462 CGTGGGTAGGGGGTTGTTTGTGG + Intronic
1018893857 6:168000274-168000296 AGTGGGGAGGGGCAGGTTTATGG - Intronic
1018893960 6:168000610-168000632 AGTGGGGAGGGGCAGGTTTATGG - Intronic
1019095060 6:169573007-169573029 CGTGGGGACGGCTCTGTTTTGGG - Intronic
1020083103 7:5296838-5296860 GGTGGGGAGGGGTCTGTGTGTGG + Intronic
1023183416 7:37509429-37509451 CGCGTGGAAGGTTTTGTTTAAGG - Intergenic
1023785226 7:43700790-43700812 AGTAGGGAGGTGTTTGTTTTGGG - Intronic
1024127220 7:46311742-46311764 CCTGGGGAGGGGGTGGTTTGGGG + Intergenic
1028869916 7:95758397-95758419 CCTGGGGAGGGATTTCTTCATGG + Intergenic
1034734910 7:153419780-153419802 CTGGGGCAGGGGTTTCTTTAAGG + Intergenic
1035716000 8:1755426-1755448 GGTGGGGAGGGGTCTGTGTGGGG - Intergenic
1037369176 8:18155327-18155349 GCTGGGGAGAGGTTTGTTAAGGG + Intergenic
1037751138 8:21683188-21683210 CCTGGGGAGGGCTCTGTTTAGGG - Intergenic
1042318635 8:67451579-67451601 AGTGGGGAGGGGATGGTTTCAGG - Intronic
1042655906 8:71096178-71096200 GGTGGGCAGGGGTCTGCTTATGG + Intergenic
1049315351 8:141964125-141964147 AGTGGGAAGGGGGATGTTTAGGG - Intergenic
1049894436 9:100492-100514 TGTGGGGAGAGGATTGGTTAAGG - Intergenic
1051967125 9:22842952-22842974 GGTGGGCAGGGGGTTGTTTTGGG + Intergenic
1053349583 9:37404256-37404278 GGCAGGAAGGGGTTTGTTTAGGG + Intergenic
1053475523 9:38379448-38379470 GGGGGGGAGGGGTTGGTTTTTGG + Intergenic
1056136159 9:83631246-83631268 CGTGGGGAGAGTTTTGTGTTCGG + Intronic
1056678163 9:88694575-88694597 GGTGGGGGGGTGTTTGTTTTTGG - Intergenic
1057860531 9:98637291-98637313 CTTGGGGAGGGGGATGTTAAAGG - Intronic
1058628328 9:106959155-106959177 AGTGGGGAGGGGATTGATTGTGG - Intronic
1059343689 9:113613928-113613950 CTGGGGGAGGGGGTTGTGTAGGG - Intergenic
1059494717 9:114700029-114700051 CGTGGTGAGGAGTTTGGCTATGG + Intergenic
1061600348 9:131665641-131665663 GGTGGGGAGGGGGTTGGTTGGGG - Intronic
1062514680 9:136926695-136926717 CGTGGGGAGGGGTCTGTGAGAGG - Intronic
1186045300 X:5530287-5530309 CGTGGGGATAGGTTTGTTTGTGG + Intergenic
1192503892 X:71669483-71669505 CATGGGGAGGGGTTGTGTTAAGG - Intergenic
1192510101 X:71716405-71716427 CGTGGGGAGGGGTTGTGGTAAGG + Intronic
1192516596 X:71765148-71765170 CGTGGGGAGGGGTTGTGGTAAGG - Intronic
1192683577 X:73280369-73280391 GGTGGGGAGGGGGTGGTTTCAGG + Intergenic
1202297250 Y:23372769-23372791 GATGGGGAGAGGTTGGTTTATGG - Intergenic
1202573557 Y:26297828-26297850 GATGGGGAGAGGTTGGTTTATGG + Intergenic