ID: 1106006361

View in Genome Browser
Species Human (GRCh38)
Location 13:25773576-25773598
Sequence GCTGCTGGTGGGTCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106006361_1106006372 19 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006372 13:25773618-25773640 TGGCCAGAGGGGCTCTGTACTGG 0: 1
1: 0
2: 0
3: 14
4: 161
1106006361_1106006375 26 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006375 13:25773625-25773647 AGGGGCTCTGTACTGGTTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1106006361_1106006374 23 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006374 13:25773622-25773644 CAGAGGGGCTCTGTACTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 135
1106006361_1106006366 -1 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006366 13:25773598-25773620 CCCCTGACTGCATAGCACTCTGG 0: 1
1: 0
2: 1
3: 8
4: 112
1106006361_1106006371 8 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006371 13:25773607-25773629 GCATAGCACTCTGGCCAGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 157
1106006361_1106006369 6 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006369 13:25773605-25773627 CTGCATAGCACTCTGGCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 160
1106006361_1106006370 7 Left 1106006361 13:25773576-25773598 CCAGCTTGGGACCCACCAGCAGC 0: 1
1: 0
2: 8
3: 20
4: 210
Right 1106006370 13:25773606-25773628 TGCATAGCACTCTGGCCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106006361 Original CRISPR GCTGCTGGTGGGTCCCAAGC TGG (reversed) Intronic
900108003 1:993661-993683 GCAGCTGGAGGGTCCCATGCTGG + Intergenic
900123267 1:1058630-1058652 GCTCCTGGAGGGCTCCAAGCAGG + Intergenic
900123418 1:1059160-1059182 GGCGCTGGTGGGTCCCAGGTTGG + Intergenic
900146025 1:1158951-1158973 GCTGCTGGAGGACCCCGAGCTGG - Intergenic
900609155 1:3537160-3537182 GCTGCCAGTGGGGCCCAAGGGGG + Intronic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
906197281 1:43936813-43936835 TCTGCGGGAGGGTCCCAGGCAGG - Exonic
906215518 1:44036052-44036074 TCTGCTGGTAGCTCCCCAGCAGG + Intergenic
912795060 1:112688374-112688396 GGTGCAGGTGGAACCCAAGCAGG - Intronic
913489655 1:119367027-119367049 CCTGCTGGTGGGTCCAAAGCTGG + Intergenic
914457152 1:147846701-147846723 GCTGTTGGTGAGTCCTTAGCTGG - Intergenic
915462312 1:156077407-156077429 GCTGGTGGTGGGCCCCAAAGGGG - Exonic
916986029 1:170192010-170192032 GTTGCTGGTAGCTACCAAGCTGG + Intergenic
918014288 1:180617929-180617951 GCTCCTGGGTGGTCACAAGCTGG + Intergenic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
922326638 1:224534539-224534561 GCTGCTTGGGTGTTCCAAGCTGG - Intronic
923492831 1:234499416-234499438 GCTGCTGATGTGTCCCCAGGAGG - Intergenic
923521890 1:234741303-234741325 GCTTCTGTAGGGTCCCGAGCAGG + Intergenic
924194777 1:241594615-241594637 GCTGCTGGTAGGTCTTTAGCAGG + Exonic
1062947831 10:1474492-1474514 GAGGCTGGTGGCACCCAAGCAGG + Intronic
1065797874 10:29323711-29323733 TCTGAAGGTGGGTCCCAGGCAGG - Intergenic
1071355003 10:84784966-84784988 GGTGCTCTGGGGTCCCAAGCTGG + Intergenic
1071656903 10:87458855-87458877 CCTGCTTGGGGATCCCAAGCAGG - Intergenic
1074536079 10:114329448-114329470 GCTGCTGGTGGGTCCCCACCTGG - Intronic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1075874888 10:125798012-125798034 GCTCCTGGTGGATCCCAAAGTGG + Intronic
1077018435 11:407046-407068 GCTTCCGGTGGGTCCCGCGCGGG - Exonic
1077361149 11:2140596-2140618 GCGGCTGGAGGGTCCCAAAGTGG - Intronic
1077433746 11:2528411-2528433 GCTGCTGCTGGGACACCAGCAGG - Intronic
1077633740 11:3827787-3827809 CCTGCTGGTGGGCACCAAGAAGG - Exonic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1078682221 11:13487503-13487525 GCAGCTGGTGGGCCGCAAGTTGG - Intergenic
1079031700 11:16991070-16991092 GATGCCGGTGGTTCCCAAACTGG + Intronic
1079392831 11:20037050-20037072 GGTGCTGGTCAGTCCCAAACTGG - Intronic
1081763785 11:45595159-45595181 GCAGCTGGAGGGTCTCAACCAGG - Intergenic
1083157988 11:60837126-60837148 GCAGCTGGGAGGTCTCAAGCTGG + Intergenic
1083173518 11:60936173-60936195 GTGGCTGGTGGGCTCCAAGCAGG - Exonic
1083573144 11:63770383-63770405 GATGCTGATGGGTGCCACGCAGG + Intergenic
1084145798 11:67264757-67264779 GCTGCTTCTGGGTGCCAAGCAGG + Intergenic
1084183552 11:67458442-67458464 GCCGCTGGCGGGTCCTGAGCTGG + Exonic
1084204468 11:67583890-67583912 GCTGCGGGTTGGCCCCATGCTGG - Intronic
1084385475 11:68840973-68840995 GCTGCGGGGCGCTCCCAAGCAGG + Intronic
1084730605 11:71070895-71070917 GCTCCAGGAGGGTCCCAAGCTGG - Intronic
1085076608 11:73597725-73597747 GGTGAGGGTGGGACCCAAGCAGG - Intronic
1085300878 11:75457602-75457624 GCTGATGGAGGGTCCCACCCTGG - Intronic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1085445606 11:76598726-76598748 GCGGCTGGTGGCTACTAAGCTGG - Intergenic
1086901664 11:92374401-92374423 GGTGGTGGTGGGTTCCAAGAAGG + Intronic
1088847985 11:113683609-113683631 GGTGCTGGAGGGAACCAAGCTGG - Intergenic
1089785598 11:120904789-120904811 GCTGAAGGTGGGATCCAAGCTGG - Intronic
1090999259 11:131894676-131894698 GCTGCTGGTGGTTTGCAATCTGG - Intronic
1091035206 11:132226882-132226904 GCTGCTGGTGTATACCATGCTGG + Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1092170539 12:6371369-6371391 GCAGCTGGTGGGAGCCCAGCGGG - Intronic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1098556580 12:71825611-71825633 GCTGCTGGAGGGTCCCATAAAGG + Intergenic
1099056662 12:77850526-77850548 GCTGCTGGTGGTTGCAAAGGAGG + Intronic
1101735098 12:107457485-107457507 GGTGCTGGCGGGTCCCAGGCAGG + Intronic
1104097266 12:125569187-125569209 TCTACTGGGGGTTCCCAAGCTGG + Intronic
1104981864 12:132576822-132576844 GCTGGAGGTGGGTGCAAAGCTGG + Exonic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1106023230 13:25933967-25933989 GCTGATGGTGAGTACCATGCAGG + Intronic
1106480474 13:30133599-30133621 GCGGCTGGGGCGTCCCAGGCAGG - Intergenic
1106888979 13:34222432-34222454 GGTCCTGGTGGGTCCCAAGAAGG - Intergenic
1107450798 13:40507269-40507291 GGTCCTGGTGGGTGGCAAGCAGG + Intergenic
1111604504 13:90520039-90520061 GCTGCTGTGTGTTCCCAAGCTGG - Intergenic
1113542101 13:111116380-111116402 CCGGCTGGTGGTTCCCAGGCTGG + Intronic
1113662260 13:112115831-112115853 GCAGCTGGTGTGTCCGTAGCCGG - Intergenic
1114252279 14:20971550-20971572 GCGGCTGCGGTGTCCCAAGCCGG - Intergenic
1114519065 14:23321646-23321668 GCTGCTGCTGGAGCCCGAGCCGG + Exonic
1118761417 14:68882442-68882464 GATGGAGGTGGGTCCCATGCTGG - Exonic
1119690480 14:76667944-76667966 GCTGCTGGTTTGTCCTCAGCTGG + Intergenic
1119878272 14:78078627-78078649 GCTGCTGGTGGGTCCATTGGAGG + Intergenic
1121713953 14:96059631-96059653 TCTGCTGGGGGGGCCCTAGCTGG + Intronic
1121734220 14:96206518-96206540 CCTGCCGGTGGGACCCAACCTGG + Intronic
1121776324 14:96593294-96593316 GATGCTGCTGGGTCCGAGGCTGG - Intergenic
1122772368 14:104103124-104103146 ACTGCTGGTGGCTCCCCAGCTGG + Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1123035998 14:105472180-105472202 GCTGCTTGTGGGTCTAAACCTGG + Intergenic
1123627786 15:22239381-22239403 GCTGCTGGGGAGTGCCAGGCAGG + Intergenic
1124440034 15:29678891-29678913 GCTGATGGAAGGTCTCAAGCAGG + Intergenic
1125509246 15:40283814-40283836 GCTCCTGGTGGCTGCCTAGCGGG + Intronic
1127279383 15:57475908-57475930 GCTGCTGGGTGGACCCAAGAAGG - Intronic
1128764617 15:70243563-70243585 GGTGCTGGTGGGTGAGAAGCAGG + Intergenic
1130128785 15:81118461-81118483 GCTGCTTGTGGGACCGGAGCGGG + Intronic
1132333324 15:101027375-101027397 GCGGCTGGTGGGTACCTTGCTGG + Exonic
1132398745 15:101491815-101491837 GCAGCTGGTGCCTCCCAAGACGG + Intronic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132958068 16:2606898-2606920 GCGGGTGGTGGGTCCCAAGCTGG - Intergenic
1132970542 16:2686146-2686168 GCGGGTGGTGGGTCCCAAGCTGG - Intronic
1133138500 16:3728638-3728660 GCTGCTGGTGCATGCCAGGCTGG + Exonic
1133359961 16:5166391-5166413 ACAGCTGGTGGGTCTCAAGCTGG - Intergenic
1134642830 16:15843071-15843093 GCTAATAGTGGGTCTCAAGCTGG + Intronic
1135562339 16:23486441-23486463 CCTGTTGCTGGGACCCAAGCTGG + Intronic
1136067101 16:27766704-27766726 GGTGCTGGGGGGTCCTAGGCAGG + Intronic
1136253893 16:29025400-29025422 GCTGACGGCTGGTCCCAAGCAGG + Intergenic
1136922884 16:34346241-34346263 GCAGCTGGTGGGTCCCAGGCTGG + Intergenic
1136981689 16:35065565-35065587 GCAGCTGGTGGGTCCCAGGCTGG - Intergenic
1138263159 16:55640126-55640148 GATGCTGGAGTCTCCCAAGCAGG - Intergenic
1141118967 16:81336001-81336023 GCTGATGGTGGTTCCCAGGCAGG + Intronic
1141976172 16:87517971-87517993 GCTGCTGGGGAGTGCCAGGCAGG - Intergenic
1142839754 17:2618757-2618779 GCTACTCGTGAGGCCCAAGCAGG - Intronic
1144081702 17:11769232-11769254 GGTGCTGGTGGGAGCTAAGCTGG + Exonic
1144137745 17:12314560-12314582 GCTGGTAGTGGGTCTCAGGCAGG + Intergenic
1144422091 17:15107999-15108021 GATGCTGTTGGGTCAGAAGCAGG + Intergenic
1145949676 17:28806432-28806454 GGTGCTGGTGGATCCCAGGAAGG - Intronic
1146721803 17:35129299-35129321 GCTCCTGCTGGGGCCCAGGCAGG - Intronic
1147636730 17:41968499-41968521 GGTGCTGGTGGAGCCCAAGACGG + Exonic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150788702 17:68183078-68183100 GCTGCTGGTGTGAGCCAAGGGGG - Intergenic
1151140191 17:71984206-71984228 CCTGCTGCTGGATCCCAAGGGGG - Intergenic
1151534492 17:74731001-74731023 GGTGCTGGCTGGTACCAAGCAGG - Intronic
1152744736 17:82033481-82033503 CCTCCTGGTGGGCACCAAGCTGG + Exonic
1153874754 18:9359186-9359208 GCTGCTGGTTGGTTGGAAGCTGG + Intronic
1155059647 18:22217419-22217441 TCTGGTGGTGGGTCCCAGGGAGG + Intergenic
1155229283 18:23757366-23757388 GCTGCTGGAGAGCGCCAAGCAGG - Intronic
1159700778 18:71623927-71623949 CCAGCTGCTGTGTCCCAAGCAGG - Intergenic
1160040135 18:75337590-75337612 GCTGCAGGTGGGGCCAAGGCAGG + Intergenic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1160806031 19:992534-992556 GCTGCAGGTGGCTCCCACGTGGG + Intronic
1160912643 19:1481960-1481982 GGGGGTGGTGGGTCCCATGCAGG + Exonic
1160946017 19:1644419-1644441 GGAGCTGGGGGGTCCCAGGCTGG + Intronic
1161001952 19:1915037-1915059 GCTGCTGGAGGCTCCCAGGCAGG - Intronic
1161390686 19:4018904-4018926 ATGGCTGGTGGGGCCCAAGCAGG + Intronic
1162475953 19:10899444-10899466 GCTGTGGGTGGGTCCCAGGAAGG - Intronic
1163156504 19:15442660-15442682 GCAGCTGGTGAGTGCCATGCTGG - Intronic
1163799734 19:19357122-19357144 GCTGCTTGGGGCTCCCAGGCTGG + Exonic
1164156617 19:22601289-22601311 GCTGAGGGCGGGTCCCAAGGGGG + Intergenic
1165160517 19:33813048-33813070 GAGGCTGGAGGGTCCAAAGCTGG + Exonic
1165383153 19:35495135-35495157 GCTGGTGGTAGGTTCCGAGCAGG + Intronic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1166717385 19:44977258-44977280 GCTGCAGATGGGTGCCAGGCAGG + Intronic
1167468851 19:49664484-49664506 ACTGATGGTGGGGCGCAAGCAGG - Intronic
927213337 2:20651728-20651750 GCTGCACTTGGGTCCCCAGCTGG + Intergenic
928100528 2:28434795-28434817 GCTGCCGATGGGGCCCAGGCAGG + Intergenic
928181256 2:29070623-29070645 GGTGCTGGTGGGGTCCAAGGTGG + Exonic
929044308 2:37775464-37775486 GCTGCTGGTGGGGCCCAGGTGGG - Intergenic
929123161 2:38500008-38500030 GCTGCTGGCGGATCACATGCCGG - Intergenic
929503744 2:42511903-42511925 GCTGCTGGGGAGTCTGAAGCAGG + Intronic
931166434 2:59754207-59754229 GCTTTTGCTGGGTCCCATGCCGG - Intergenic
931908126 2:66864974-66864996 GCTGTTGGTTGATCCCAAGGAGG + Intergenic
935826546 2:106957046-106957068 GCTGATGGTGGTTTCCAGGCAGG + Intergenic
936075883 2:109401626-109401648 GCTGCTGCTGTGTCCCAAGAGGG + Intronic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
944840360 2:203618316-203618338 TGTGCTGGTGGGTCCCACACAGG + Intergenic
948486873 2:238287078-238287100 GCTGCTGCTGGCTCCCAGTCTGG - Intronic
948942200 2:241202241-241202263 GCAGCTGGTGGATCCCAAGCAGG - Exonic
1170053800 20:12176529-12176551 GATGCAGGTGGGGCCCAAGGTGG + Intergenic
1171439144 20:25147257-25147279 GGTCCTGGGGGGTCCCCAGCAGG + Intergenic
1172027153 20:31956454-31956476 GCTGCTGGAGGGTGCTGAGCAGG + Intergenic
1172178367 20:32986112-32986134 GAGGCTGGGAGGTCCCAAGCAGG - Intronic
1172617329 20:36297959-36297981 GTTGCTGGTGGATCCCAAAGTGG - Intergenic
1173949523 20:46979190-46979212 GCAGATGGAGGGTCCCAGGCGGG - Intronic
1174884426 20:54316491-54316513 GCTCCAGGATGGTCCCAAGCTGG - Intergenic
1175755150 20:61524990-61525012 CCAGCTGGTGGGTCCCACACAGG - Intronic
1176065676 20:63193259-63193281 GCTTCTGGTGGGTTACAGGCTGG - Intergenic
1177107525 21:16978616-16978638 GCTCATGGTAGGTCCCATGCTGG - Intergenic
1178200359 21:30396262-30396284 GCAGCTGGTGGGCTCCCAGCAGG - Exonic
1178920346 21:36734648-36734670 CCTGCAGGTGGTTCCCACGCTGG - Intronic
1181173538 22:21023410-21023432 GTTGCTGGTGGGTCCCAAGTTGG + Exonic
1182351429 22:29702245-29702267 GCTGCTGAGGTGTCCCAGGCAGG + Intergenic
1183481439 22:38067730-38067752 GCTGCAGGCGGACCCCAAGCAGG + Exonic
1184807764 22:46806797-46806819 GTGGCTGGTGGGTCCCACCCAGG + Intronic
950564830 3:13762457-13762479 GCTCCTGGTGGGTTCCACCCTGG + Intergenic
952095372 3:29945240-29945262 CCTGCTGGTGGTTTTCAAGCAGG + Intronic
954428516 3:50456594-50456616 GTTCCTGGTGGGTCCTAAGCAGG - Intronic
956175424 3:66468715-66468737 TTTTCTGGTGAGTCCCAAGCAGG - Intronic
960845062 3:121997367-121997389 GATGCTTCTGGGTCCCAACCAGG + Intronic
961073599 3:123961399-123961421 CCTGCCGGTGGGTGACAAGCCGG - Exonic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968248685 3:197183818-197183840 CCTGCAGGTGGTTGCCAAGCAGG + Intronic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
969050884 4:4372121-4372143 TGTGCTGTTGGGTCCCAAACTGG + Intronic
969458329 4:7313778-7313800 GCTGCTGGAGGGTTCTGAGCAGG - Intronic
969534183 4:7745926-7745948 GCTCCGGGGGGGTCCCAGGCTGG + Intergenic
972683136 4:41326160-41326182 GCTGTTTGGGGGTCCCAAGGAGG - Intergenic
974814037 4:66982477-66982499 GCTTCTGGTGGGTCCCCCTCTGG + Intergenic
983309743 4:166044167-166044189 GCAGGTGGTAGGTCCCAACCAGG + Intronic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
985872552 5:2568865-2568887 GCTGATGGTGTGGCCCATGCAGG + Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
987264940 5:16243505-16243527 GCTGTTGGTGGGTGCCAGGTGGG + Intergenic
989617215 5:43349040-43349062 TCTGGTGGTGGCTCCCAAGATGG - Intergenic
992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG + Intronic
995033402 5:107506120-107506142 GGAGCTGGTGAGTCCTAAGCTGG - Intronic
1001245219 5:170101055-170101077 GATGCTGGTGGTTCACCAGCTGG - Intergenic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1002017214 5:176334518-176334540 GCTACTGGGGGGTTGCAAGCTGG - Intronic
1002063923 5:176642885-176642907 GGTGCTGGTGGGTTAAAAGCTGG + Intronic
1002885390 6:1289375-1289397 GTGCCTGGTGGGACCCAAGCTGG - Intergenic
1003855442 6:10268955-10268977 GCTGCTGCTCTTTCCCAAGCAGG + Intergenic
1003961535 6:11213535-11213557 GCTTCTGATTGGTCCCATGCAGG - Exonic
1007712012 6:43830551-43830573 GCTGCTCTGCGGTCCCAAGCTGG - Intergenic
1007826639 6:44605823-44605845 CCTGCTGGAGAGGCCCAAGCTGG - Intergenic
1008053417 6:46922771-46922793 GCTTCGGGTGAGTCCCATGCAGG + Intronic
1011254398 6:85405926-85405948 GCTGAAGGTGGTTCCTAAGCTGG - Intergenic
1012120073 6:95355075-95355097 GTGGCTGGTGGCTCCCAAGATGG - Intergenic
1013637097 6:112039259-112039281 GCTGCTCGTGGGCGCCAAGAAGG - Intergenic
1015565404 6:134564921-134564943 GCTGTTGGTGTCTCCCCAGCTGG - Intergenic
1018060844 6:160088482-160088504 GCTGCTCGAGGGTCCCAGCCAGG - Intronic
1019069657 6:169333232-169333254 GCTGCTGGTGGGTAGAAAACAGG - Intergenic
1019601051 7:1884005-1884027 GATGCTGGGGAGTCCCCAGCTGG - Intronic
1023797745 7:43807923-43807945 GCTGCTGCTGGAGCCCACGCAGG + Intergenic
1023856261 7:44185978-44186000 GCTCCAGGTGGCCCCCAAGCAGG - Intronic
1024417271 7:49121337-49121359 GCTGCAGCTGGGTACCAAGCAGG - Intergenic
1024954313 7:54900484-54900506 GCTTCTGGTGGGTTCTATGCAGG + Intergenic
1029419780 7:100466694-100466716 ACTGCTGGGGGGTCCCAGGAGGG + Exonic
1033476790 7:141700782-141700804 GCTGATGATGGGTTCCAGGCCGG - Intronic
1034441904 7:151089957-151089979 ACTGCAGGTGAGTGCCAAGCCGG - Intronic
1034817247 7:154183101-154183123 GCTGTTGTTGAGTCCCCAGCTGG + Intronic
1035817981 8:2561768-2561790 CCTGCTCCTGGCTCCCAAGCTGG + Intergenic
1037584758 8:20268768-20268790 GCTGCTGGTGGGTTGGGAGCAGG + Intronic
1046850001 8:118961436-118961458 GCTGTGGGTGGGTGCCAAGATGG + Intergenic
1049651895 8:143773664-143773686 TCTGGGGGTGGGTCCCTAGCTGG - Intergenic
1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG + Exonic
1050081511 9:1920566-1920588 GCTGCTGGTCTGACCCCAGCAGG - Intergenic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1052242520 9:26291642-26291664 GCCCATGGTGGGTCCCAAGCAGG - Intergenic
1059336988 9:113575151-113575173 GGTGGTGGTGGGTCTCCAGCAGG + Intronic
1059558059 9:115301198-115301220 CCCGCTGCTGGATCCCAAGCTGG + Intronic
1060435995 9:123593744-123593766 ACTGTTGCTGGGTTCCAAGCAGG + Intronic
1061037111 9:128120116-128120138 GCCTCTGGAGGGTCCCTAGCAGG + Intergenic
1061212391 9:129201394-129201416 CCTGCTGCTGGGTGCCAACCAGG - Intergenic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061574345 9:131496798-131496820 GCTGCTGGTGGCTCCCAGGTTGG + Exonic
1061940260 9:133880173-133880195 GCTGCTCGTGAGTGCCAAGTGGG - Intronic
1062209434 9:135355826-135355848 GCAGCTGGTGGGCCCCAGGTGGG - Intergenic
1186448996 X:9656416-9656438 GCTGCTGGCTGGTCCCCAGGGGG + Intronic
1192552100 X:72062720-72062742 GGTGCTGGTCGATCCCAAGGGGG + Intergenic
1192728437 X:73777728-73777750 GCTGTTGCTGGGTGCCCAGCAGG + Intergenic
1193517012 X:82478392-82478414 ACTCCTGGTGGGACCCCAGCTGG + Intergenic
1199270016 X:145872533-145872555 GATGCTAGTGGGTGCCAGGCTGG + Intergenic
1199679070 X:150213138-150213160 GCAGGGGGTGGGCCCCAAGCTGG + Intergenic
1199980964 X:152920282-152920304 GCATCTGATGGGTGCCAAGCTGG - Intronic
1200213632 X:154357842-154357864 GCTGAGGATGGGTGCCAAGCTGG - Intronic