ID: 1106010789

View in Genome Browser
Species Human (GRCh38)
Location 13:25820116-25820138
Sequence CAGGTACAACCCGCCGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106010787_1106010789 -9 Left 1106010787 13:25820102-25820124 CCTGAGAGTGGCGGCAGGTACAA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1106010789 13:25820116-25820138 CAGGTACAACCCGCCGAGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106010789 Original CRISPR CAGGTACAACCCGCCGAGGT TGG Intronic
900168354 1:1254098-1254120 CAGGTGCATCGCGTCGAGGTGGG - Intronic
1067449241 10:46371199-46371221 AAGGTACAGCCGGCTGAGGTCGG + Exonic
1067588129 10:47489566-47489588 AAGGTACAGCCGGCTGAGGTCGG - Exonic
1067635254 10:47997657-47997679 AAGGTACAGCCGGCTGAGGTCGG - Intergenic
1073725673 10:106227319-106227341 CAGGCACAACCCACCGTGCTGGG + Intergenic
1089306960 11:117532482-117532504 GATGTACAGCCCGCCGTGGTAGG + Exonic
1096462671 12:51830929-51830951 CAGGTACATGCCACCGAGCTTGG + Intergenic
1102843574 12:116152992-116153014 CAGGTAGAACACGCCCAGGTAGG + Intronic
1106010789 13:25820116-25820138 CAGGTACAACCCGCCGAGGTTGG + Intronic
1110532212 13:76610476-76610498 CAGGTATAACAAGCAGAGGTAGG + Intergenic
1128143039 15:65315697-65315719 CAGGTCCAACCCTCCAAGCTCGG - Intergenic
1150640977 17:66949249-66949271 CAGAGAAAACCCGCCGAGGCTGG + Intergenic
1156350533 18:36297998-36298020 AAGGTACGACCCGGCGGGGTGGG + Exonic
1160798269 19:955514-955536 CATGTACAGCCAGCCAAGGTTGG - Intronic
1163370643 19:16899455-16899477 GAGGTACCACCAGCCGGGGTTGG - Exonic
1163472294 19:17504706-17504728 CAGGTACAGCTCGGCCAGGTGGG - Exonic
1165100266 19:33434934-33434956 CAGGTACAAACCCCTGAGGACGG + Intronic
925125070 2:1448481-1448503 CAGAAACAACCCTGCGAGGTGGG - Intronic
936152020 2:110027257-110027279 CAGGCACAGCCCCCTGAGGTAGG + Intergenic
936192658 2:110344156-110344178 CAGGCACAGCCCCCTGAGGTAGG - Intergenic
1176099666 20:63359183-63359205 CAGGGACAACCGGCCGGGGCAGG - Intronic
1176360021 21:5987424-5987446 CATGTACAAGCGCCCGAGGTGGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179439431 21:41382681-41382703 CAGGTAAGACCTGCCCAGGTGGG + Intronic
1179763497 21:43551126-43551148 CATGTACAAGCGCCCGAGGTGGG - Intronic
1181902841 22:26169850-26169872 CAGGCACCACCCGCCGGGATGGG + Intronic
1184716349 22:46284288-46284310 CAGGTACACCCTGCGGAGTTGGG - Intronic
950282059 3:11716725-11716747 CAGATACAAACTGCCAAGGTAGG - Intronic
950372156 3:12540206-12540228 CAGGCACAACCCCCTGAGGGCGG - Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
969571332 4:8010399-8010421 CAGGAAGGACACGCCGAGGTGGG + Intronic
985677483 5:1239545-1239567 AAGTTACAACTCGCCCAGGTAGG + Exonic
985764665 5:1770555-1770577 CAGGCACCACCCGGCGAGGTGGG - Intergenic
986172692 5:5326867-5326889 CTGGGACATCCCGCAGAGGTGGG + Intergenic
1003567293 6:7231593-7231615 CAGGTCCACCCCGCCGCTGTTGG - Exonic
1003590473 6:7432770-7432792 CAGGGAGAGCCCGCCGAGGCTGG - Intergenic
1003743093 6:8965455-8965477 CAGGTACAAACCGCCGCGCCTGG + Intergenic
1006425158 6:33959024-33959046 CAGGTACAGGCAGCCGAGGAAGG + Intergenic
1034495992 7:151422739-151422761 CAGGTACAACACACTGAGGCAGG - Intergenic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1057023509 9:91718779-91718801 CAGCTACAACCCTCCCAGGATGG - Intronic
1195705137 X:107732985-107733007 CAGCTACTCCCGGCCGAGGTGGG + Intronic