ID: 1106016963

View in Genome Browser
Species Human (GRCh38)
Location 13:25878795-25878817
Sequence CAGAGTGAGTGGAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106016963_1106016970 15 Left 1106016963 13:25878795-25878817 CCCAGCACCTTCCACTCACTCTG 0: 1
1: 0
2: 5
3: 17
4: 353
Right 1106016970 13:25878833-25878855 ATCACCACTTCCCCAGGCACAGG 0: 1
1: 0
2: 1
3: 28
4: 284
1106016963_1106016968 9 Left 1106016963 13:25878795-25878817 CCCAGCACCTTCCACTCACTCTG 0: 1
1: 0
2: 5
3: 17
4: 353
Right 1106016968 13:25878827-25878849 ACGTCCATCACCACTTCCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106016963 Original CRISPR CAGAGTGAGTGGAAGGTGCT GGG (reversed) Intronic
901039188 1:6354084-6354106 TAGCATGAGTGGCAGGTGCTGGG + Intronic
901744346 1:11362745-11362767 AAGAGTGAGCGGAGGGTGCGAGG + Intergenic
902292105 1:15442298-15442320 CAGGGTGAGGGGAAGGGCCTGGG - Intronic
902777555 1:18684431-18684453 CAGACTGAGAGGCAGGGGCTTGG - Intronic
903070658 1:20725598-20725620 AAGAGTGAGTGGAATGTGCTAGG + Intronic
903341636 1:22658631-22658653 CAGACTCTGTGCAAGGTGCTGGG - Intronic
904082971 1:27883586-27883608 CAGAGTGAGTGGAGGAAGATGGG - Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
905325404 1:37148258-37148280 CACAGTGAGTTGAGGGTGCCTGG - Intergenic
906714093 1:47954238-47954260 CAGTCAGAGTGGAAGGTGGTAGG - Intronic
906961473 1:50421718-50421740 CAGACTGGGGTGAAGGTGCTAGG - Intronic
909030319 1:70531502-70531524 CAGATTGAGTGGGAGGTGGGAGG + Intergenic
909381465 1:75003742-75003764 GAGTGAGAGAGGAAGGTGCTAGG - Intergenic
909520906 1:76566554-76566576 CAGAGTCATTGGAAGGGTCTTGG - Intronic
909552048 1:76908663-76908685 TGAAGGGAGTGGAAGGTGCTAGG - Intronic
912033265 1:105276636-105276658 AACAGTGAGAGGAAGGTACTAGG + Intergenic
913110883 1:115656132-115656154 GACAGTGGGTGGAAGGTTCTTGG + Intronic
913479521 1:119274149-119274171 CACAGTGAGTGGAATATGCTTGG - Intergenic
915460843 1:156069901-156069923 CAGACTGAGTGGGAGGCACTGGG - Intronic
917930829 1:179821464-179821486 CAGAATGTGTGGCAGGTTCTGGG - Intergenic
918469528 1:184857151-184857173 CAGATAGAGTGCAAGGTGATGGG + Intronic
919880010 1:201895046-201895068 CAGGATGAGTGGGAGGTGCTGGG + Intergenic
921098890 1:211911343-211911365 CACACTGAATGGAGGGTGCTAGG + Intergenic
923280622 1:232439592-232439614 AAGAGTGAGTAGAAAGGGCTTGG - Intronic
924433795 1:244020788-244020810 AAGAGAGAGTGGGAGGTCCTAGG - Intergenic
924540215 1:244973410-244973432 CAGAGTGCTTGGAACGTGGTAGG + Intronic
924686299 1:246294233-246294255 CTGAGTGAGTGCTATGTGCTGGG - Intronic
924795109 1:247287371-247287393 GAGAGGGAGAGGAAGGGGCTGGG - Intergenic
1062799871 10:371156-371178 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1062799877 10:371174-371196 CAGGGTGAGGGGATGGTGCAGGG - Intronic
1063504176 10:6580687-6580709 CAGATTGGGTGGAAAGAGCTGGG + Intergenic
1063528915 10:6811278-6811300 CAGAAGAAGTGGGAGGTGCTGGG - Intergenic
1063725467 10:8632832-8632854 CTTAGGGAGTGGAAGGAGCTAGG + Intergenic
1067030054 10:42873864-42873886 TAGAGTGAGTGGATGATGATGGG + Intergenic
1067501055 10:46805762-46805784 CAGAGGGAGTGGGAAGTGGTGGG + Intergenic
1067593526 10:47534153-47534175 CAGAGGGAGTGGGAAGTGGTGGG - Intronic
1067640635 10:48042257-48042279 CAGAGGGAGTGGGAAGTGGTGGG - Intergenic
1067686928 10:48471279-48471301 CAGAGTGACTGCTTGGTGCTGGG - Intronic
1068208842 10:53893797-53893819 CAGAGTGGGAGGAAGGTGAGGGG + Intronic
1069334038 10:67327747-67327769 CATAGTGGGTGGCAGGTGCCAGG + Intronic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1070137598 10:73708286-73708308 CAGAGGGAGTGGGAAGTGGTGGG - Intergenic
1070566229 10:77605641-77605663 CAGAGTGTGGGGAGGCTGCTCGG - Intronic
1071090580 10:81913393-81913415 CTGAGTGAGAGTATGGTGCTGGG - Intronic
1072139081 10:92573958-92573980 AGGACTGAGCGGAAGGTGCTGGG + Exonic
1072464988 10:95655305-95655327 GAGAATGCGTGGAAAGTGCTTGG + Intronic
1073445857 10:103579987-103580009 AAGAGTCAGTGGAAGGGGCAAGG - Intronic
1075560387 10:123463974-123463996 CAGAGTGTGTGGAATGTGCTCGG + Intergenic
1075583932 10:123643696-123643718 GAGAGTGAGTGGTGGGTGGTGGG - Intergenic
1076710012 10:132327899-132327921 CAGAAAGAGGGAAAGGTGCTTGG + Intronic
1076920883 10:133454185-133454207 CAGAGTGGGTGGGACATGCTGGG + Intergenic
1078147636 11:8732601-8732623 AATAGTGTCTGGAAGGTGCTCGG + Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078930594 11:15909587-15909609 GAGACTGAGTGAGAGGTGCTGGG + Intergenic
1079292731 11:19202860-19202882 CAACATGAGTGGAAGGGGCTTGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1082742855 11:56930143-56930165 CATAGTGGGGGAAAGGTGCTAGG + Intergenic
1082994001 11:59234218-59234240 CAGAGTTGGTGCATGGTGCTGGG - Intergenic
1083654814 11:64224501-64224523 CAGAGTGGGTGGGAGTAGCTAGG + Intronic
1083966590 11:66047438-66047460 CAGAGAGAGTGACAGGTGCCTGG + Intronic
1086756750 11:90573380-90573402 GAGACATAGTGGAAGGTGCTTGG - Intergenic
1088125795 11:106422086-106422108 CAGAGTCTGTTGAATGTGCTGGG + Intergenic
1088775638 11:113079723-113079745 CTGATTGAGTTGAAGGTGCTAGG - Intronic
1088882947 11:113986086-113986108 CAGGGAGAGTGGGAGTTGCTGGG + Exonic
1089135444 11:116245526-116245548 CAGAACAGGTGGAAGGTGCTTGG - Intergenic
1089357447 11:117863184-117863206 AAGAAAGAGTGGAAGGTGCATGG - Intronic
1089603963 11:119630888-119630910 CAGTGTGAGTAGGAGATGCTGGG + Intronic
1089776419 11:120840029-120840051 CAGAGAGAGCGGAGGCTGCTCGG + Intronic
1089818729 11:121201505-121201527 CAGTGTGCGTGGAATGTTCTAGG + Intergenic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090313600 11:125765185-125765207 CACAATGAGTGGAAGGAACTAGG + Intergenic
1090384823 11:126351459-126351481 CACAGTGAGAGGAAGGGCCTAGG - Intergenic
1091201624 11:133785000-133785022 CAAGGTTATTGGAAGGTGCTAGG - Intergenic
1093517340 12:20004127-20004149 CAGCGAGAGTGGAAGCTGCAGGG - Intergenic
1093757953 12:22873833-22873855 GAGATTAAGTGGAAGGTTCTAGG + Intergenic
1097610497 12:61814212-61814234 CAGAGGGAGTAAAAAGTGCTAGG + Intronic
1098828234 12:75326925-75326947 CAGAGAGAGGTGAAGATGCTAGG + Intronic
1100319485 12:93476541-93476563 CAGAGTGAGTAAAAGGCGCAAGG - Intronic
1101732851 12:107440785-107440807 GAAAGTGAGTGGAAGGGGCGAGG + Intronic
1102524966 12:113505979-113506001 CAGAGAGAGTGGGAGGTGGTTGG - Intergenic
1104437739 12:128769219-128769241 CTGAGGGAGTGGGAGATGCTCGG - Intergenic
1104840505 12:131822641-131822663 GAGAGTGAGTGTAAGGTGTATGG + Intergenic
1105760680 13:23511556-23511578 CAGAGTGAGAGGAAGAGGGTGGG - Intergenic
1106016963 13:25878795-25878817 CAGAGTGAGTGGAAGGTGCTGGG - Intronic
1106402831 13:29445944-29445966 CAGAGGGAGAGGAAGAGGCTGGG - Intronic
1106478988 13:30122972-30122994 CAGTGTGAGTGCAGGGTGCGTGG - Intergenic
1107272262 13:38633962-38633984 CAGAAAAAGTGCAAGGTGCTGGG - Intergenic
1107402811 13:40085890-40085912 CATGGTGAGTGGACTGTGCTGGG + Intergenic
1111540219 13:89659229-89659251 CAGAGTGTGTGTATGGTGTTGGG - Intergenic
1113505964 13:110816091-110816113 CAGAGTGAATGGCAGATGATGGG - Intergenic
1113937538 13:114002291-114002313 CGGAGGGTGTGGAAGCTGCTGGG + Intronic
1114135258 14:19840864-19840886 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1114591412 14:23868260-23868282 GAGAATGGGTGGAAGGTGATGGG + Intergenic
1114774552 14:25466421-25466443 CTTAGTGTGTGCAAGGTGCTGGG + Intergenic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1118693839 14:68364533-68364555 AAAAGAGAGTGGAAGGGGCTGGG - Intronic
1119740649 14:77011923-77011945 CAGGGTGAGAGTCAGGTGCTGGG - Intergenic
1119865368 14:77968735-77968757 AATAGTGAGTGGATGGTGCCAGG - Intergenic
1121697549 14:95926096-95926118 CAGGATGAGTAGAAAGTGCTTGG - Intergenic
1122199659 14:100114713-100114735 CAGAGTGAGCTGTAGGTGATGGG + Intronic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122594363 14:102879012-102879034 CCCAGTGAGTGGAGGGTGATGGG + Intronic
1122843045 14:104476033-104476055 CAGCCTCAGTGGCAGGTGCTGGG + Intronic
1124014202 15:25862554-25862576 CACAGTGATTGGCAGGGGCTGGG - Intronic
1125033640 15:35098061-35098083 CAGATTGAATGCTAGGTGCTTGG + Intergenic
1126825500 15:52543934-52543956 CAAAGTTAGTGAAAGGGGCTGGG - Intergenic
1126922902 15:53547484-53547506 CAGAGCATGTGGGAGGTGCTGGG + Intronic
1127917403 15:63466663-63466685 CTGAGAGAGAGGAAGATGCTGGG - Intergenic
1128090355 15:64915007-64915029 AAGAGTGATTGGAAGAGGCTGGG + Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128563951 15:68686949-68686971 ATGAGTGAGTGCAAAGTGCTAGG - Intronic
1129154355 15:73708698-73708720 GAGTGTGACTGGAAGGTGGTGGG + Intronic
1131176122 15:90210843-90210865 AGGAGTGAGTGGAAGGTGAGAGG + Intronic
1131433564 15:92405531-92405553 AAGAGTGCCTGGCAGGTGCTCGG + Intronic
1132663558 16:1071927-1071949 CAGAGTCAGGGGAGGGGGCTGGG + Intergenic
1134058462 16:11184530-11184552 CAGAGCCTGTGGCAGGTGCTAGG - Intergenic
1134416841 16:14050917-14050939 CAGTGAGAGTGTAAGGTGCCAGG - Intergenic
1135382992 16:22008991-22009013 CAGGGTGAATGGTGGGTGCTGGG + Intronic
1136096748 16:27962442-27962464 CAGAGAGAGTGGCAGGGGCCAGG + Intronic
1136409408 16:30067381-30067403 CAGAATGGGTGGAGGGTGCAGGG + Intronic
1137873513 16:51973291-51973313 CTGAGCTGGTGGAAGGTGCTGGG - Intergenic
1138185036 16:54970346-54970368 CACAGTGAGTGATGGGTGCTGGG + Intergenic
1138247487 16:55478662-55478684 CAGAGACAGTGGAAGGTCCCAGG - Intronic
1140474854 16:75234766-75234788 CAAAGTGAGAGGAGGGTGCAGGG + Intronic
1140541248 16:75758409-75758431 CAGGCTGAGTGGACAGTGCTTGG + Intronic
1141590155 16:85063084-85063106 CAGAGTGAGAGGAAGCAGATGGG - Intronic
1141715419 16:85724254-85724276 CAGAGGGATGGGGAGGTGCTGGG - Intronic
1142159014 16:88547424-88547446 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142159023 16:88547448-88547470 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142159039 16:88547496-88547518 CAGAGGGTGGGGAAGGTGCGGGG + Intergenic
1142210428 16:88805923-88805945 CAGGGTGGGTGTGAGGTGCTGGG + Intronic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142688929 17:1593120-1593142 CAGAGAGGGTGGAAGGAGCCTGG + Intronic
1143107533 17:4537045-4537067 CAGAGTTGGTGGGATGTGCTGGG - Intronic
1143122232 17:4615713-4615735 CAGAGTGGGTGGAGAGAGCTGGG - Intergenic
1143595591 17:7911846-7911868 CAGTGTGGGAGGAAGGTACTTGG - Exonic
1143729470 17:8872894-8872916 CAGAGTGAGAGGCACGTGCCAGG - Intergenic
1143832808 17:9665815-9665837 GAGAGAGAGTTGAAGATGCTAGG + Intronic
1144667465 17:17111819-17111841 GAGAGTGAGTGGGCAGTGCTGGG - Intronic
1144952335 17:19000956-19000978 CAGAGTGACAGGCAGGGGCTGGG - Intronic
1145870724 17:28271127-28271149 CAGAGTCATTGGAAGAGGCTGGG - Intergenic
1146461473 17:33049176-33049198 CAGACTGAATGGAATGTCCTAGG + Intronic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1146892213 17:36513573-36513595 CAGAGTGGGTGGGTGATGCTGGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147502197 17:40976317-40976339 CAGTGTCAGTGGAAGCTGCATGG - Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1148084109 17:44984090-44984112 CAGAGGGAGTGGAACGGGGTGGG - Intergenic
1148582100 17:48751355-48751377 CAGAGTGTGGGGAAAGAGCTGGG + Intergenic
1148667089 17:49382901-49382923 CCTAGTGAGTGGGAGGTGATGGG + Intronic
1148770666 17:50064201-50064223 AAAAGTGAGGGGAAGGGGCTGGG + Exonic
1148872879 17:50668892-50668914 CAGAGTGGGGGGCAGGTCCTGGG - Exonic
1148884348 17:50760703-50760725 CAGGGTGAGCTGATGGTGCTAGG - Intergenic
1149661217 17:58334956-58334978 CAGGGTGACTGGAAGGAGCTGGG + Intergenic
1149891002 17:60391006-60391028 CAGAGTGAGTGGTAGGGGGTTGG + Intronic
1149927579 17:60716904-60716926 CAGACTGTGTTGAAGGTGCTGGG + Intronic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151724247 17:75875365-75875387 CAGTGTGAGTGGAGGGGGCACGG + Intronic
1151922131 17:77164736-77164758 CGGAGTGGGAGGAAGTTGCTAGG + Intronic
1151969659 17:77451166-77451188 AAGAGTGAGGGGGAGCTGCTAGG - Intronic
1152405806 17:80097141-80097163 TGGAGTGTGTGGAAGGTGCCTGG + Intronic
1152885242 17:82845553-82845575 CAGACGGAGAGGAAGGGGCTGGG - Intronic
1152966037 18:114709-114731 CAGGCTGAGTGAAAGATGCTAGG - Intergenic
1153223826 18:2883074-2883096 CAGGGACAGTGGAAGGTGCTAGG + Intronic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1154459387 18:14564819-14564841 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1154927932 18:20957346-20957368 CAGGCTGAGTGAAAGATGCTAGG + Intronic
1155056852 18:22192272-22192294 TAGAGTGAGTGGGAGATGCCTGG + Intronic
1155252881 18:23968334-23968356 GAGAGGGAGAGGAAGGAGCTAGG + Intergenic
1157125818 18:44954790-44954812 CAGACTTTGTTGAAGGTGCTTGG + Intronic
1157471966 18:47996184-47996206 CAGAGAGGGTGGGAGGAGCTGGG + Intergenic
1158452462 18:57579387-57579409 CAGAGTGAGAGAAAGTAGCTGGG - Intronic
1159084218 18:63769969-63769991 CAGTGTGAGTGGAAGGGGAAGGG + Intronic
1159212843 18:65349465-65349487 CAGCGTCAGTGGAGGGGGCTGGG - Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1161480958 19:4510481-4510503 CAGAATGAGTTGGAGGGGCTGGG - Exonic
1161868948 19:6855739-6855761 AAGGGTGAGTGGATGGTGGTCGG - Intronic
1162730527 19:12715786-12715808 CAGTGGGAGGGGGAGGTGCTAGG - Intronic
1164670766 19:30070776-30070798 CAGAGGGAGTGGCAGGGGCAGGG - Intergenic
1164697617 19:30258245-30258267 CAGAGTCATTGGAAGTGGCTTGG - Intronic
1164725842 19:30465123-30465145 CAGGGAGAGTGGGAGGTGATGGG - Intronic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165972029 19:39639858-39639880 GAGAGTGGGTGAAAGGGGCTGGG - Intergenic
1166812934 19:45525019-45525041 CAGAGTGACTGGAGGATTCTAGG - Intronic
1166832274 19:45645708-45645730 CAGAGGGATTGGAAGGGGCAGGG + Intergenic
1168365912 19:55787232-55787254 CAGTGTGAATGGAAGCTGATAGG + Intronic
1168522523 19:57063718-57063740 GAGAGGGAGTGGCAGGTTCTAGG - Intergenic
924971529 2:132455-132477 GAGAGTGGATGGAACGTGCTTGG + Intergenic
925862505 2:8193729-8193751 CAGAGAGAGTCAGAGGTGCTTGG - Intergenic
927857235 2:26535346-26535368 GAGATTGAGTGGAAGGGGCATGG + Intronic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
930721437 2:54641838-54641860 CAGTGGGAGTGGAAGGGCCTTGG + Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
931187039 2:59963130-59963152 AAGAGCCAGTGGTAGGTGCTGGG + Intergenic
933592926 2:84252433-84252455 CAGAGCCAGAGGAAGGAGCTCGG - Intergenic
935264776 2:101384889-101384911 AAGAGAGAGGGGAAGGTGCCAGG - Intronic
938006498 2:127791173-127791195 CAGAGTGAGACGCAGTTGCTGGG - Intronic
938128859 2:128693815-128693837 CAGAGTCGGAGGAAGGTGCCAGG + Intergenic
938380128 2:130831901-130831923 CACATTGACTGGAAGGGGCTTGG - Intergenic
939118610 2:138089413-138089435 GAGAATGAGTGGAAGAGGCTTGG - Intergenic
939512711 2:143126686-143126708 CAGAATGAATGTAAAGTGCTTGG + Intronic
939593474 2:144095494-144095516 CAGATTGTGTGGCAGGTGCTAGG - Intronic
941161987 2:162045988-162046010 CAGACAGAGTGGAAGGTGAGAGG + Intronic
942204821 2:173609747-173609769 CCGTTTGAGTGGAAGTTGCTAGG - Intergenic
944346106 2:198667558-198667580 CAGGGTGAGTGGAAGCTACATGG + Intergenic
947900871 2:233720394-233720416 AAGAGTGGGTGGAAGGGACTAGG + Intronic
948268757 2:236657736-236657758 CACAGAGAGTGGAAGAAGCTTGG - Intergenic
1170006039 20:11670221-11670243 CAGAGGGAGTAGAAGGTGCTAGG - Intergenic
1170613400 20:17931538-17931560 GAGAGTGAGTAGAAGCTGCAAGG - Intergenic
1170789063 20:19492862-19492884 CAGGATGCCTGGAAGGTGCTTGG - Intronic
1171159250 20:22906686-22906708 CACAGTGACTGGTAGGTTCTTGG - Intergenic
1171160663 20:22919882-22919904 CAGTCTGAGTGCAAGGTGCCAGG + Intergenic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1173143180 20:40502632-40502654 CAGAGTGAGCGGGCTGTGCTGGG - Intergenic
1173146107 20:40525886-40525908 CAGAGTGAGACCCAGGTGCTGGG - Intergenic
1173988903 20:47284594-47284616 CAGAGTGGCTGGAAGGGGTTGGG - Intronic
1175297290 20:57917559-57917581 CAGAGTCTTTGGAAGGTGATTGG - Intergenic
1175303370 20:57958876-57958898 CAGAGTCAGAGGAATTTGCTGGG - Intergenic
1175505594 20:59482193-59482215 GAGAGAGACTGGAAGATGCTAGG - Intergenic
1175717077 20:61262320-61262342 CTGAGAGAGAGCAAGGTGCTTGG + Intronic
1176814757 21:13588514-13588536 AAGAGTGAGTGGAAAGGGCAGGG - Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1179200159 21:39210392-39210414 CAGAGTGACTGTAGGATGCTTGG - Intronic
1179242512 21:39604691-39604713 CAGAGTGAGCGACAGGTCCTGGG + Intronic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180057582 21:45366921-45366943 GAGAGAGAGCAGAAGGTGCTGGG + Intergenic
1180799313 22:18624416-18624438 CAGAGTGAGTGGGAGCTGCAGGG - Intergenic
1181167903 22:20993129-20993151 CAGAGTCAGTGGAGGGAGCCGGG + Intronic
1181222405 22:21370850-21370872 CAGAGTGAGTGGGAGCTGCAGGG + Intergenic
1181638165 22:24183836-24183858 CAGAGTGAGTGGGAGCTGCAGGG + Intronic
1181717979 22:24748736-24748758 AAGAATGAATGTAAGGTGCTTGG - Intronic
1182304016 22:29355532-29355554 CAGAGTGATTTGAACCTGCTAGG - Intronic
1182384088 22:29921252-29921274 AAGAGAGAGGAGAAGGTGCTAGG + Intronic
1182476694 22:30580435-30580457 AACAGTGTGTGGAAAGTGCTCGG - Intronic
1183620258 22:38967956-38967978 CAGAGTGACCGCAAGCTGCTGGG - Intronic
1183668716 22:39259609-39259631 CAGGGTGGGTGGGAGGTGCGTGG + Intergenic
1183705852 22:39474551-39474573 CAGTGTGCAGGGAAGGTGCTTGG - Intronic
1184099634 22:42335303-42335325 GAGAGAGAGTGGGAGGTGCAGGG - Intronic
1184374377 22:44102540-44102562 CAGAGAGAGGTGAAGGGGCTGGG + Intronic
1184983082 22:48108644-48108666 CAGAGAGAATGGAATGAGCTTGG + Intergenic
1185415949 22:50710340-50710362 GGGAGTGAGAGGAAGGGGCTGGG + Intergenic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
953372387 3:42400211-42400233 CAGAGTCAGTGTAGGGTGGTGGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
955002191 3:54937835-54937857 CAGAGGGTGAGGAAGGAGCTTGG + Intronic
955241379 3:57181546-57181568 GAGAGTGAGTGGATGGGGATGGG - Intergenic
955426477 3:58796233-58796255 CAATGTGAGTGGACAGTGCTGGG - Intronic
955873163 3:63461331-63461353 CAGAGGGAGTAGGAGGAGCTGGG - Intronic
956498150 3:69850933-69850955 CAGAGTGGGTGGCAAGTGATGGG - Intronic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
957700853 3:83709020-83709042 CAGAGTAAGTGTAAGATTCTAGG + Intergenic
959315801 3:104805091-104805113 CAGAGAAAGTGGCAGGTGATGGG + Intergenic
960156997 3:114306242-114306264 CCAGGTGAGTGGATGGTGCTTGG + Intronic
961358908 3:126355720-126355742 ATGAGTGAATGGAAGGTGCGGGG + Intronic
961499778 3:127324029-127324051 CATATTGAGGGGAAGGGGCTGGG - Intergenic
962236376 3:133710875-133710897 AAGAGTGAGTGGAAGGGGAGTGG - Intergenic
968916687 4:3499791-3499813 GACAGTGAGGGGGAGGTGCTGGG + Intronic
969585300 4:8088049-8088071 CGTACTGAGTGGGAGGTGCTGGG - Intronic
969633786 4:8353522-8353544 CCAAGGGAATGGAAGGTGCTAGG + Intergenic
970087106 4:12362142-12362164 GGGACTGAGTGGAAGGTGATTGG - Intergenic
970546081 4:17131767-17131789 CAGAGAATGGGGAAGGTGCTAGG - Intergenic
970602935 4:17654607-17654629 ATGAGTGAGTGGAAAGGGCTTGG - Intronic
970902830 4:21179276-21179298 CAGAGTGAGCAGAAAGTGCAAGG - Intronic
972284049 4:37631323-37631345 CAGGGTGAGGAGAAGGTACTTGG - Intronic
975084909 4:70326952-70326974 AAGAGTCAGTGGAAGCAGCTTGG - Intergenic
977610818 4:99028339-99028361 CAGAGTGCCTGGCATGTGCTAGG - Intronic
977687512 4:99865079-99865101 GAGAGTGAGTGGACAGTGGTGGG - Intronic
979906561 4:126300738-126300760 CAGAGTAGGAGGGAGGTGCTGGG + Intergenic
980995410 4:139775399-139775421 GAGAGTGACTGGGAGCTGCTGGG + Intronic
981347322 4:143691302-143691324 CAGAGTGAGTGTATACTGCTCGG + Intronic
981681996 4:147409862-147409884 TAGAGTGAGAGGAAGGGGCATGG - Intergenic
982416120 4:155134270-155134292 CAGAGTGACAGGAAGCTGCAGGG + Intergenic
983957643 4:173716171-173716193 CAGAGTGGGTGCACTGTGCTTGG - Intergenic
984235374 4:177151194-177151216 CAGAGTCAATGGTAGTTGCTAGG + Intergenic
985361216 4:189177958-189177980 CAGTGTGAGTGGAATGTGTGGGG - Intergenic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985535064 5:460007-460029 CAGAGAGAGTGGAATGGGCAGGG - Intronic
986565047 5:9104728-9104750 CAGAGCGGGTGGAAGGAGCAGGG - Intronic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
993168474 5:84385100-84385122 CAGAGGTGGTGGCAGGTGCTAGG - Intergenic
995122373 5:108549829-108549851 GGGAGTGAGTGGAAGGTGGTGGG + Intergenic
995642147 5:114268964-114268986 CTGAGAGAATGGAAGGTGCACGG + Intergenic
996945779 5:129065913-129065935 CAGAGAGATTAGAAGATGCTAGG + Intergenic
997405981 5:133647153-133647175 CACAGTGAGTGGATAGAGCTGGG - Intergenic
997419900 5:133757665-133757687 AGGAGTGAGTAGAAGGAGCTGGG + Intergenic
998186288 5:139982313-139982335 AGGAGTGAGGGGAATGTGCTTGG - Intronic
998479018 5:142445695-142445717 CCCAGTAAGTGGAAGGTGGTAGG - Intergenic
998990392 5:147808959-147808981 AAGAGTGAATGGAAGGTGAAGGG - Intergenic
999424111 5:151471990-151472012 CAGACTGTGTGGAAGGGGCAGGG - Intronic
999979740 5:156946429-156946451 AAGAGTGAATGGAAGGGGATAGG - Intronic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002476234 5:179467983-179468005 CAGGGTGCGTGAAAGGTTCTGGG + Intergenic
1002528176 5:179826958-179826980 CAGAGTGAGTGGCAGGATTTAGG - Intronic
1003243819 6:4367692-4367714 CAGAGCTGGTTGAAGGTGCTGGG + Intergenic
1004584110 6:16982769-16982791 CACAGTGACTGCATGGTGCTTGG + Intergenic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1007249881 6:40488361-40488383 CAGAGGGAATGGAAGATGGTGGG - Intronic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1007370237 6:41422112-41422134 CAGAGGGAGTGGATGTAGCTGGG - Intergenic
1008230156 6:48976712-48976734 TAGGGTGACTGCAAGGTGCTGGG + Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015480280 6:133700901-133700923 CAGAGTAAGTGGAATGTGTTAGG - Intergenic
1016042170 6:139442537-139442559 AAGAGTGAGGGGAGGGAGCTTGG + Intergenic
1016355815 6:143217217-143217239 CACAGTGATTGGAAGGTGACTGG - Intronic
1017564831 6:155672304-155672326 CATAGTGTGTGGAAGGAGGTGGG + Intergenic
1017693705 6:156992845-156992867 CAGAGTGACAGAGAGGTGCTAGG - Intronic
1018174814 6:161169337-161169359 CAGCGAGAGGGGATGGTGCTGGG + Intronic
1019469801 7:1213139-1213161 CAGAGTGAGGGAAAGGCACTTGG - Intergenic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1023967161 7:44969073-44969095 GGGAGGGAGTGGAAGGTGCAGGG - Intronic
1024666360 7:51550955-51550977 CAGAGTGAGAGGAAGGGGAGAGG + Intergenic
1024797104 7:53033955-53033977 CTGACTGAGTGGAAAGTCCTGGG + Intergenic
1027215189 7:76179031-76179053 CAGGGTGGGAGGAAGCTGCTGGG + Intergenic
1028937758 7:96485428-96485450 CAGAGTGAGTAGGAGGAGTTGGG - Intronic
1029167415 7:98602540-98602562 CAGAGTGCCTGGATGGTGCAGGG - Intergenic
1029506300 7:100965895-100965917 TAGAATGAGTGGGAGGGGCTCGG - Intronic
1034698094 7:153072936-153072958 AGGAGGGAGTGGAGGGTGCTGGG + Intergenic
1034845781 7:154443141-154443163 CAGAGGGAGTGGCAGGTGCCTGG - Intronic
1035146426 7:156821855-156821877 CTTGGTGAGTAGAAGGTGCTGGG - Intronic
1035784603 8:2250773-2250795 CAGGGGGAGTGGCTGGTGCTGGG + Intergenic
1035808204 8:2470940-2470962 CAGGGGGAGTGGCTGGTGCTGGG - Intergenic
1036203899 8:6791447-6791469 CAGGGAGAGTCAAAGGTGCTCGG + Intergenic
1036729911 8:11253606-11253628 CAGAGTGACTGCAAGGGGCCTGG - Intergenic
1037087743 8:14873714-14873736 CAAAATCAGTGGAAGGAGCTGGG - Intronic
1038241213 8:25809265-25809287 CACAGTGAGGGGAAGGGGTTGGG + Intergenic
1040051993 8:43024126-43024148 TAAAGTGAGAGGAAAGTGCTTGG + Exonic
1041169112 8:55123024-55123046 CACAGTAAGTGGAAGGTATTAGG - Intronic
1041775795 8:61521632-61521654 CACAGTGAGTTGCAGATGCTGGG - Intronic
1042039789 8:64579164-64579186 AAGAGTTATTGGAAGGTGTTGGG + Intergenic
1042290246 8:67163377-67163399 TAGGCTGAGAGGAAGGTGCTTGG + Intronic
1042577193 8:70233489-70233511 TAGAGTGAGTGGAAGGGAATAGG - Intronic
1044474524 8:92610649-92610671 CAGGGTGAGTCCAAGTTGCTTGG + Intergenic
1046078715 8:109344020-109344042 TAGAGTATGTGGAAGGAGCTTGG - Exonic
1046183360 8:110681880-110681902 CAGAGACTGTGGAAGGTGATGGG - Intergenic
1047215119 8:122869877-122869899 ATGAGTCTGTGGAAGGTGCTTGG + Intronic
1047336709 8:123943034-123943056 CAGAGAGATTGGTACGTGCTGGG - Intronic
1047354075 8:124103737-124103759 CAGATTGTGTGGTATGTGCTTGG + Intronic
1048522806 8:135172244-135172266 CAGAGAGGGTGGGATGTGCTGGG - Intergenic
1048590189 8:135814148-135814170 GAGGGTGAGTGGAAGGTACAAGG + Intergenic
1049499776 8:142955664-142955686 CAGGGTCCGTGGATGGTGCTAGG + Intergenic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1053472692 9:38358180-38358202 CAGGACCAGTGGAAGGTGCTGGG - Intergenic
1055700300 9:78937663-78937685 CAGAGAGAGTTGGGGGTGCTAGG + Intergenic
1056318447 9:85414371-85414393 CAGAGGGAGAGGAATGAGCTGGG + Intergenic
1056862979 9:90204254-90204276 GAGACTCAGTGGAAGATGCTAGG - Intergenic
1058524197 9:105840683-105840705 CACAATGAGTGGAAGTAGCTGGG - Intergenic
1058566771 9:106294102-106294124 CAGAGTTCGTGGAATGTGATGGG + Intergenic
1059357137 9:113708703-113708725 CAGAGTGAGGGAAAGGTGCTGGG + Intergenic
1059799746 9:117738202-117738224 GACAGTGAGTGGAAGCTACTTGG + Intergenic
1060322172 9:122572518-122572540 CAGGGTGAGTGTATGGGGCTGGG + Intergenic
1060618752 9:125044042-125044064 CAGAGTGGGTGCCAGGAGCTGGG - Intronic
1060662857 9:125414496-125414518 TAGAGGGACAGGAAGGTGCTGGG + Intergenic
1061216430 9:129224532-129224554 CTGAGTGAGGAGAAGGTACTAGG + Intergenic
1061672062 9:132194371-132194393 CTGAGTGGGTAGCAGGTGCTGGG - Intronic
1062101609 9:134731470-134731492 CAGAGGGAGAGGAAGGCGCAGGG - Intronic
1062403113 9:136381062-136381084 CAGTATGAGTGGAAGATGCCGGG - Intronic
1203532602 Un_GL000213v1:160921-160943 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1189467469 X:41288293-41288315 CAGAATGCCTGGGAGGTGCTGGG + Intergenic
1190335562 X:49259644-49259666 CTCAGGGAGTGGAAGGTTCTGGG - Intronic
1190981936 X:55463958-55463980 CCAGGAGAGTGGAAGGTGCTGGG + Intergenic
1190986762 X:55509222-55509244 CCAGGAGAGTGGAAGGTGCTGGG - Intergenic
1192234521 X:69287200-69287222 CAGAGTGGATGGAAAGTGCAAGG + Intergenic
1196679249 X:118454000-118454022 CAATGGGAGTGGAAGGTGGTGGG + Intergenic
1197873586 X:131082567-131082589 CAGAGGTATTGGAAAGTGCTGGG + Intronic
1198278624 X:135120669-135120691 TAAGGTGAGTGGAAGTTGCTGGG + Intergenic
1198292337 X:135251847-135251869 TAAGGTGAGTGGAAGTTGCTGGG - Intronic
1198298254 X:135308094-135308116 TAGGGTAAGTGGAAGTTGCTGGG - Intronic
1201355984 Y:13097427-13097449 GAGAGTCAGTGGAAGGAGATAGG - Intergenic
1202365379 Y:24158652-24158674 AAGTGTGAGTGGAAGTTTCTTGG - Intergenic
1202505402 Y:25511470-25511492 AAGTGTGAGTGGAAGTTTCTTGG + Intergenic