ID: 1106005468

View in Genome Browser
Species Human (GRCh38)
Location 13:25766029-25766051
Sequence TAAGGAGGAGTCGCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106005464_1106005468 12 Left 1106005464 13:25765994-25766016 CCAGCTTTCTTGATCAGTTGGGT 0: 1
1: 0
2: 1
3: 7
4: 96
Right 1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106005468 Original CRISPR TAAGGAGGAGTCGCAGCCTC AGG Intronic
903140962 1:21338979-21339001 TAAGCAGGAGGAGCAGCCCCTGG - Intronic
905238013 1:36563561-36563583 GAAGGAGGAGCTCCAGCCTCGGG - Intergenic
905316958 1:37088652-37088674 TAGGGAGGGGGCACAGCCTCAGG + Intergenic
906046828 1:42837566-42837588 AAAGGAAGGGTCGCAGGCTCTGG + Intronic
913332802 1:117681514-117681536 TGAGGAGGAGTCTCAGACCCTGG + Intergenic
915514593 1:156405525-156405547 GAAGGAGGAATCAAAGCCTCAGG - Intronic
916290029 1:163155549-163155571 TAAAGAGGAGAAGCAGTCTCAGG - Intronic
917063536 1:171066871-171066893 TAAGTAGGAGTTGAAGCCTCTGG - Intergenic
1063967504 10:11358204-11358226 TAAGGAGGGGTAGAAGCATCCGG + Intergenic
1066675569 10:37883651-37883673 CCAGGAGGAGTGGCAGCATCTGG + Intergenic
1066699767 10:38114793-38114815 TCAAGAGGAGTGGCAGCATCTGG + Exonic
1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1067121498 10:43475759-43475781 CCAGGAGGAGTGGCAGCATCTGG + Exonic
1074382059 10:112989284-112989306 TGGTGAGGACTCGCAGCCTCAGG + Intronic
1076144648 10:128107810-128107832 TAAGGAAGAGGCCCAGGCTCTGG - Exonic
1076457322 10:130609376-130609398 TAAGGGGCAGCCCCAGCCTCAGG + Intergenic
1079230529 11:18645340-18645362 TTAGGAGGAATCGCAGGCTGCGG - Intergenic
1085344596 11:75760049-75760071 TAGGGAGGAGGAGCTGCCTCAGG - Intronic
1087301794 11:96444317-96444339 TGAGGAGGAGTCTGACCCTCTGG - Intronic
1088695341 11:112361487-112361509 AGAGGAGGAGCCGTAGCCTCGGG + Intergenic
1090604323 11:128405769-128405791 TAAGGAGGTGCTGCTGCCTCAGG - Intergenic
1100360204 12:93870695-93870717 TGAGGAGGAGTAGCAGTCCCTGG - Intronic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1106206233 13:27598047-27598069 TCAGCAGGAGTTGCAGCCTCAGG + Intronic
1106433778 13:29706317-29706339 CAAGGAGGAAATGCAGCCTCTGG - Intergenic
1108007740 13:45968965-45968987 AAAAGAGGAGCAGCAGCCTCGGG - Exonic
1112950498 13:104989995-104990017 TAAGGTATAGCCGCAGCCTCTGG - Intergenic
1113118944 13:106905801-106905823 TAAGGAAGAGGCCCAGCCTGTGG - Intergenic
1121816127 14:96930049-96930071 TAATGAGAACTCGCAGCATCCGG + Intronic
1122136526 14:99636025-99636047 TCAGGAAGAGTCTCTGCCTCTGG + Intergenic
1123015957 14:105375709-105375731 TAAGGTGGTGTGGCAGCCACAGG + Intronic
1128427751 15:67559403-67559425 TAGAGAGGAGAAGCAGCCTCAGG - Intronic
1132632523 16:926733-926755 GAAGGAGGAGAGGAAGCCTCTGG - Intronic
1133528639 16:6631759-6631781 TAGGGAGGAGGAGCAGCCACCGG + Intronic
1133722730 16:8509974-8509996 TCAGGAGGAGTCCCATCCTTGGG - Intergenic
1134005907 16:10818677-10818699 TAAGGCGCAGTCGCAGGCTGGGG + Exonic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1137911644 16:52383901-52383923 GAAGGGGGAGTTTCAGCCTCTGG - Intergenic
1138785756 16:59844612-59844634 TGAGGTGGAGAAGCAGCCTCTGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1145927900 17:28661674-28661696 TAGGGAGGACTCGGAGGCTCTGG - Intronic
1148848789 17:50544186-50544208 TGAGGTGGAGTGGCAGCCCCAGG - Intronic
1152535684 17:80949221-80949243 GCAGGAGGAGTCGCAGCCCAGGG - Intronic
1152805604 17:82354406-82354428 TATGGAGGAGTCACAGACTCTGG + Intergenic
1153311397 18:3680337-3680359 GAAGGAGCAGTGGCAGCCACAGG + Intronic
1155555198 18:27011084-27011106 TAAGGAGGACTTGAAGCCACAGG + Intronic
1161816118 19:6501244-6501266 TAAGGAGGTTTTCCAGCCTCTGG + Intronic
1162910145 19:13843773-13843795 TCAGGAGGAGGCCCTGCCTCGGG + Intergenic
1165074658 19:33273991-33274013 GGAGGAGGAGAGGCAGCCTCAGG - Intergenic
1165247284 19:34504917-34504939 TTAGGAGTAGGCGCAGCCTGTGG + Exonic
1165564449 19:36712424-36712446 TCAGGAGGAGTGGCAGCACCTGG + Exonic
1166444324 19:42845552-42845574 TCAGTAGGAGTCACAGCCCCTGG + Intronic
925100549 2:1241173-1241195 TTAGGAGGAGCCGCAGCTTCTGG + Intronic
927706398 2:25299062-25299084 TAAGGGGGAGTCAGAGGCTCTGG - Intronic
928231741 2:29504625-29504647 TGAGGAAGAATCGCAGCCTTGGG + Intronic
930597121 2:53402452-53402474 TAAGGAGGTGTGGTAGCATCAGG + Intergenic
930767355 2:55097566-55097588 GAAGGAGGAGGGGCAGCTTCAGG + Intronic
932497884 2:72155822-72155844 TGGGCAGGAGTCTCAGCCTCAGG - Intergenic
938662927 2:133505810-133505832 GAAGTAGCAGTGGCAGCCTCAGG - Intronic
940393922 2:153165898-153165920 TAGTGAGGAATAGCAGCCTCAGG + Intergenic
941925681 2:170892062-170892084 GAAGGAGGAGGGGCAGCCTGAGG + Intergenic
947542789 2:230990371-230990393 GAAGGCGGAGGCGCAGCCACAGG + Intergenic
1173905876 20:46628353-46628375 GAAGAAGGAGTAGCAGCTTCGGG + Intronic
1175250988 20:57610175-57610197 CCAGGAGGAGTCGCAGGGTCTGG - Exonic
1176169526 20:63690653-63690675 TTGGGGGGAGTCTCAGCCTCGGG - Intronic
1176184236 20:63769397-63769419 AAAGGAGGAGTCTCACCCACAGG + Intronic
1176235370 20:64051235-64051257 AAAGGAGGACTAGCAGCATCCGG - Intronic
1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1180832993 22:18915493-18915515 TAATCAGGACTCCCAGCCTCTGG - Intronic
1181066827 22:20310761-20310783 TAATCAGGACTCCCAGCCTCTGG + Intergenic
1184808699 22:46813800-46813822 TGAGGAGGTGGCTCAGCCTCCGG - Intronic
1203283077 22_KI270734v1_random:140797-140819 TAATCAGGACTCCCAGCCTCTGG - Intergenic
949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG + Intronic
954150804 3:48656153-48656175 TAAGGTGGAATCGCTGCCGCAGG + Exonic
954358689 3:50105361-50105383 TAAGGAGCAGCAGCAGCTTCGGG + Intronic
955139423 3:56254477-56254499 TAAGGAGGAGGCCCCACCTCTGG + Intronic
961327080 3:126115184-126115206 CAAGGAGGTGCCCCAGCCTCTGG - Intronic
965849933 3:173010844-173010866 TAATGGGGAGGGGCAGCCTCAGG - Intronic
967823272 3:193858088-193858110 GAAGGAGAAGTTGCAGCATCTGG + Intergenic
970484206 4:16507989-16508011 TAAGGGGGAGGATCAGCCTCTGG - Intronic
973728949 4:53804726-53804748 AAAGGAGGAGTAGTGGCCTCAGG - Intronic
973873370 4:55188820-55188842 TAATGAGGAGTCTCCACCTCAGG + Intergenic
976398562 4:84583110-84583132 GAAGGCGGAGACGCGGCCTCCGG - Exonic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
980988400 4:139717686-139717708 TACGGAAGAGTCGGAGCCTGTGG - Exonic
985128012 4:186714373-186714395 ACAGGAGGAGAAGCAGCCTCAGG + Intronic
985627686 5:998369-998391 TGAGGAGGAGACCCAGCCACAGG + Intergenic
992451990 5:76883785-76883807 TTAGGAGGAGTCCCAGGCTGCGG + Intronic
992994369 5:82318038-82318060 GAAGGAGGAGGCGCAGTCTTGGG - Exonic
998154751 5:139778388-139778410 TAAGGAGGAAGCAGAGCCTCTGG - Intergenic
998439513 5:142145326-142145348 TAAGATGGAGTGTCAGCCTCTGG - Intronic
1003066734 6:2910022-2910044 TAAGGAGGAGACGCAGATTTGGG + Intergenic
1006637980 6:35474135-35474157 GAGGAAGGAGTCCCAGCCTCTGG - Exonic
1007729452 6:43937089-43937111 GAAGGAGGAGTGGGAGCCTCAGG - Intergenic
1018019461 6:159745931-159745953 TAGGGAGGAATCACAGCTTCAGG + Intronic
1018472125 6:164106498-164106520 CCAGGAGGAGTCGGTGCCTCCGG + Intergenic
1020943850 7:14575807-14575829 TAATGAGGACTCATAGCCTCTGG - Intronic
1021027771 7:15689084-15689106 TAAGAAGAAGTGGCAGCCTCGGG - Intergenic
1022115922 7:27260307-27260329 AAAGGAGGAGTTGCAAGCTCAGG + Intergenic
1023823016 7:43990488-43990510 GAAGGAGGGGGGGCAGCCTCAGG + Intergenic
1024153823 7:46600091-46600113 TAGGGAGGAGTCGCAGGATAGGG + Intergenic
1025021798 7:55486084-55486106 TGAGGTGGAGCCGGAGCCTCTGG - Intronic
1029751275 7:102543912-102543934 GAAGGAGGCGGGGCAGCCTCAGG + Intronic
1029769227 7:102643017-102643039 GAAGGAGGCGGGGCAGCCTCAGG + Intronic
1033305339 7:140221311-140221333 TAAGGATGAGACACAGCCTAGGG + Intergenic
1035201700 7:157271859-157271881 TCAGGAGGCCTCACAGCCTCAGG + Intergenic
1048949019 8:139477733-139477755 AAAGGAGGAGGAACAGCCTCAGG - Intergenic
1049392455 8:142379281-142379303 TTAGGAGGAGAGGCAGCCCCTGG - Intronic
1049675619 8:143887611-143887633 GAAGCAGGAGTCCCAGCCCCAGG - Intergenic
1055352529 9:75403930-75403952 TTAGGAGGAATTGCAGGCTCTGG + Intergenic
1056202602 9:84290984-84291006 TAAGGAGGACAGGCAGCCTGCGG + Intronic
1056924548 9:90821681-90821703 AAAGGAGGAGTTGGAGCGTCTGG - Intronic
1057218542 9:93243246-93243268 CAGGGAGGAGTCGCAGTCTTGGG - Intronic
1060053263 9:120391905-120391927 AAAGGAGGAGTTGCAGGCCCGGG + Intronic
1188456515 X:30372761-30372783 TAAGCAGGAATCTCAGTCTCAGG - Intergenic
1197050150 X:122047380-122047402 TGAGGGGGAGGCACAGCCTCTGG - Intergenic