ID: 1106003553 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:25747663-25747685 |
| Sequence | GGGAAGAATTTCAGGATGTC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 253 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 17, 4: 232} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1106003546_1106003553 | 12 | Left | 1106003546 | 13:25747628-25747650 | CCTGGGGATACAATGCGTGGGGA | 0: 1 1: 0 2: 1 3: 4 4: 62 |
||
| Right | 1106003553 | 13:25747663-25747685 | GGGAAGAATTTCAGGATGTCAGG | 0: 1 1: 0 2: 3 3: 17 4: 232 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1106003553 | Original CRISPR | GGGAAGAATTTCAGGATGTC AGG | Intronic | ||