ID: 1106017127

View in Genome Browser
Species Human (GRCh38)
Location 13:25880094-25880116
Sequence GTGCCCAAAACAGTACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106017127_1106017128 -10 Left 1106017127 13:25880094-25880116 CCATGGGGTACTGTTTTGGGCAC 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1106017128 13:25880107-25880129 TTTTGGGCACAGTGACAGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106017127 Original CRISPR GTGCCCAAAACAGTACCCCA TGG (reversed) Intronic
900411459 1:2514564-2514586 CTGCCCCAGACAGTCCCCCACGG - Intronic
904743713 1:32697920-32697942 GTATCAAAAACAGTGCCCCAGGG + Intronic
904805719 1:33130373-33130395 GTGCCCAAAACAGAAGCCACAGG - Intergenic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
908577125 1:65471983-65472005 ATGCCCAAAACACTTCCCCAAGG + Intronic
913250939 1:116911149-116911171 GTGCCCACCATGGTACCCCAGGG + Intronic
913638239 1:120785990-120786012 GGGCGCAAAACAGTGCTCCAGGG - Intergenic
914280209 1:146163972-146163994 GGGCGCAAAACAGTGCTCCAGGG + Intronic
914464354 1:147912868-147912890 ATGCCCAAAACACTAGGCCAGGG - Intergenic
914541254 1:148614911-148614933 GGGCGCAAAACAGTGCTCCAGGG + Intronic
919439001 1:197603337-197603359 GTGCCCGAAACAGTAGACCATGG - Intronic
920786543 1:209047719-209047741 CTGCAGTAAACAGTACCCCATGG - Intergenic
921605138 1:217143018-217143040 GTGCCCAAAACACTACAACATGG - Intergenic
922424586 1:225481081-225481103 GTGCCCCACACAGGGCCCCATGG - Intergenic
923575200 1:235152092-235152114 GTGCCCAAAAATGTACACTATGG + Intronic
1072315090 10:94194567-94194589 GTGCACAAGACAGTAGCCCTGGG + Intronic
1079814535 11:25039252-25039274 GTACCCAAAACCCAACCCCAAGG - Intronic
1080043239 11:27781693-27781715 TTTTCCAAAACATTACCCCAGGG + Intergenic
1080697082 11:34611987-34612009 GTGCCCAAACCAGCCCCACATGG + Intergenic
1089063633 11:115645862-115645884 GTCCCCAAAACAGCAGCCCTGGG - Intergenic
1089371832 11:117966048-117966070 GTGACTAAAACAGTGCCCAAAGG + Intergenic
1096811718 12:54174698-54174720 GAGCCCAGAACAGTCCTCCATGG - Intronic
1101011113 12:100450446-100450468 GTGCCCCAAACAGAAACCTAGGG + Intergenic
1102711825 12:114934647-114934669 TTGCCCAAGACAGTACCTGAAGG + Intergenic
1106017127 13:25880094-25880116 GTGCCCAAAACAGTACCCCATGG - Intronic
1112955779 13:105056487-105056509 GTGAACAAAACAGTAGCCTAGGG + Intergenic
1120865353 14:89291607-89291629 TTGCCAAAGACAGGACCCCAGGG - Intronic
1121304074 14:92894514-92894536 GTGCCCAAGTCACTACCACAAGG + Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126311100 15:47317824-47317846 GTGCCTAAAACACTACACCTGGG - Intronic
1131071856 15:89471112-89471134 GTGCCCAGAGCAGGACCACATGG + Intergenic
1133127816 16:3657587-3657609 GTGCCCAAAACTGCACACCCTGG - Intronic
1133904382 16:10008256-10008278 GTGCCCCAACTAGTACCCCATGG + Intronic
1134028305 16:10971725-10971747 ATGCCCAAAACATTGCCCCAGGG + Intronic
1137055799 16:35746220-35746242 CTGCCCAAAACAAACCCCCATGG - Intergenic
1143411958 17:6714275-6714297 GTGCCCAAAACAGGGCCTCGCGG - Intergenic
1144340403 17:14304950-14304972 GTGGCCTAACCAGTAACCCAGGG + Intronic
1146657012 17:34640490-34640512 GAGCCCAAAGCAGAACCACAGGG + Intergenic
1155100339 18:22604725-22604747 TGGCCCAAAACTGTACCCCTCGG - Intergenic
1159678954 18:71323124-71323146 CTGCCCAAAATAGTATCTCAAGG + Intergenic
1160740484 19:683284-683306 GTGCCCAGAAAAGTGCCCCTAGG + Exonic
1161242327 19:3229285-3229307 TTGCCCAACCCAGTAGCCCAGGG - Intronic
1167764254 19:51469652-51469674 GTGCACAAAAAAGCACCTCAGGG - Intergenic
938191064 2:129281015-129281037 TTGCCCAAAATATTTCCCCAAGG + Intergenic
940371858 2:152911588-152911610 GTAACCAAAACAGTACCATATGG + Intergenic
941175058 2:162186772-162186794 GTGCTAAAAAAAGTCCCCCATGG + Intronic
944112251 2:196145144-196145166 GGGCCCAAAACAGAACTACAGGG + Intronic
944448622 2:199818417-199818439 GTGCCCAACACAGTACTAAAGGG - Exonic
944485119 2:200197346-200197368 GTGCCCAAACCAGAACCCTGGGG - Intergenic
948729300 2:239953042-239953064 GTGCACAGAACAGGGCCCCAAGG + Intronic
1169058290 20:2641693-2641715 GTGTCCTAAACTGTATCCCATGG - Exonic
1169509307 20:6246173-6246195 GTGTCCAAAACAGTACCCACTGG + Intergenic
1171339038 20:24412726-24412748 GTCCCTAAAAGAGAACCCCATGG - Intergenic
1172011561 20:31848826-31848848 GGGCCCCACACAGCACCCCAAGG - Intronic
1172563020 20:35906172-35906194 GTGCCCACTCCAGTGCCCCAAGG - Intronic
1172869903 20:38129558-38129580 GCGCCCACAACAGTTTCCCATGG + Exonic
1178635365 21:34297871-34297893 GTGACAGAAAGAGTACCCCAGGG + Intergenic
1181881947 22:25988212-25988234 GTGCCCCAAACAGTCTCCCTGGG - Intronic
1181924143 22:26344475-26344497 GTCCTCAAAACAGCACTCCAGGG - Intronic
1183142807 22:35959806-35959828 GTCCTCAAAACAGTCCCCCATGG - Intronic
951030818 3:17879952-17879974 CTGCCCAAATCAGTAATCCATGG - Intronic
954691904 3:52400139-52400161 GTCCCCAATACAGTAACCCTGGG + Intronic
961457613 3:127031955-127031977 GTGCCCCAAACACCACCTCAGGG - Intronic
961478325 3:127163028-127163050 GTGCTGAAAACAGGACCCAAGGG + Intergenic
965685794 3:171301019-171301041 GTCCTCAAAATATTACCCCATGG + Intronic
967237910 3:187405611-187405633 GTGCCCAACACTGTTCTCCAGGG + Intergenic
967761277 3:193228666-193228688 CTGCCCTAGACACTACCCCAGGG + Intergenic
968551005 4:1223318-1223340 GTGCCCCCACCAGGACCCCAGGG - Intronic
968673552 4:1864903-1864925 GTGCCCAAAGCATTACCCTGCGG + Intergenic
971502969 4:27336247-27336269 GTCACTAAAACAGTGCCCCAAGG - Intergenic
971596566 4:28536573-28536595 GTCCCCTAAACAGAACCACAGGG + Intergenic
973797733 4:54445758-54445780 GGCCCCACAACATTACCCCAAGG + Intergenic
973851997 4:54970069-54970091 GTGGACAAAACAGTATGCCATGG + Intergenic
977932724 4:102766084-102766106 GTGCCCAAAAAACTACACCTGGG + Intergenic
980874881 4:138651538-138651560 CACCCCAAAACAGAACCCCAGGG - Intergenic
981619960 4:146684453-146684475 AGGCCCAAAACAGGACCACACGG - Intergenic
989288601 5:39733885-39733907 GTGCCCTAAACAGCAGCACAGGG + Intergenic
992066728 5:73116424-73116446 GTTCCCAAAACAGTGCCCTAAGG - Intergenic
994323276 5:98418277-98418299 GGGCCCAAAACAGCATCCAAGGG + Intergenic
996036902 5:118768489-118768511 TTGTCCAAAACAGTACCCTGAGG - Intergenic
997846835 5:137294048-137294070 CTGCCCAAAACAGTAGCCACTGG + Intronic
998881888 5:146653520-146653542 GAGCTCAAAGCAGGACCCCAAGG + Intronic
999116079 5:149164342-149164364 GTGCCCACAAGAATACTCCAGGG + Intronic
999580967 5:153037382-153037404 GTGCCAAACGCAGTTCCCCAGGG - Intergenic
1017517707 6:155172274-155172296 GTGGCCAGAACAGTGGCCCAGGG + Intronic
1017716570 6:157217549-157217571 GTGGGCAAAAAAGTACCCCAAGG + Intergenic
1026466357 7:70658274-70658296 GTGCCCTAGACAGTTCCCCAGGG - Intronic
1030126866 7:106162378-106162400 GTACCCAGAACAATATCCCAAGG + Intergenic
1032736558 7:134697663-134697685 GTCCCCAGAACAATCCCCCAAGG - Intergenic
1033414268 7:141148386-141148408 GGACCTAAAACAGAACCCCAAGG + Intronic
1034353239 7:150430756-150430778 GTCTCCAGAACAGAACCCCAAGG - Intergenic
1050258491 9:3816960-3816982 ATGCCCCCCACAGTACCCCAGGG + Intergenic
1050614452 9:7387707-7387729 CTCCCCAAAACATTACCCAAAGG - Intergenic
1056579517 9:87880733-87880755 GTGCCCACAACAGAACCCTGGGG - Intergenic
1058581657 9:106465233-106465255 GTGCCCAACACAGTGCCCACTGG - Intergenic
1187608714 X:20916221-20916243 GTCCCCAAAAAGGTACCTCAGGG + Intergenic
1191975968 X:66871664-66871686 GTGCCCCAAACATGACCACAGGG + Intergenic
1196277224 X:113780778-113780800 GTGTCCAAAGCACTCCCCCAAGG + Intergenic
1200280803 X:154775424-154775446 GAGCCCAAACAAGCACCCCAGGG - Intronic
1200762864 Y:7055994-7056016 GTGCACCAGACACTACCCCAAGG + Intronic