ID: 1106003552

View in Genome Browser
Species Human (GRCh38)
Location 13:25747655-25747677
Sequence TTTGTTTAGGGAAGAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106003546_1106003552 4 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003552 13:25747655-25747677 TTTGTTTAGGGAAGAATTTCAGG 0: 1
1: 0
2: 3
3: 25
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106003552 Original CRISPR TTTGTTTAGGGAAGAATTTC AGG Intronic
900903906 1:5537104-5537126 TTTCTTTAGGAAATAAATTCAGG + Intergenic
900904076 1:5538430-5538452 TTTGCCTAGGAAAGAATTTGAGG + Intergenic
901779211 1:11581913-11581935 TTTGTTCAGGAAAGAATTCAAGG - Intergenic
901782335 1:11602304-11602326 AATGTTTAGGGAAGACTTCCTGG + Intergenic
904072019 1:27807679-27807701 TTTCTCTAGGGTAGAATTGCTGG - Intronic
906574738 1:46878037-46878059 TTTGCTTAGAGAATAAGTTCAGG - Intergenic
906597232 1:47089866-47089888 TTTGCTTAGAGAATAAGTTCAGG + Intronic
907562964 1:55407957-55407979 TTTTCTTAGGGTACAATTTCTGG - Intergenic
907690032 1:56654702-56654724 GTTATTAAGGAAAGAATTTCAGG + Intronic
907839687 1:58144686-58144708 ATTTTATAGGAAAGAATTTCAGG + Intronic
908231377 1:62108380-62108402 TTTGCTTAAGGAAGCATTTGTGG + Intronic
908626094 1:66044570-66044592 TTTAATTAGAGAAAAATTTCTGG + Intronic
909297892 1:73974276-73974298 TTTTTATAGGGCAGAATTCCAGG - Intergenic
909687214 1:78363528-78363550 ATTGTTTAGAGAATAATTACAGG + Intronic
909988910 1:82197396-82197418 AATTTTTAGGGAAGAATATCAGG - Intergenic
910388241 1:86707521-86707543 TTTATTAAGGGAAAAATTTTAGG + Intronic
910599297 1:89013359-89013381 TTTTCTTTGGGAAGAACTTCCGG + Exonic
910603607 1:89058166-89058188 TTTTCTTTGGGAAGAATTTCCGG + Exonic
910623639 1:89283737-89283759 TGTGTTCAGAGAAGAATTTATGG - Intergenic
910682800 1:89884500-89884522 TTTATTTAGGTAAGGATTTATGG + Intronic
910696389 1:90022337-90022359 TTTGTTAAGGTAAGATTTTAGGG + Exonic
911310624 1:96288583-96288605 TTTGTTTCTGGAAGATTTTTAGG + Intergenic
912085093 1:105991266-105991288 ATTGTTTAGCTCAGAATTTCTGG - Intergenic
912224870 1:107721892-107721914 TTTCTTAAGGGAAGTATTTGGGG - Intronic
912627102 1:111214507-111214529 TTTGCATAGGTACGAATTTCTGG + Intronic
915875695 1:159609974-159609996 ATTATTTAGGGAAGACTTTTTGG - Intergenic
915918842 1:159959239-159959261 TTTGTTAAGGGAAGTTTTGCTGG + Intergenic
916781236 1:168032362-168032384 TTTGTATAAGGAAGCATATCTGG - Intronic
916783734 1:168066511-168066533 TTTTCTTAGGGAAGCATTTTAGG - Intronic
916857034 1:168760840-168760862 TTTCCTTAGGGAAGAGGTTCTGG + Intergenic
917708807 1:177662964-177662986 TATATTTAATGAAGAATTTCAGG + Intergenic
918151862 1:181803831-181803853 TTTGTTTAGAGAGGCTTTTCAGG - Intronic
919305552 1:195830589-195830611 TTTCTTTGGGGAATAATTTTAGG - Intergenic
919595663 1:199558482-199558504 TTTGTCTAGAGTAGATTTTCAGG - Intergenic
920497051 1:206462509-206462531 TTTCATTTGGGAACAATTTCTGG - Exonic
921422078 1:214959799-214959821 TTTGTTAAGGGAAGCAAGTCTGG - Intergenic
921992482 1:221382486-221382508 CATATTTAGGGAAGAATTTGTGG + Intergenic
923823071 1:237468470-237468492 TTTCTTTACTGCAGAATTTCAGG + Intronic
924376788 1:243419002-243419024 TTTCATTCGGGAAGGATTTCTGG + Intronic
924587542 1:245373257-245373279 CTAGTTTAGGAAAGAATTCCAGG + Intronic
1062776766 10:156733-156755 TTTGTGGAGTGGAGAATTTCAGG + Intronic
1063819792 10:9820558-9820580 TTTGTTTCTAGAAGATTTTCAGG - Intergenic
1063853499 10:10220688-10220710 TTTTTTTAAGGAAGAGTTTCAGG - Intergenic
1064620395 10:17210556-17210578 TCTGGTTAGGAAAGAATGTCAGG + Intergenic
1064669802 10:17700619-17700641 TTTCTTTAGGGTAGATATTCAGG + Intronic
1064777349 10:18793446-18793468 TTGGTTTAGGGATGATTTCCTGG + Intergenic
1065059512 10:21884535-21884557 TTTGTTTCTGGGAGAATTGCTGG - Intronic
1065757754 10:28949654-28949676 TTTACTTAGGGAAGAATTCTGGG + Intergenic
1066120729 10:32283884-32283906 TTAGTTTACGGAACATTTTCTGG + Intronic
1066178293 10:32934282-32934304 ATTGTTTAGGGAATAATGACAGG - Intronic
1067146393 10:43697204-43697226 TTTCTTTAGGACAGAAGTTCAGG + Intergenic
1067223393 10:44360125-44360147 ATGGTTTAGGGTAGAATTTTAGG + Intergenic
1067549374 10:47223069-47223091 TTTTTTTATGGTTGAATTTCTGG - Intergenic
1068462880 10:57350611-57350633 TTTGTTTTTGGAAGATTTTAGGG + Intergenic
1068704800 10:60063161-60063183 TTTGATTATGGAAATATTTCAGG - Exonic
1068933871 10:62617563-62617585 TCTGTTTGGGGAAGAATCACAGG + Intronic
1069276990 10:66604701-66604723 TTTGTTTCTGGAAGACTTTAGGG - Intronic
1069287431 10:66732765-66732787 TTTGTTTAGGGGATAATGTTTGG - Intronic
1069532879 10:69231932-69231954 TCTGTGAAGGTAAGAATTTCCGG + Intronic
1069579439 10:69555432-69555454 TTTAAGGAGGGAAGAATTTCAGG - Intergenic
1069805864 10:71124712-71124734 TTTGTTTCTGGAAGATTTTAGGG + Intergenic
1070908982 10:80100891-80100913 TTTGTTTAGGGTTGATTTTGAGG - Intergenic
1071453901 10:85826878-85826900 TTTATTTCGGGAAGATTTTAGGG - Intronic
1071839584 10:89455436-89455458 CATGTTTAGACAAGAATTTCAGG - Intronic
1073070446 10:100790126-100790148 GTTGTTTGGGGAAGTATTTTGGG + Intronic
1077789209 11:5419489-5419511 ATTGTTTAGGGAATAATGACAGG - Intronic
1078397358 11:10992985-10993007 TTTGTTTGGGACAGAAATTCTGG + Intergenic
1078522138 11:12071852-12071874 TCTGTTTATTGAAGAGTTTCTGG + Intergenic
1078598951 11:12714106-12714128 TTTGGGTAGGCAAGAATATCTGG + Intronic
1079711164 11:23683532-23683554 TTGATTAAGGGAAGATTTTCAGG - Intergenic
1079791110 11:24740461-24740483 CTGGTTTAGTGAAGAATTTTGGG - Intronic
1080072942 11:28111076-28111098 TTTTTTTAGGGAGGTATTGCAGG + Intronic
1081024228 11:37989067-37989089 TTTCTTTATAGAAGAATTTGGGG + Intergenic
1082953278 11:58840957-58840979 TTTGTTTCAGAAAGACTTTCAGG - Intronic
1083034338 11:59622826-59622848 ATTGTTTAGGGAATAATGACAGG + Intergenic
1083178554 11:60969721-60969743 TTTGTTTAAGGCAGAAATTTTGG + Intergenic
1084403178 11:68956461-68956483 TCTGCTTAAAGAAGAATTTCGGG + Intergenic
1085074808 11:73581635-73581657 TTTTTTTAGGGAAGAGTTCTTGG - Intronic
1085678748 11:78550723-78550745 TTTCTCTTGGGTAGAATTTCTGG - Intronic
1088741754 11:112773359-112773381 TGTGGTTGGGGAAGACTTTCTGG + Intergenic
1089962057 11:122625047-122625069 TTTTTTAAAGGAAGGATTTCTGG - Intergenic
1090989162 11:131800787-131800809 TTTGATTAGGGTAGAGTTTTTGG - Intronic
1091654765 12:2337522-2337544 GTTATTTAGGGAAGAGATTCAGG - Intronic
1092242650 12:6844862-6844884 TTTGTTTCGGGAAGTACTTAAGG - Intronic
1092333717 12:7609048-7609070 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1092680498 12:10974537-10974559 TTTGTTTATGGTAGATTTTGGGG - Intronic
1092845894 12:12584895-12584917 TATGAATAGGGAAGAACTTCAGG + Intergenic
1093222322 12:16437450-16437472 TTTATTCTGGGAAGAATTCCTGG - Intronic
1094006728 12:25761338-25761360 TTTGTTTTGGGCAGGACTTCTGG + Intergenic
1094040672 12:26118246-26118268 TTTGTTTAATGAAAAATATCAGG + Intergenic
1094469649 12:30791948-30791970 TTTGTTTAGGGAAGAAATAGTGG + Intergenic
1094475943 12:30840564-30840586 TTTGCCTAGGAAAGAATTTAAGG + Intergenic
1097802194 12:63927034-63927056 TATGTTGAGAGAAGAATTTGAGG - Intronic
1098899997 12:76102688-76102710 TTAGTGGAGGGGAGAATTTCAGG - Intergenic
1099307426 12:80974915-80974937 TCTGTTTTGGGAGGAATTTGGGG - Intronic
1100012723 12:89972831-89972853 GGTGGGTAGGGAAGAATTTCTGG + Intergenic
1100266282 12:92979166-92979188 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1100893415 12:99151793-99151815 TTTATTTAGGAAATATTTTCAGG - Intronic
1100926771 12:99557899-99557921 TTTGTTTCTGGAAGACTTTAGGG + Intronic
1101058346 12:100943749-100943771 TTTGTATAGGAAAGATTTTCTGG - Intronic
1101266104 12:103089271-103089293 TTTGTTTAGGCCAGAAGCTCAGG - Intergenic
1103113809 12:118307729-118307751 TTTTTTAAGGAAAGAACTTCCGG - Intronic
1103269990 12:119665243-119665265 TTTGTTTGGGGGAGAATCTAGGG + Intergenic
1106003552 13:25747655-25747677 TTTGTTTAGGGAAGAATTTCAGG + Intronic
1106489857 13:30210776-30210798 TTTTTTTTGAGAAGCATTTCCGG - Intronic
1106888931 13:34221658-34221680 TTTGCTTAGAGAAGATATTCAGG + Intergenic
1107331579 13:39307009-39307031 AGTGTTTAGGGAAGTCTTTCTGG - Intergenic
1107397098 13:40029399-40029421 TGTATCTAGGGAAGAATTTCAGG + Intergenic
1109621401 13:64911665-64911687 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1109818906 13:67625364-67625386 TTTATTCAGGGCAGAATTTAAGG + Intergenic
1110071988 13:71189565-71189587 TTAGTTTAAGGAATTATTTCTGG + Intergenic
1111122929 13:83878601-83878623 TTTGTTGAGGGAAGTTTTTAGGG - Exonic
1111769024 13:92572853-92572875 TTTGTTTTGGGAAGAGCTACAGG - Intronic
1112477197 13:99742300-99742322 CTTATTTATGAAAGAATTTCAGG - Intronic
1114458111 14:22870216-22870238 ATTGTTTAGGGAATAATGACAGG + Intergenic
1114946417 14:27687107-27687129 TTCATTTAGGGATTAATTTCAGG + Intergenic
1115300280 14:31877679-31877701 TTTGCTTGCTGAAGAATTTCTGG + Intergenic
1115745571 14:36433664-36433686 TCTCTTTAGGGAAGGATTTTTGG + Intergenic
1115787776 14:36845679-36845701 TTTGTTGAAAGAAGAATTTGAGG - Intronic
1116337661 14:43678323-43678345 ATTGTTTAGGGAATAATGACAGG - Intergenic
1116464934 14:45220833-45220855 TTTGTTCAGTTAAGAATATCTGG + Intronic
1116710169 14:48357986-48358008 TTTGTTTAACCAAAAATTTCTGG + Intergenic
1117001935 14:51379401-51379423 TTTTCTTAAGGAAGTATTTCAGG - Intergenic
1117417061 14:55507004-55507026 GTTATTTGGGGAAAAATTTCAGG + Intergenic
1118350270 14:64968752-64968774 TTTGTTTAAGGTAGTATTTTGGG + Intronic
1119517161 14:75257379-75257401 AGTGTTTAGGGAAGGATGTCGGG + Intronic
1120493763 14:85207955-85207977 TTTGTTTTGGGAGGTATTTTTGG + Intergenic
1121140549 14:91538034-91538056 ATTGTTTAGGGAATAATGACAGG + Intergenic
1121673134 14:95728973-95728995 TGTTATTAGGGAAGAATTTAAGG - Intergenic
1121800872 14:96773188-96773210 TTTGTTCAGGGAAGAAAGGCAGG - Intergenic
1121804547 14:96805268-96805290 TGGTCTTAGGGAAGAATTTCCGG + Intronic
1122009795 14:98736733-98736755 GTTGTTTAGGGGAGAATTGAAGG - Intergenic
1123849941 15:24344148-24344170 TTTGTCCAGGAAAGAATTTAAGG + Intergenic
1123854881 15:24398703-24398725 TTTGTCCAGGAAAGAATTTAAGG + Intergenic
1123870912 15:24571687-24571709 TTTGTCCAGGAAAGAATTTAAGG + Intergenic
1124094831 15:26639394-26639416 ATTGTTTAGGGAATAATTACAGG - Intronic
1124970195 15:34481560-34481582 TTTCGTTATGGAAGAATTTTGGG + Intergenic
1125845233 15:42846105-42846127 ATTGTTTAGGAAATAATTACAGG + Intronic
1126240890 15:46442008-46442030 TTTGTATAGGGAATAATTCAGGG + Intergenic
1126716193 15:51520254-51520276 GATGGTTAGGAAAGAATTTCTGG - Intronic
1127528580 15:59818808-59818830 TTTGTGTAGGATATAATTTCTGG + Intergenic
1127852616 15:62926983-62927005 TTTTTTTAAGGTAGCATTTCAGG + Intergenic
1128282233 15:66405619-66405641 TTTTTTAAGGGAAGAATGTGGGG - Intronic
1128637973 15:69315300-69315322 TTTGTTCAGGGAGGAAGATCGGG + Intronic
1131655468 15:94453013-94453035 TTTCTTTACTGAAGAATTTTAGG + Intronic
1132189158 15:99834440-99834462 TTTCGTTATGGAAGAATTTTGGG - Intergenic
1133150508 16:3825198-3825220 TTTGTTCTAGGAAGAGTTTCAGG + Intronic
1133394905 16:5439053-5439075 TTTGTTTTGGGAGGCTTTTCTGG + Intergenic
1133533559 16:6677638-6677660 TTTGATTAGGGAACAAGTTTGGG + Intronic
1133661067 16:7918344-7918366 TTTGTGTAAGGATGATTTTCTGG + Intergenic
1138270845 16:55694875-55694897 TTTGTTTATGGACCAATTTATGG + Intronic
1138459894 16:57141944-57141966 TTAGTTTGGGGAAGAATATTTGG + Intronic
1138917072 16:61478137-61478159 ATTGTTTAGGGAATAATGACAGG + Intergenic
1140377790 16:74458921-74458943 TTTATTTATGGAAACATTTCTGG - Intronic
1142541074 17:659918-659940 TTTGTTTAGGGAAAAATCAGTGG - Intronic
1143399770 17:6636757-6636779 TGTGTGTAGGGAAGAAGTTGGGG - Intronic
1144305834 17:13968761-13968783 TTAGATAAGGAAAGAATTTCAGG - Intergenic
1146737860 17:35254451-35254473 TTTTTTGAGGGAAGAAATGCAGG + Intronic
1147045492 17:37748734-37748756 TTTGTTTACAGAAGAGATTCTGG + Intergenic
1147504868 17:41005889-41005911 TTTGCCTAGGGAAGAATTCAAGG + Intergenic
1147545309 17:41396721-41396743 TTTGTTTTGGGATGAATATTGGG - Intronic
1148162363 17:45457995-45458017 TTCATTCAGGGAAGCATTTCAGG - Intronic
1148334957 17:46834843-46834865 CTTGTTCAGGGAAGAGTCTCTGG + Intronic
1148977532 17:51542767-51542789 TTTATAGTGGGAAGAATTTCAGG + Intergenic
1149987526 17:61358908-61358930 CTTGTTTATCGAAGAATTTAGGG + Intronic
1150393598 17:64804656-64804678 TTCATTCAGGGAAGCATTTCAGG - Intergenic
1151080804 17:71326284-71326306 TATGTTTAGGAGCGAATTTCTGG + Intergenic
1151224064 17:72635458-72635480 TTTGTTTAGTGTAGAATTCTTGG - Intergenic
1152393124 17:80014683-80014705 TTTCCTAAGGGAGGAATTTCAGG - Intronic
1154967035 18:21369456-21369478 TTATTTTACAGAAGAATTTCTGG + Intronic
1155317061 18:24582477-24582499 TTTGTTCAGGGGAGAGTTTTGGG + Intergenic
1155584809 18:27352766-27352788 TTTCCTTAGGAAAGTATTTCTGG - Intergenic
1155680901 18:28484138-28484160 TTTGTCCAGGAAAGAATTTAAGG - Intergenic
1156343373 18:36233288-36233310 TATTTTTAGGGAAGTAATTCAGG - Intronic
1156734235 18:40233512-40233534 TTTGTTTCTGGAAGAAATTAGGG - Intergenic
1156790426 18:40966220-40966242 TTTGTTTATAAAAGGATTTCTGG + Intergenic
1158407769 18:57175378-57175400 TTTGTTTTGGGTAGAAAATCAGG + Intergenic
1158675278 18:59512769-59512791 TGTGTTTAGGGAACAAATCCCGG + Intronic
1159079187 18:63716474-63716496 TTTGGTTAAGGAAAAATTTAAGG + Intronic
1160145208 18:76358051-76358073 TTTATTTATGGAAGAGTTTTAGG - Intergenic
1160551947 18:79699083-79699105 TTTGTTTAGGGCCGGAATTCAGG + Intronic
1164661304 19:29972487-29972509 TTGGTTTTGGTAAGAAGTTCAGG + Intronic
1165023414 19:32942026-32942048 TTTATTTTGTGAAGAATTTAAGG - Intronic
1165359400 19:35326680-35326702 TTTGGTAAGGGTAGAAGTTCAGG + Intronic
1165441341 19:35829974-35829996 CATTTTTAGGGAAGAAATTCTGG + Intronic
925270546 2:2603853-2603875 ATTGTTTAGGGAATAATAACAGG + Intergenic
925318690 2:2944508-2944530 TTTGTTTAGGGTGGATTTACTGG - Intergenic
925486433 2:4337793-4337815 TATCTTTAGGGCAGAACTTCAGG + Intergenic
925860288 2:8168837-8168859 TTTGGTTAGCTCAGAATTTCAGG + Intergenic
925890272 2:8427903-8427925 ATTGTTTAGGGAATAATGACGGG - Intergenic
926517234 2:13863267-13863289 ATTGTTTAGGGAATAATAACAGG + Intergenic
926900486 2:17746577-17746599 TTTTTTTAGGGAAGAGTTAAAGG - Intronic
927099300 2:19775623-19775645 TGTCTTCAGGGAAGAATTTGAGG + Intergenic
928926271 2:36582781-36582803 TTTATTTCAGGAAGAAGTTCTGG + Intronic
929851606 2:45596367-45596389 TTTGGTTAGGAATGAATATCTGG - Intronic
929939481 2:46322049-46322071 TATTCTCAGGGAAGAATTTCAGG - Intronic
930984218 2:57565311-57565333 TTTGTTTTGGAAATAATCTCTGG + Intergenic
931295288 2:60918112-60918134 TTTTTGCAGGGAAGAATTTGAGG - Intronic
932136633 2:69236620-69236642 ATTGTTTGAGGTAGAATTTCTGG - Intronic
932539797 2:72639765-72639787 TTTGTTTCTGGAAGATTTTAGGG - Intronic
932743010 2:74306354-74306376 TCTGTTTGGGGAAGAAGTTTTGG - Intronic
932879042 2:75483055-75483077 TTTGTTTAATGAACAGTTTCTGG + Intronic
933904392 2:86875821-86875843 TTTGTTTATGAAATAATATCAGG + Intergenic
934069532 2:88371232-88371254 ATTGTTTAGGGAATAATGACAGG + Intergenic
934719951 2:96566994-96567016 TTTGTCTAGGAAAGAATTCAAGG - Intergenic
934868370 2:97835585-97835607 TTTGTGCAGAGAAGAAATTCAGG - Intronic
935449364 2:103190892-103190914 TTTGTTTCTGGAAGATTTTGGGG - Intergenic
935555028 2:104500328-104500350 TTTTCTTAGGGAACAATGTCAGG - Intergenic
935836011 2:107054356-107054378 TTTATTTAAAGAAAAATTTCTGG - Intergenic
936367849 2:111876331-111876353 TTTGTTTATGAAATAATATCAGG - Intronic
936795854 2:116203786-116203808 TTTGTTTCTGGAAGATTTTAGGG + Intergenic
937445927 2:121957785-121957807 TATGTTCAGGGAAGACTTCCTGG + Intergenic
939946354 2:148416201-148416223 TTTGTTTCTGGAAGATTTTAGGG + Intronic
940522872 2:154773499-154773521 TTTGTTCTCGGAATAATTTCTGG + Intronic
940834874 2:158510046-158510068 TTTCTTAAAGGAAGAATTTTGGG - Intronic
941155871 2:161977322-161977344 GAAGTTTAGGGAAGACTTTCAGG - Intronic
943845745 2:192644987-192645009 TTTGTTTAAAGGAGTATTTCTGG + Intergenic
943944659 2:194044291-194044313 TTTTTTTTGAGAAGAAATTCAGG + Intergenic
944510314 2:200458182-200458204 TCTCTTTATGGAAGAATTCCAGG + Intronic
946787417 2:223262448-223262470 TTTGCTTAGGCAAGATTTTTTGG - Intergenic
947208609 2:227685113-227685135 TTAGTCCAGTGAAGAATTTCGGG + Intergenic
947321845 2:228927783-228927805 TTGGTTTAGATAAGAATTTGGGG + Intronic
947662933 2:231883454-231883476 TTTCATTAGGGAAGACATTCAGG + Intergenic
948136433 2:235639652-235639674 GTTGTTTGGGGAAGAATCGCAGG + Intronic
948688450 2:239686734-239686756 ATTGTTTAGGGAATAATGACAGG + Intergenic
1170089419 20:12574103-12574125 TTTATTAAGGGAAGACTCTCAGG + Intergenic
1170127741 20:12984912-12984934 TTTTGTAAGAGAAGAATTTCTGG + Intergenic
1170882041 20:20305251-20305273 TTTCCTGAGGGAAGAACTTCTGG - Intronic
1172259403 20:33549190-33549212 TTTGGTTAGGGCAGAATTTCTGG + Intronic
1172691910 20:36796063-36796085 TTTATTTGGGACAGAATTTCAGG - Intronic
1173308528 20:41874617-41874639 TTTGTTTAGGAAATGATTTCTGG - Intergenic
1174283260 20:49454500-49454522 TTTGTTTACTGAAGTATCTCAGG - Intronic
1175651529 20:60728808-60728830 TTTATTTAAGGAAGAAGATCAGG - Intergenic
1177458207 21:21371588-21371610 GGTGTTGAGGGAAGAATTCCAGG - Intronic
1178172099 21:30052736-30052758 ATAGTTTAGGGAAGTATTTCTGG - Intergenic
1178681070 21:34672226-34672248 GTTGTTTATTGCAGAATTTCAGG + Intronic
1178717100 21:34975378-34975400 ATTGTTTAGGGAAGAATGACAGG - Intronic
1178730698 21:35100194-35100216 TTGGTTTAGGTAAGAGTTTATGG + Intronic
1178989609 21:37342071-37342093 TTTGAGTAGTGAAGAATTTTAGG + Intergenic
1179216503 21:39371751-39371773 TTTATTTAGAGATAAATTTCTGG + Intergenic
1182091951 22:27602057-27602079 GTTGTTCAGGGAAGACTGTCAGG - Intergenic
1184757472 22:46525102-46525124 CTTGTTTTGGGAGGAAATTCAGG - Intronic
949451601 3:4191350-4191372 TGTGTTTAAGGAAGAAATTTAGG + Intronic
949595076 3:5534604-5534626 TTTTTTTAGGGGAGAATTTGTGG + Intergenic
949670600 3:6395539-6395561 TTTGTATAGTAAAGAAGTTCTGG + Intergenic
951822551 3:26828166-26828188 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
953056821 3:39394317-39394339 TTGGTTTGGGGAAGAATTGGTGG + Intronic
953148106 3:40297818-40297840 TTCACTTAGGGAGGAATTTCTGG + Intergenic
953220481 3:40966544-40966566 TTTGATCAGGGAAGAAATTAAGG - Intergenic
955457735 3:59142658-59142680 TCTGTTCAGAGAAGCATTTCAGG + Intergenic
956194770 3:66642116-66642138 TCAGCTTAGGGAAGGATTTCAGG + Intergenic
956601881 3:71031334-71031356 TTTGTTTAGGGAAGTCTTACAGG + Intronic
956742731 3:72287760-72287782 ATTGTTTAGGGAATAATGACAGG - Intergenic
957117526 3:76045734-76045756 TTTATTTTGGAAAGTATTTCAGG + Intronic
957391421 3:79577384-79577406 TGTGTTTAGCGAAGAGTTTTTGG + Intronic
957781887 3:84829251-84829273 ATTGCTTAGGGAAAAATTACAGG + Intergenic
957982593 3:87528811-87528833 TTTTTTTTGGGAAGAGTTTGAGG + Intergenic
958125980 3:89355573-89355595 TTTGTTTAGAAATGAATTTAAGG + Intronic
958145303 3:89615579-89615601 TTTGTTCAGAGAAGAATCACTGG - Intergenic
958706063 3:97657221-97657243 TTTTTTTAAGGAAAATTTTCAGG + Intronic
959041312 3:101425412-101425434 TTTGTTTCTGGAAGATTTTAGGG - Intronic
959749305 3:109814347-109814369 TATGTGTAGGGATGTATTTCTGG - Intergenic
960307570 3:116080539-116080561 TTTCTACAGGGAAGAATATCAGG + Intronic
960739357 3:120816075-120816097 TTTGTAAAGGGAAGAAATTGAGG + Intergenic
960853725 3:122081504-122081526 TCTGTCTAGGGAAGAATTATTGG + Intronic
961704214 3:128771906-128771928 TATGTTTAGGAGAGAATTTAAGG - Intronic
962391527 3:134976671-134976693 GTTGTTTATGGAAGAATATGTGG - Intronic
962705628 3:138040873-138040895 TTTTTATAGTGAAGATTTTCTGG - Intergenic
962863188 3:139423535-139423557 ATAGTTTAGGGAAGAAGTCCAGG - Intergenic
963335486 3:143970862-143970884 TGTGTTTAGGGATAAGTTTCAGG - Intergenic
963345910 3:144096608-144096630 TTTGGATAGGGAAGAAGTTTTGG - Intergenic
963659025 3:148100893-148100915 TGTGTTTTGGGGAGAATTTCTGG + Intergenic
963699689 3:148609004-148609026 TTGGCTTAGGCAAGAATTTCAGG - Intergenic
966490073 3:180517364-180517386 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
966714162 3:182999638-182999660 TTTGTTTCTGGAAGATTTTAGGG + Intergenic
967347916 3:188479261-188479283 TTTGTTGAGGGGAGAATTTTTGG - Intronic
967728755 3:192887023-192887045 TTTGTATAGTGAAGAATCTAGGG - Intronic
969828779 4:9779260-9779282 GATGTTTAGGGAAGGCTTTCTGG - Intronic
969840846 4:9880580-9880602 TTTGGTTAGCAAAGAACTTCAGG + Intronic
970671842 4:18405613-18405635 TTTGTTAATGGAAGAATCTTAGG + Intergenic
970892264 4:21060354-21060376 TTTGTGTAGGGAAAAAATTCTGG - Intronic
970924613 4:21436567-21436589 TTTGTTTAGGAAACAGGTTCTGG + Intronic
972964141 4:44488212-44488234 ATTATTTAGGCAAGAATTACAGG - Intergenic
973573101 4:52260407-52260429 TTTGACAAGGGAAGTATTTCAGG + Intergenic
973694355 4:53475767-53475789 TTACTTCAGGGAAGAATTTGGGG - Intronic
974416734 4:61617774-61617796 TTTGCTTAGGGAAGAAAATATGG - Intronic
975022327 4:69503978-69504000 TTTGTTTCTGGAAGATTTTGGGG - Intronic
976216100 4:82716901-82716923 ATTGTTTAGGGAATAATGACAGG - Intronic
976517865 4:85992032-85992054 ATGGTTCAGGGAAGAATTGCTGG + Intronic
976645920 4:87387291-87387313 TTAATTTAGGGAAGAATTAATGG - Intronic
976939914 4:90687327-90687349 TTTGTTTCTGGAAAATTTTCAGG + Intronic
976948370 4:90798725-90798747 TTTGTTTCTGGAAGATTTTAGGG + Intronic
977147718 4:93466342-93466364 TTTGCTCAGGGAAGAATTCAAGG + Intronic
982879006 4:160686658-160686680 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
983565701 4:169149227-169149249 GTTGTTTAGGTAAGGATTTAGGG - Intronic
983804596 4:171978825-171978847 TTGGCTTAGGAAACAATTTCTGG + Intronic
983891980 4:173038888-173038910 TTAGTTTAGGGAAGGTTTACAGG - Intronic
984056617 4:174938357-174938379 TTGGTTTAGGGTAGCATTACTGG - Intronic
986284682 5:6350673-6350695 TTCTTTGGGGGAAGAATTTCCGG + Intergenic
988166599 5:27598249-27598271 TTTATTTTGTGAAGAATTTTTGG + Intergenic
989066131 5:37463717-37463739 GTTGTTTAGGCAGGAATTTGAGG + Intronic
989084366 5:37659535-37659557 AGTGTTTAGAGAAGAATTTAAGG - Intronic
990299554 5:54436862-54436884 TTTGTTTCTGGGAGAATTGCAGG - Intergenic
990373463 5:55145118-55145140 ATTGTTTTTGGAAGAATTTCTGG - Intronic
990799275 5:59581908-59581930 ATTGTTTAAGGCAGAAATTCAGG - Intronic
991106800 5:62852552-62852574 TTTGTCCAGGGAAGAATTAAAGG - Intergenic
991471364 5:66972498-66972520 TTTTTAAAGGGAAGAATTACAGG - Intronic
992744847 5:79809290-79809312 TTTGCTTAGGGCAAAAATTCAGG + Intergenic
993178402 5:84518233-84518255 TTTGTTTCTGGAAGATTTTTGGG + Intergenic
993281402 5:85929361-85929383 TTGGTATAGGCAAGAGTTTCTGG + Intergenic
993839757 5:92863483-92863505 TTGTTTTGGGGAAGAATTACTGG - Intergenic
994385070 5:99121372-99121394 TTTAATTAAGGAAAAATTTCGGG - Intergenic
994419664 5:99516268-99516290 ATTGTTTAGGCAGGAATTTGAGG + Intergenic
994487544 5:100398873-100398895 GTTGTTTAGGCAGGAATTTGAGG - Intergenic
994558225 5:101331439-101331461 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
995235295 5:109822618-109822640 TTTGGCTAGGGAAAATTTTCTGG - Intronic
995708805 5:115014141-115014163 TTTGTTTATGCAAGAGTCTCTGG + Intergenic
996971816 5:129378982-129379004 TTTGTTTTAGGAGGAATATCAGG - Intergenic
997188104 5:131901743-131901765 TTTGTTTCTGGAAGATTTTGTGG - Intronic
997605245 5:135170601-135170623 TGTCTTTATGGAAGCATTTCTGG - Intronic
997763276 5:136471804-136471826 TTTTATTAAGGAAGTATTTCAGG - Intergenic
998809080 5:145948277-145948299 AATGTTTAGGGAAGATTTTGAGG + Intronic
998880944 5:146644207-146644229 TTTCCTAAGGGAAGAAGTTCAGG - Intronic
999565370 5:152854313-152854335 TATTTTGAGGGCAGAATTTCAGG - Intergenic
1000967598 5:167677186-167677208 TGTGTTTAGGGAATCATTTCAGG - Intronic
1001747914 5:174106128-174106150 ATTGTTTTGGAAAGAAATTCAGG + Intronic
1003237946 6:4315626-4315648 TTTGTTGATGCAAGAATTTAGGG - Intergenic
1003358955 6:5405095-5405117 TATGTATATGCAAGAATTTCAGG - Intronic
1003775690 6:9360458-9360480 TTTGTTTAGTGCAGGATATCTGG - Intergenic
1004176585 6:13345317-13345339 TTGGTTTAGGAAATAATTTTGGG - Intergenic
1004834068 6:19511256-19511278 TTTGTTTCTGGAAGATTTTAGGG + Intergenic
1004972982 6:20932732-20932754 TTTCTTTAGGGAAACATTTTTGG - Intronic
1005173117 6:23011260-23011282 TAAGATTAGGGAAGAAGTTCGGG + Intergenic
1005607674 6:27491603-27491625 TTTTTTTAGGGAATAATTTAAGG - Intergenic
1005918737 6:30379318-30379340 TTTGCTTATGGAATAATTTTAGG + Intergenic
1007514064 6:42397300-42397322 TTTGTATAGAGAATACTTTCTGG - Intronic
1008269872 6:49478824-49478846 TTTCTATAGGGCAGACTTTCTGG - Intronic
1008590331 6:52987390-52987412 TTAGTTTGATGAAGAATTTCTGG - Exonic
1009237912 6:61146975-61146997 TTTTGTTTGGGAATAATTTCAGG + Intergenic
1009332804 6:62445279-62445301 TTTGTTTATGGAAGATTATAGGG + Intergenic
1010085099 6:71908164-71908186 TTCCTTTAGGGAAGAATTGATGG + Intronic
1010222971 6:73463589-73463611 TTATTTTAAAGAAGAATTTCAGG - Intronic
1010264930 6:73855565-73855587 TTTGGTTAGGGAATAAGTTATGG + Intergenic
1010681939 6:78808191-78808213 TTTGTTTCTGGAAGATTTTATGG + Intergenic
1010821230 6:80418531-80418553 TTTGTTTTTGGAAGAATTTAGGG + Intergenic
1012671709 6:102057905-102057927 TTTGATTAGGGAAAGCTTTCTGG - Intronic
1013738028 6:113249538-113249560 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1014003909 6:116395490-116395512 TTTGTTTCGGTAAGCATTTTTGG + Intronic
1015246951 6:131085492-131085514 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1015739297 6:136436261-136436283 TTTCTCTAGGCAAGATTTTCTGG + Intronic
1015803040 6:137080123-137080145 TTGGCTTAGGCAAGGATTTCAGG - Intergenic
1016075223 6:139788107-139788129 TTTGTTTCTGGAAGATTTTGGGG + Intergenic
1017944629 6:159085192-159085214 TTTGTAGAGGGAAGAATCTTTGG + Intergenic
1018439340 6:163794994-163795016 ATTGTTTAGGGAATAATCACAGG + Intergenic
1018515573 6:164576395-164576417 TTTTTTCAGGGGAGAATTCCAGG - Intergenic
1018715503 6:166529678-166529700 TTTGTGTACGTAAGAATTACTGG + Intronic
1018954525 6:168399713-168399735 TTTTTGTAGGGAACAATTTTTGG - Intergenic
1019120307 6:169798343-169798365 TTTGTTCAAGAAAGAATTTAAGG - Intergenic
1019953847 7:4396276-4396298 TTTGTTAACAGAGGAATTTCAGG + Intergenic
1020382118 7:7557850-7557872 TTTGTTTTTGGAAGATTTTAAGG - Intergenic
1020898357 7:13971289-13971311 TTTGTTTCTTTAAGAATTTCTGG - Intronic
1021404800 7:20252621-20252643 TTTTCTTAGGGAAGAAATTTTGG - Intergenic
1023910734 7:44554304-44554326 TCAATTTAGGGAAGAATTTGAGG - Intergenic
1026276648 7:68884362-68884384 CTTGGTTAGAGAAGAATTTTGGG - Intergenic
1028813814 7:95120924-95120946 ATTTTTTAGGATAGAATTTCAGG + Intronic
1029063811 7:97827436-97827458 TTTGTTTACGGAAGGACTTTGGG + Intergenic
1029801558 7:102953103-102953125 TATTTTTTGGGAAGAATTTGAGG - Intronic
1030403485 7:109082304-109082326 TTTATTGAGGAAAGAAATTCTGG + Intergenic
1030454772 7:109760054-109760076 TTTGTTTCTGGAAGATTTTATGG + Intergenic
1030807534 7:113936302-113936324 TTTGTTTCTGGAAGATTTTAGGG + Intronic
1031014614 7:116559677-116559699 TATGTTAAGGGAAGAATTCCAGG + Exonic
1031760690 7:125709897-125709919 TTGGCTTAGGCAAGGATTTCAGG - Intergenic
1031857362 7:126938347-126938369 GTTGTTTAGGAAGGCATTTCAGG - Intronic
1033488490 7:141816019-141816041 TTTGGTTTGGGAAGTATATCTGG - Intergenic
1033835979 7:145312770-145312792 ATTGTTTTTGTAAGAATTTCTGG + Intergenic
1034072986 7:148205697-148205719 TTCCTTTAGTGAAAAATTTCAGG - Intronic
1036519786 8:9480500-9480522 TTTGTTTATGGACCATTTTCTGG - Intergenic
1036954901 8:13177211-13177233 TTTGTTTTAGGAACAATTTTTGG + Intronic
1037409203 8:18577030-18577052 TTTGGTTAAGAAAGAATTTAAGG + Intronic
1037996997 8:23359930-23359952 GCAGTTTAGGGAAGGATTTCTGG - Intronic
1038029423 8:23624179-23624201 TTTGCTTAGAGAAGAGGTTCAGG - Intergenic
1038208858 8:25496395-25496417 GTTGTTTATAGAAGAATTTCAGG + Intronic
1039197199 8:35046031-35046053 TTGGTTTCTGGGAGAATTTCTGG + Intergenic
1040366300 8:46720729-46720751 TTTGTTTAGAGAAGGACTTTGGG - Intergenic
1041959378 8:63594948-63594970 GTTGTTCAGGGAAGAAGTCCGGG + Intergenic
1043473014 8:80579777-80579799 TTTTATTAGTGAAGAATTTGAGG + Intergenic
1043813590 8:84773916-84773938 TTTGTTTCATGAAGCATTTCTGG + Intronic
1044151931 8:88789603-88789625 TATATTTATGGAAGAATTTTTGG + Intergenic
1044531112 8:93308693-93308715 TTTAGTTAGGGAAGCATTTTAGG + Intergenic
1045033432 8:98159107-98159129 TTTCTTTATGAAAGAACTTCTGG + Exonic
1045060973 8:98410736-98410758 TTTGTGGAGGGAATACTTTCTGG - Intronic
1045318634 8:101064478-101064500 TTTATTTAGGGAACAATTTCTGG - Intergenic
1045569317 8:103353166-103353188 TTTGTTTAGGCAGAAACTTCTGG - Intergenic
1046550780 8:115713402-115713424 TATATTCAGGGAAGAATTTCAGG - Intronic
1046895250 8:119464417-119464439 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1047458095 8:125034697-125034719 CTGGTTTGGGGAAGATTTTCCGG - Intronic
1047468492 8:125143696-125143718 TTTGTTTAGGACCAAATTTCAGG + Intronic
1048414977 8:134217597-134217619 TTAGTTTGGGGAATAATTTCTGG + Intergenic
1048661054 8:136601239-136601261 TTTGATTGGGGCACAATTTCTGG - Intergenic
1048721844 8:137334659-137334681 TTCTTTTAGGTAGGAATTTCAGG + Intergenic
1052220901 9:26020548-26020570 TTTGTTTAGGGAGGAATTTAGGG - Intergenic
1052677260 9:31643252-31643274 ATTGTTGAGAGAAGAATTTAGGG - Intergenic
1052712059 9:32069296-32069318 TTAATTTAGAGAAGACTTTCAGG - Intergenic
1053826717 9:42032528-42032550 TTTGTTCAGAGAATAATTTACGG + Intronic
1054603842 9:67154895-67154917 TTTGTTCAGAGAATAATTTACGG - Intergenic
1054937047 9:70699222-70699244 TTTTTCTAGGAAAGAATTTAAGG + Intronic
1055203338 9:73695065-73695087 GATGTTTTGGGAAGACTTTCAGG - Intergenic
1055302602 9:74897770-74897792 TTTTTTTAAATAAGAATTTCTGG - Intergenic
1055986837 9:82061738-82061760 TTTCTTTAGGGAAGACCTTGGGG + Intergenic
1056572649 9:87829033-87829055 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1056643824 9:88392862-88392884 TCTGTCTAGGGATGAATTTGGGG + Intronic
1056644016 9:88394762-88394784 ATTCTTAAAGGAAGAATTTCAGG - Intronic
1056885148 9:90434979-90435001 TTTGTCGAGGGAAACATTTCGGG + Intergenic
1057464905 9:95304085-95304107 TTTGTCTAGATAAGAATTCCAGG - Intronic
1059330830 9:113534555-113534577 ATTGTTTAGGGAATAATGGCAGG + Intronic
1059836494 9:118160283-118160305 GATGTTGAGTGAAGAATTTCAGG - Intergenic
1062119449 9:134826379-134826401 TCTGTTTAGTGAAGAATTCGGGG + Intronic
1062165882 9:135106990-135107012 TTTGTTCCTGGAAGACTTTCGGG + Intronic
1185792488 X:2937977-2937999 TTTGGTCGGGGAACAATTTCAGG + Intronic
1186090659 X:6044523-6044545 TTTTTTTATGGAAGATTTTTAGG + Intronic
1186096110 X:6104158-6104180 TTTGATGATGGAAGAATTTGCGG - Intronic
1187006873 X:15240975-15240997 TTTCTGTAGGTCAGAATTTCAGG - Intronic
1187423405 X:19156195-19156217 TTCCTTTATGGAAGAATTTCAGG - Intergenic
1187730324 X:22246298-22246320 TTTGTTTAGGGCATTATATCTGG + Intronic
1187820788 X:23285726-23285748 TATGTTTTAGGAAGAAGTTCAGG - Intergenic
1188187670 X:27134854-27134876 TTTGCCTAGGTAAGAATTTAAGG - Intergenic
1188530207 X:31132138-31132160 AGTGCTTACGGAAGAATTTCAGG - Intronic
1189100764 X:38186948-38186970 TTTGTTGAGGGAATACTCTCAGG - Intronic
1190734378 X:53246160-53246182 TTTCTTTAGGGAACAATTGAGGG - Intronic
1190823138 X:53993255-53993277 TCTGGGTAGGGAAGATTTTCAGG - Intronic
1191155464 X:57267750-57267772 TTTGTTTCTGGAAGATTTTAGGG - Intergenic
1191672524 X:63761708-63761730 TTTCTTGAGGGAAAAGTTTCTGG - Intronic
1192417073 X:70990843-70990865 TTTGTATAGAGTAGTATTTCAGG + Intergenic
1192934713 X:75847934-75847956 TTTGTTTTTGGAAGATTTTAAGG + Intergenic
1193593660 X:83420012-83420034 TTTGTTGATGGAAGACTTTAGGG - Intergenic
1193673995 X:84424896-84424918 TTTGTCTGGGCAAAAATTTCTGG + Intronic
1193999644 X:88412307-88412329 TATGTTGAGGTAACAATTTCTGG + Intergenic
1194712796 X:97255327-97255349 TATGATTAGGGAAGGCTTTCTGG - Intronic
1194925732 X:99820612-99820634 TTTGTTTCTGGAAGATTTTCAGG - Intergenic
1195470537 X:105224810-105224832 ATTGGTTGGGGAAGGATTTCTGG + Intronic
1195952399 X:110289110-110289132 TTTGTTGAGGGAAGGATTCATGG - Intronic
1196586905 X:117440306-117440328 TTTATTTCGGGAAGATTTTAGGG - Intergenic
1196933613 X:120706815-120706837 TTTGTATACGGTAAAATTTCTGG - Intergenic
1197100442 X:122647201-122647223 TTTCTGAAGGGAAGAATTACCGG - Intergenic
1197978494 X:132191677-132191699 TGTCCTTAGGGAAAAATTTCAGG - Intergenic
1198118690 X:133569584-133569606 TCTGGTTAGAGAAGAATTTATGG - Intronic
1198494256 X:137174777-137174799 TTTGTTTTGGGACAAATTTGGGG + Intergenic
1199773158 X:150987474-150987496 TTTGTTTTGGGGACAACTTCAGG + Intronic
1200327963 X:155262624-155262646 TTAATGTAGGGAAGAATTTAAGG - Intronic
1200553859 Y:4611375-4611397 TTTGTTTCTGGAAGATTTTAGGG + Intergenic
1201280756 Y:12340071-12340093 TTTGGTCGGGGAACAATTTCAGG - Intergenic