ID: 1106003553

View in Genome Browser
Species Human (GRCh38)
Location 13:25747663-25747685
Sequence GGGAAGAATTTCAGGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106003546_1106003553 12 Left 1106003546 13:25747628-25747650 CCTGGGGATACAATGCGTGGGGA 0: 1
1: 0
2: 1
3: 4
4: 62
Right 1106003553 13:25747663-25747685 GGGAAGAATTTCAGGATGTCAGG 0: 1
1: 0
2: 3
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106003553 Original CRISPR GGGAAGAATTTCAGGATGTC AGG Intronic
901767961 1:11515747-11515769 GGGAAGGAGGTCAGGATGTGGGG + Intronic
902724331 1:18324852-18324874 GGGAGTCATTTCAGGATTTCGGG + Intronic
903575450 1:24337090-24337112 GGGGAGGTTTTCAGGATATCTGG - Exonic
904544105 1:31254886-31254908 GGGAACAATTTGACAATGTCTGG - Intergenic
905293724 1:36941028-36941050 GGGCAGAAACTCAGGAGGTCAGG - Intronic
906449006 1:45927972-45927994 GGCAAGTATTGCAGGAAGTCAGG - Intronic
909737450 1:78980849-78980871 GGAAAGATTTTCAGGATGAAAGG - Intronic
910280146 1:85490892-85490914 GGCCAGAATCTCAGAATGTCTGG - Intronic
911479566 1:98421226-98421248 GGGAACATTTTCAGGACATCTGG - Intergenic
911639567 1:100272942-100272964 AGGAATAATTTTATGATGTCAGG + Intronic
912630657 1:111243945-111243967 GGGTAGAAATGCTGGATGTCTGG + Intergenic
913438054 1:118867713-118867735 GGGACGCATTTGAGGGTGTCGGG - Intergenic
913739813 1:121829333-121829355 GGGAACATTTTCAGAATTTCTGG - Intergenic
915103600 1:153518054-153518076 GTGAAGAATTTTGGGAGGTCAGG - Intergenic
915370347 1:155344612-155344634 GGGATGCATTTCAGAATGTTTGG - Intronic
917923538 1:179770578-179770600 TGAAAGAATTTCAGGGTGGCTGG - Intronic
919137523 1:193529449-193529471 GGGAAGAAGTTGAGGTTGTTAGG - Intergenic
919395594 1:197043390-197043412 GTGGAAAATTTCAGGATGTTTGG - Intronic
920709308 1:208279949-208279971 GGGATGAAATCTAGGATGTCTGG + Intergenic
921101565 1:211933315-211933337 AGAAAGAATGACAGGATGTCTGG + Intergenic
921534261 1:216326130-216326152 ATGAAGCATTACAGGATGTCAGG - Intronic
921988332 1:221336440-221336462 GGGAACAATGTCAGAATGACCGG + Intergenic
922378652 1:224997257-224997279 GGGAAGCATATCAGAATGCCAGG + Intronic
923375297 1:233356001-233356023 TGGAAGAAATTCAGTATGGCTGG - Intronic
924378735 1:243440521-243440543 AGGAAGAATTCCAGGAATTCTGG + Intronic
1062776767 10:156741-156763 GTGGAGAATTTCAGGTTGTTTGG + Intronic
1065144373 10:22753617-22753639 TGGAAGAATTTTAAGATGTGAGG + Intergenic
1067382075 10:45783801-45783823 GGGATGAATTTTAGAATGTCAGG + Intronic
1067889773 10:50124444-50124466 GGGATGAATTTTAGAATGTCAGG + Intronic
1069001088 10:63265941-63265963 GGGAAAAACTTCAAGATGTTTGG + Intronic
1069362714 10:67661325-67661347 GGGAAGAAAGTCAGGAAGTTAGG + Intronic
1070335067 10:75448001-75448023 GGGTAGAAATCCAGGAAGTCAGG - Intronic
1071738962 10:88335029-88335051 AGGAAGAATTTGAAGATGACTGG - Intronic
1073643304 10:105274643-105274665 GGGAGGAATTTGAGGGTGTCAGG - Intergenic
1075331114 10:121574665-121574687 GGGGAGGCTTTGAGGATGTCTGG - Intronic
1079872854 11:25822135-25822157 GGGAGGAATTCCAGGATGCCAGG + Intergenic
1080821620 11:35812221-35812243 AGGTAGAATTTCAGCTTGTCTGG + Exonic
1081038166 11:38176562-38176584 GGGAAGAAGGGCTGGATGTCAGG + Intergenic
1084283625 11:68117155-68117177 GGAAAGAAATTCAGTATGTCTGG + Intronic
1084710957 11:70843390-70843412 GGGAAGAGTTTATGGATGGCTGG + Intronic
1085381676 11:76125461-76125483 GGGAAGAATTTCCTGAAGTGAGG - Intronic
1085477068 11:76795484-76795506 AGGAAGCATTCCAGGAGGTCGGG + Intronic
1086105808 11:83145414-83145436 GTGAAGAATATCAGGTTGTCAGG + Intergenic
1088044920 11:105438532-105438554 GGAAAGTCTTTAAGGATGTCAGG + Intergenic
1090109451 11:123889566-123889588 TGGAAGAATTACAGAATATCAGG - Intergenic
1091031585 11:132194051-132194073 TGGAATAATTTCAGTATGACTGG - Intronic
1091409962 12:232905-232927 GGGCAGAATGTCAGGCTATCCGG - Intronic
1091785395 12:3240197-3240219 GGGTAAAATGACAGGATGTCTGG - Intronic
1092115201 12:5996156-5996178 GGGCAGAATTTCAAGCTGACTGG - Exonic
1093093999 12:14951935-14951957 GGGAAGAATTTCAGGCCCTGTGG + Intronic
1093504399 12:19848174-19848196 GGGGAGAGTATCAGGATGTTTGG + Intergenic
1094081307 12:26538869-26538891 GGTAAGAATCACAGGCTGTCCGG - Intronic
1096150427 12:49306819-49306841 GGAAAGAAAATCAGGATCTCTGG - Intergenic
1100080485 12:90842991-90843013 TGGTGGAATTTCAGGATGTCTGG + Intergenic
1100856995 12:98766055-98766077 GAAAACAATTTCAGAATGTCTGG + Intronic
1101302556 12:103496263-103496285 AGGGGGAATTTCAGGATTTCTGG - Intergenic
1102231436 12:111265268-111265290 GGGAAGCTTTTATGGATGTCTGG - Intronic
1104798019 12:131533219-131533241 GGGAATAGCTTCAGGATGCCTGG + Intergenic
1106003553 13:25747663-25747685 GGGAAGAATTTCAGGATGTCAGG + Intronic
1106107934 13:26750494-26750516 GGGACTCATTCCAGGATGTCTGG - Intergenic
1106457677 13:29941588-29941610 GGGAAGAAATCCAGGATTTATGG + Intergenic
1106574269 13:30959860-30959882 GTGTGGAATTTCAGAATGTCAGG + Intronic
1106773051 13:32981364-32981386 TGGAAGAATTTCAGTTTCTCTGG - Intergenic
1107543961 13:41419510-41419532 GGGCAGAATTTCAGAATCACGGG - Intergenic
1108046769 13:46390886-46390908 GTGAAGAATTTCCAGATGTAGGG - Intronic
1109317928 13:60773593-60773615 TGGAAGAATTTCAGTAAGTTTGG + Intergenic
1109777424 13:67060147-67060169 TGGAAGAATTTCATGAGGTCAGG + Intronic
1111368267 13:87279861-87279883 GAGAAGAATTTGAGGATGTTAGG - Intergenic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1112093478 13:96107626-96107648 GGGAAGTGTTGCAGGAAGTCAGG + Intronic
1113709989 13:112456852-112456874 TGGATGAAGTTCAGGGTGTCAGG - Intergenic
1115329253 14:32176911-32176933 TGGAAGAGTTTCAGGAGGACTGG + Intergenic
1117375262 14:55113445-55113467 GGTAAGAGTGTCAGGATGTGGGG - Intergenic
1119632298 14:76243691-76243713 GGGTATAATTTCAGGCTGGCTGG - Intronic
1120838354 14:89061195-89061217 AGGAGGAATTTCAGGTTGCCTGG + Intergenic
1121241405 14:92432711-92432733 GGGAACATTTTCTGGGTGTCTGG + Intronic
1122169480 14:99860141-99860163 TGGAAGGATTGCAGGATGGCTGG - Intronic
1122295191 14:100701528-100701550 GGGGAAAGTATCAGGATGTCAGG - Intergenic
1123133635 14:106007887-106007909 GGGAAGAAGGTCAGGAAGACAGG - Intergenic
1124016202 15:25877859-25877881 CGCAAGAGTTTCAGTATGTCTGG + Intergenic
1126510755 15:49470899-49470921 GGGAGAAATTCCAGGATGTAAGG + Intronic
1129363752 15:75041751-75041773 AGGAAGAACTTCAGAAAGTCTGG - Intronic
1130815364 15:87426445-87426467 GGGATGAATTTTAGGCTTTCAGG - Intergenic
1133154415 16:3862732-3862754 GGGAAAAACTTCAAGATGGCAGG - Intronic
1140851240 16:78936550-78936572 GGTAAGAATTTCAGAATTCCAGG + Intronic
1141409626 16:83824125-83824147 GGGAAAGATCTCAGGATCTCAGG + Intergenic
1141817626 16:86423584-86423606 AGGAAGAATGTCAGGATCTTGGG + Intergenic
1141825078 16:86473023-86473045 GGGAAGAAGTTCAGTGTGTTTGG + Intergenic
1142721919 17:1782069-1782091 GGGCCCAATTTCAGGATTTCCGG - Intronic
1146685449 17:34838470-34838492 CTGAAGAATTTCAGGACGCCAGG + Intergenic
1146685468 17:34838609-34838631 CTGAAGAATTTCAGGACGCCAGG + Intergenic
1149488222 17:57061616-57061638 GGGAAGAATGTCAAGTTGTACGG + Intergenic
1152958848 18:64799-64821 GGGAAGAGTTTGATGAGGTCTGG - Intronic
1154262162 18:12844825-12844847 GGGAGAAAATTCAGGATGTAAGG - Intronic
1155776280 18:29766051-29766073 GTTAAGACTTTGAGGATGTCAGG - Intergenic
1156267327 18:35500459-35500481 GGGAAGAATTTCAGAAAGAAAGG - Intergenic
1156269190 18:35515462-35515484 GGGATGCTTTTTAGGATGTCAGG - Intergenic
1157585060 18:48795751-48795773 GGGAAGAATTTCAGACTATTAGG + Intronic
1158887596 18:61843124-61843146 GGGAAGGATTTTAGAATGCCAGG + Intronic
1159816199 18:73076820-73076842 GGGAAGCATATCAGAAAGTCAGG - Intergenic
1160248986 18:77184760-77184782 GGGAAGAACTTCAGGGTTCCTGG + Intergenic
1163728202 19:18934342-18934364 GGGAGAAATCTCAGGATGGCGGG - Exonic
1165469944 19:35997401-35997423 GGGAAGAAATGCAGGGTCTCAGG + Intergenic
1166138405 19:40791503-40791525 GGGAAGAACTTCAGTGTGGCTGG - Intronic
1166336821 19:42113258-42113280 GGGAAGTATTTCAGAATGTCTGG - Intronic
1167263699 19:48472942-48472964 GGGAAGCATCTCTGGATGTCTGG + Intronic
1167756966 19:51418740-51418762 GGGAAGAGTTTGAGGAAGGCGGG + Intergenic
926663087 2:15490260-15490282 CAGAACAATTTCAGGAGGTCAGG + Intronic
927224681 2:20752117-20752139 TGGAAGAATTTCTTGAAGTCAGG - Intronic
931299398 2:60962174-60962196 GGCTAGAATTTCAGGACATCTGG + Intronic
932509358 2:72269987-72270009 GTGAAGAGGTTCAGGATGTGAGG + Intronic
933579755 2:84111675-84111697 GGGATGAATAGAAGGATGTCAGG + Intergenic
934109350 2:88727291-88727313 GGGATGAATGTCAGGAGGTGAGG + Intronic
936281876 2:111148593-111148615 GGGGAAACTTTCAGGATGTCAGG - Intronic
936737902 2:115468720-115468742 AAGAAGAATTTCAGGATGAATGG + Intronic
938570759 2:132560160-132560182 GGGAAGAATTTTATAATGGCAGG - Intronic
939040407 2:137182311-137182333 GGGAAGGATTTCGGAATATCTGG - Intronic
939110867 2:138005156-138005178 TGGAAGAATTTCAGGGTAGCTGG - Exonic
939161194 2:138591497-138591519 GGCAAGCATTTCAGAAGGTCAGG - Intergenic
939731591 2:145791294-145791316 GGGAAGCATCTCTGGATCTCTGG - Intergenic
941412352 2:165174955-165174977 TGTAAGAAATTCAGGATCTCTGG + Intronic
941737089 2:168990157-168990179 TGGAAGAATTTGAGGAGGACTGG + Intronic
941947743 2:171118797-171118819 GAGAGGAATGTCAGGATGTGTGG - Intronic
942856836 2:180558783-180558805 GAGAGGAATATCAGGATGTGGGG + Intergenic
944303176 2:198148503-198148525 GGGAATAATTTCATCATATCTGG - Intronic
946027457 2:216680377-216680399 GGGTAGAATTCCAGGAAGTGGGG + Intronic
946542182 2:220696871-220696893 GGGAACCATTTCAGGCTGTTGGG - Intergenic
947689432 2:232121084-232121106 TGGAAGAAGCTCAGGAAGTCTGG - Intronic
948585785 2:239018897-239018919 GCGAAGAAATTCAGGGAGTCTGG - Intergenic
1169965420 20:11212370-11212392 GGAAACAATTTCAGTATTTCTGG + Intergenic
1170084038 20:12509367-12509389 GAAAAAAATGTCAGGATGTCAGG + Intergenic
1170127742 20:12984920-12984942 GAGAAGAATTTCTGGATGTGTGG + Intergenic
1170531438 20:17296504-17296526 TGGAAGAATTTCTGGAAGACAGG - Intronic
1171063800 20:21993580-21993602 GGAAAGAAGTCCAGGATGACTGG - Intergenic
1172927459 20:38551812-38551834 GAGAAGAATTTTAAGAAGTCGGG + Intronic
1173664384 20:44754358-44754380 GGGAAGAATTTCCGGGTGGAAGG + Intronic
1174904974 20:54540749-54540771 TGGAAGAATTGCAGGAGGCCAGG - Intronic
1174941741 20:54936846-54936868 GAGAAGAATTTCAAGAAGTGGGG - Intergenic
1177414213 21:20773026-20773048 TGGAAGAATTTCAGAATTTGGGG + Intergenic
1177570332 21:22877963-22877985 GGGAAGAAATTCAAGCTGGCTGG - Intergenic
1178827014 21:36025466-36025488 GAAAAGAAATTCAGGATCTCAGG - Intergenic
1179107570 21:38416791-38416813 GGGCAGATTTTGAAGATGTCTGG + Intronic
1181582945 22:23837917-23837939 GGGAAGAATTCCAGGGTCTTGGG - Intronic
1181882319 22:25990823-25990845 GGGAGAAATTTGAGGATGTGGGG - Intronic
1181909833 22:26229803-26229825 AAGAAGCATTTCAGGACGTCAGG + Intronic
1182259474 22:29062892-29062914 GGGAAGAGTTTGCGAATGTCTGG + Intergenic
1182953655 22:34400634-34400656 GAGAAAAAGGTCAGGATGTCAGG - Intergenic
1184138827 22:42565735-42565757 GGTAAGAATAGCAGGAGGTCAGG - Intronic
1184801002 22:46759351-46759373 GGATAGTATTTCAGGATGGCTGG - Intergenic
1185213611 22:49586119-49586141 GGAAAGAATTTCAGGGCGGCTGG - Intronic
952823968 3:37509465-37509487 GGGAAGAAGCATAGGATGTCTGG + Intronic
953143126 3:40247979-40248001 GGGGAGAATTTCCGCATGCCTGG - Intronic
953260520 3:41334399-41334421 TGGAAGAATCCTAGGATGTCGGG - Intronic
954401446 3:50321698-50321720 GGGAAACATTTCAGGCTGACTGG - Exonic
954810978 3:53247664-53247686 GGAGAGAATCCCAGGATGTCAGG + Intronic
956575175 3:70744922-70744944 GGTATTAATTTAAGGATGTCTGG - Intergenic
957503823 3:81093750-81093772 AGTAAGAAATTCAGGATGACTGG + Intergenic
958949652 3:100402402-100402424 GGAAAGAATTTCAGGATCACCGG + Exonic
959682655 3:109113386-109113408 GGCAGGAATTTCTGGATGGCTGG + Intronic
960172007 3:114473183-114473205 GGGAAGAAAGCCAGGAAGTCTGG - Intronic
961392097 3:126558276-126558298 GGGAAGAGGTTCAGGATGGGTGG + Intronic
961726169 3:128932531-128932553 GGCAAGAAGTGCAGGATGTGGGG - Intronic
963801381 3:149679417-149679439 GGCTAGAATTTCAGGAAGTTAGG - Intronic
965631607 3:170738982-170739004 GGGCAGAATTTCATGCTGTGAGG - Intronic
965776252 3:172234451-172234473 GGAAAGTGTTTCAGGATCTCTGG + Intronic
966128380 3:176607165-176607187 GAGAAGAACTGCAGGATTTCTGG - Intergenic
967601955 3:191400770-191400792 GAGAAAATTTTCAGGATGTTGGG - Intergenic
970900270 4:21150732-21150754 GGGCAGAATTACAGAATGTGGGG - Intronic
971003478 4:22348691-22348713 GGGTAAAATTTCACAATGTCAGG + Intronic
974316684 4:60291250-60291272 GGGAAGTAGTTCAGAATGACAGG + Intergenic
974902728 4:68021317-68021339 GGAAACAATTTCAAGATGTGGGG + Intergenic
976123617 4:81809564-81809586 GGGTAGAACTTAAGGATCTCTGG + Intronic
976538740 4:86247913-86247935 GAGACAATTTTCAGGATGTCAGG + Intronic
976853585 4:89576963-89576985 GATAAGAACTTCAGGGTGTCTGG - Intergenic
977563290 4:98555474-98555496 AGGAATAATTTCAGGAAGTGTGG - Intronic
979439503 4:120734594-120734616 GGGAAGCGTTTCAGCATTTCTGG - Intronic
981060840 4:140423579-140423601 CGGAAGAATTTGAGGAGGACTGG + Intronic
986657842 5:10032435-10032457 GGAAAGAATTGGAGGATGGCTGG - Intergenic
989338279 5:40345126-40345148 GGAAGGAATCTCAGGAGGTCAGG + Intergenic
990559287 5:56967368-56967390 GGGAAGAAGTCCAAGATGTAAGG - Intronic
990656711 5:57965286-57965308 GGAAAGAATTTCAGAATTTGAGG - Intergenic
994303202 5:98171690-98171712 GAGAAGAATTTCAAGATTTGAGG - Intergenic
995288302 5:110417830-110417852 AGGAAGAGTTTCAGGATGAGAGG + Intronic
995430208 5:112066466-112066488 GGGAATAATTTCTGAATTTCTGG - Intergenic
995882289 5:116856590-116856612 GGGAGGAATTTCAGAAGGGCAGG + Intergenic
996297628 5:121941506-121941528 GGGAACAATGACAGGATGTCAGG - Intergenic
1000044511 5:157510991-157511013 GTATAGAATTTCAGGATCTCTGG - Intronic
1000498630 5:162019751-162019773 GGGGAAAACTTCAGGAGGTCTGG - Intergenic
1000685867 5:164248495-164248517 GGGTAGAATTTCAGACTGTCAGG + Intergenic
1002352259 5:178591242-178591264 GGGAAGAACTGCTGGAAGTCAGG + Intergenic
1006181892 6:32158671-32158693 GGAAAGGATTAGAGGATGTCCGG + Intronic
1006364433 6:33607139-33607161 GGGAGGACTTCCAGGCTGTCGGG - Intergenic
1006638236 6:35475172-35475194 GGTAAGAGATTCAGGAGGTCAGG + Intronic
1006768576 6:36531077-36531099 GTGAAGAACATCAGGAGGTCTGG + Intronic
1007807056 6:44458254-44458276 AGGGAGAAGTTCAGGATTTCAGG + Intergenic
1012804566 6:103878262-103878284 GGCAGGATTTTCAGGATTTCAGG - Intergenic
1014625235 6:123716744-123716766 AGTAAGACTTTCAGGTTGTCCGG - Intergenic
1014634906 6:123833520-123833542 GGAAACAATGTCAAGATGTCAGG - Intronic
1015330543 6:131973757-131973779 AGGAAAATTTTCACGATGTCTGG - Intergenic
1015410006 6:132883493-132883515 GTCAAGAATTTCAGGATGCATGG - Intergenic
1015767846 6:136737925-136737947 TGGTAGAATTTCAGGATGCAGGG + Intronic
1016056145 6:139579635-139579657 AGGAAGAAATTCAGGAGGCCTGG - Intergenic
1018108846 6:160515493-160515515 TGGAAGAATTTCAGGAGGAATGG - Intergenic
1019335833 7:482195-482217 GGCAAGAAATTCATGGTGTCTGG + Intergenic
1019523727 7:1471572-1471594 GAGAAGAAGCTCAGGATCTCGGG + Exonic
1020596106 7:10210094-10210116 GGGAAGACTTGTAGGAAGTCAGG + Intergenic
1020610196 7:10386725-10386747 GGGAAGAATTTAAGTATTTCTGG - Intergenic
1021508461 7:21410369-21410391 GGGAAGAATGTGAGCATGTCAGG + Intergenic
1021804900 7:24345190-24345212 GAGTAGAATTTCTGGATGTTAGG + Intergenic
1022841289 7:34166440-34166462 GGAGAGAATTTCAGGGTTTCAGG - Intergenic
1023233003 7:38053545-38053567 GGGAAGAATTTCATGAGGTCAGG + Intergenic
1023411072 7:39889887-39889909 GGGTAAAATTTCATGACGTCTGG + Intergenic
1024912395 7:54459861-54459883 GGGAAAATTTTCAAGATATCAGG + Intergenic
1024996227 7:55274898-55274920 AGCAAGAATTTCAGCATGTATGG - Intergenic
1028619327 7:92806516-92806538 GGGAAGGAGTGGAGGATGTCAGG + Intronic
1029168059 7:98609718-98609740 TGGAAGAATTTCAGGAAGTCTGG + Intergenic
1029204520 7:98861002-98861024 GAGAAATATTTCAGAATGTCAGG + Intronic
1030919126 7:115358022-115358044 GTGAACAAGATCAGGATGTCTGG + Intergenic
1031946706 7:127849600-127849622 GTGAAGTATTTCAGGATGATAGG + Intronic
1032698840 7:134361182-134361204 GGGATGATTCTCAGGATGACAGG - Intergenic
1034628814 7:152514817-152514839 GGGGAGGATTTCCGGAAGTCTGG - Intergenic
1035910791 8:3563794-3563816 GGGGAGAATTTCTTGATCTCAGG + Intronic
1038078274 8:24102438-24102460 GGGAAGTGTTTCAGGGAGTCAGG + Intergenic
1039300987 8:36208524-36208546 GGAAAGAATCTCAGGAGGCCAGG + Intergenic
1039712007 8:40064619-40064641 TGGAAGAATTTCAGGAGGATTGG - Intergenic
1040656997 8:49522005-49522027 GGAAAGAATTTCATGATCTTAGG - Intergenic
1043211575 8:77525821-77525843 GGGAAGAATTTCAGTCTCTATGG + Intergenic
1045346132 8:101295132-101295154 GGGTAGAATCTCTGAATGTCAGG + Intergenic
1046584378 8:116133353-116133375 GGCAAGAGGTCCAGGATGTCAGG + Intergenic
1049571029 8:143370393-143370415 GGGAAGACTTTCCAGATGGCAGG - Intronic
1052960277 9:34289883-34289905 GGTCATAATTTCAGGAAGTCAGG - Intronic
1053605258 9:39651857-39651879 GGGAAGGGATTCAGGATGTTAGG + Intergenic
1053863177 9:42408484-42408506 GGGAAGGGATTCAGGATGTTAGG + Intergenic
1054248283 9:62690559-62690581 GGGAAGGGATTCAGGATGTTAGG - Intergenic
1054562397 9:66725084-66725106 GGGAAGGGATTCAGGATGTTAGG - Intergenic
1055944793 9:81683322-81683344 AGGAATAATTTCAGCCTGTCAGG + Intronic
1057173809 9:92979657-92979679 TGGAAGAATTTCAGGAGGATTGG + Intronic
1057406496 9:94776110-94776132 GGGAAGTGTTACTGGATGTCTGG - Intronic
1057646949 9:96885470-96885492 GAGAACAATTACAGCATGTCAGG + Intergenic
1058920066 9:109605085-109605107 GTGAAGAATTTGAGGAAGCCTGG - Intergenic
1059980289 9:119764121-119764143 GGGAAGGTTTGCAGGGTGTCGGG + Intergenic
1060016639 9:120092297-120092319 GAGAAGGATTGCAGGATGCCAGG - Intergenic
1060320045 9:122550337-122550359 TGGAAGAGTTTCAGGAAGACTGG - Intergenic
1060808296 9:126592652-126592674 GGGAAGAATAGCAGGCTTTCAGG - Intergenic
1186986551 X:15020926-15020948 AGGAAGAAATTGAGGATGTGGGG - Intergenic
1188177136 X:27004890-27004912 GGGAAGAAATCAAGGATGTAAGG + Intergenic
1188600624 X:31959245-31959267 GGGTAGAATATAAGGATGTTGGG - Intronic
1188892424 X:35627047-35627069 GTGAAGAGTTTCAGGTTGGCAGG - Intergenic
1189434124 X:40976013-40976035 AGGAAGAATTTCAATGTGTCAGG + Intergenic
1196411015 X:115418542-115418564 GGCAAGAAGTTCAGCAAGTCAGG - Intergenic
1197107864 X:122737149-122737171 GGAAAGAATATCAGTATATCTGG + Intergenic
1197601782 X:128539844-128539866 GGGAAGAATTTCAGAAGGAATGG + Intergenic
1197868803 X:131046331-131046353 GGAAAGAGTCTCAGGAAGTCAGG - Intergenic