ID: 1106020448

View in Genome Browser
Species Human (GRCh38)
Location 13:25909796-25909818
Sequence CTGAGTTGGGGGAGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 662}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106020448_1106020461 30 Left 1106020448 13:25909796-25909818 CCCGCCGCCCTCCCCCAACTCAG 0: 1
1: 0
2: 3
3: 74
4: 662
Right 1106020461 13:25909849-25909871 TCTGTGAATTTACCTATTCTAGG 0: 4
1: 30
2: 194
3: 581
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106020448 Original CRISPR CTGAGTTGGGGGAGGGCGGC GGG (reversed) Intronic
900164877 1:1240629-1240651 ATGAGGTGGGGGATGGGGGCTGG - Intergenic
900269298 1:1778822-1778844 GTGAGTTGGGGGCGGGACGCCGG - Intronic
900324433 1:2101318-2101340 CTCAGTAGGGGGAGGCCAGCGGG + Intronic
900416101 1:2535471-2535493 CGGAGCTGGGGGAGGGAGCCTGG + Intergenic
900604112 1:3516227-3516249 CTGAGCTGGCGCAGGGAGGCGGG + Intronic
900623528 1:3598091-3598113 CAGAGATGGGGGAGGGTGGCTGG - Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
901426072 1:9182968-9182990 GTGAGTGGGGGCAGGGCGCCGGG - Intergenic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
901921478 1:12540567-12540589 TGGAGTTGGGGGAGGGTGGAGGG - Intergenic
902372721 1:16016143-16016165 CTGAGTTGCGGGGGAGGGGCCGG - Intronic
902552740 1:17229065-17229087 CAGACTTGGGGGAGGGCTGGAGG - Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
902962002 1:19970452-19970474 CTGAGATGGGGCAGGGCGGAAGG - Intergenic
903185147 1:21624658-21624680 CTGAGGTGGGGGTGGGCTGTCGG + Intronic
903350783 1:22715403-22715425 TTGAGCTGGGGGAGGGAGGGAGG - Intronic
903368283 1:22818260-22818282 CTGAGGTGAGGGAGGGCTGGAGG - Intronic
903839942 1:26231780-26231802 CTAAGTTTGGGGAGGAAGGCAGG + Intergenic
903840186 1:26233633-26233655 CCAAGTTTGGGGAGGGAGGCAGG + Intergenic
903849651 1:26298108-26298130 CTGAGTTGTGGGGGGGAGGGAGG + Intronic
903891329 1:26572318-26572340 CTTATTTGGAGGAGGGAGGCAGG + Intronic
903891486 1:26573182-26573204 GGGGGTTGGGGGAGGGCTGCAGG - Intronic
904608715 1:31713629-31713651 CTGAATTGGGGGTGAGCGGGAGG - Intergenic
904769278 1:32871851-32871873 CTGAGATGAGGGAAGGGGGCTGG - Intronic
904827079 1:33280626-33280648 CCCAGTTCGGGGAGGGCTGCTGG + Intronic
904985099 1:34539216-34539238 CTGGGTGGGGGAAGGGAGGCTGG - Intergenic
905324812 1:37144043-37144065 GAGGGTTGGGGGAGGGGGGCAGG - Intergenic
905464266 1:38140828-38140850 CTGAGACGGGGGAGGACTGCAGG - Intergenic
905665666 1:39761607-39761629 GTGAGTGGGAGGAGGGCGGAGGG - Intronic
905800310 1:40838691-40838713 CTGAGGTGGGGAAGGGGCGCTGG - Exonic
906105358 1:43288658-43288680 CTGAGATGCGGGAGCACGGCTGG + Intergenic
906212489 1:44019877-44019899 CGGGGATGGGGGAGGGCTGCAGG + Intronic
906333920 1:44911848-44911870 GTGGGTTGGGGGAGGGGGGAGGG - Intronic
906544938 1:46613984-46614006 TGGAGGAGGGGGAGGGCGGCAGG + Intronic
906877614 1:49556376-49556398 GTGAGGTGGGGGAAGGGGGCAGG + Intronic
907105480 1:51878725-51878747 CTGGGTTGGGGGAGGGGTTCAGG - Exonic
909217227 1:72904929-72904951 GTGAGGTGGGGGAGGGGGGAGGG + Intergenic
910444049 1:87282714-87282736 AAGAGTTGGGGGAGGGGAGCTGG - Intergenic
911115974 1:94247349-94247371 CTGAGTTGTGTGACGCCGGCGGG - Intronic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912542297 1:110426099-110426121 CTGGGTTGGGGGATGGCAGGGGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
913477577 1:119253107-119253129 CTGAGGTGGGGGTGGGGGGTGGG + Intergenic
914062287 1:144217850-144217872 CTGAGTTGGGTGGGGGAGGCTGG + Intergenic
914116863 1:144748504-144748526 CTGAGTTGGGTGGGGGAGGCTGG - Intergenic
914341690 1:146765467-146765489 CTAAGTTGTGGGAGGGCTGCAGG + Intergenic
914682894 1:149952190-149952212 TGGAGTTGGGGGAGGGGGGAGGG - Intronic
915082440 1:153361236-153361258 CTGAGATGGGGCAGGGAGCCTGG - Intergenic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
915449761 1:155996437-155996459 TTGAGATGGGGGAGGGGAGCTGG + Intronic
915782446 1:158567643-158567665 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915932324 1:160068353-160068375 CTGAGTGGGGGGTGGGGGGATGG + Intronic
916722363 1:167494031-167494053 CTGAGTTGGGTGGGGGAGGCTGG + Intronic
917053564 1:170952600-170952622 TGGAGTTGGGGGAGGGGGGAGGG + Intronic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917797267 1:178541585-178541607 GTGAGGTGGCGGAGGGGGGCAGG - Intronic
918002336 1:180509069-180509091 CTGAGTTGGTGGGGGGAGGTGGG + Intergenic
918248938 1:182684662-182684684 CAGAGTCGGGGGAGGACCGCAGG + Intergenic
918356459 1:183709835-183709857 CTGAGTTGGGGGAATTGGGCTGG + Intronic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918427917 1:184429005-184429027 CTGGGTTGGGGGATGGAGCCAGG - Intronic
919002639 1:191853386-191853408 ATGGGTTGGGGGAGGGGGGAGGG - Intergenic
919322662 1:196062594-196062616 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
919770294 1:201154241-201154263 CGGAGATGGCGGAGGGCGGTGGG - Exonic
919946119 1:202320095-202320117 CTGAGTTGGGGCAGGGAGAAAGG + Intergenic
920027208 1:203007570-203007592 CCGAGGTGGGCGAGGGGGGCAGG + Exonic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920382500 1:205543581-205543603 CAGAGCTGGGGGAGTGGGGCGGG - Intergenic
920452242 1:206068299-206068321 TTGAGTTGGGGTAGGGTGGAGGG + Intronic
920496771 1:206460469-206460491 CTGAGTTGGGGAGGAGGGGCGGG + Intronic
920616309 1:207496142-207496164 CAGAGTGTGGGGAGGGCTGCGGG - Intronic
921472062 1:215561551-215561573 CGGAGTAGGGGGATGGCGGCAGG - Intergenic
922032868 1:221820760-221820782 GTTAGTTGGGGGAGGGAGGAAGG - Intergenic
922086726 1:222355748-222355770 TTGGGTTGGGGGAGGGGGGAGGG + Intergenic
922110161 1:222548241-222548263 ATGGGTTGGGGGAGGGGGGAAGG - Intergenic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922674911 1:227544075-227544097 CTGAGCTGGGGGAGTCAGGCAGG - Intergenic
923055925 1:230426007-230426029 CTGCGCTGGTGGGGGGCGGCGGG - Intergenic
923558726 1:235022140-235022162 CTGACTTGGAGGCGGGCGGCAGG + Intergenic
924112282 1:240711941-240711963 CTGATTTGGAGGAGGGCAGTGGG - Intergenic
924415010 1:243849927-243849949 CTCAGGCGGGGGATGGCGGCGGG - Intronic
924489819 1:244525339-244525361 TGGAGTGGGGGGAGGGGGGCGGG + Intronic
1063332448 10:5175116-5175138 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065887862 10:30094730-30094752 CTAAGTTAGGAGTGGGCGGCTGG - Intronic
1067202986 10:44190346-44190368 CAGGGTTGGGGGAGGGTGGAGGG + Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070158336 10:73850416-73850438 CTGCGGTGGGGGGGGGCGGGCGG - Intronic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070312606 10:75284423-75284445 CTGGGTTGGGGGAAGGGGACTGG + Intergenic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070602254 10:77873972-77873994 GTGAGCTGGAGGAGGGCGGCAGG - Intronic
1071505713 10:86230229-86230251 CTGGGTTGGGGTAGGGTGGGTGG - Intronic
1072426001 10:95331412-95331434 CAGAGTTGAGGGAGGTGGGCAGG + Intronic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1072740295 10:97905084-97905106 ATGGGTTGGGGGAGGGAGACTGG + Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073183452 10:101600895-101600917 CTGAGGTGGGGGTGGGCTGTGGG + Intronic
1073333076 10:102683806-102683828 GGGAGTTGGGGGAGGGCTGGGGG + Intronic
1075106423 10:119542791-119542813 CTGGCTAGGAGGAGGGCGGCGGG - Intergenic
1076677739 10:132156199-132156221 CTGAGCCGAGGGAGGGAGGCGGG - Intronic
1076779657 10:132717239-132717261 CGGGGGTGGGGGAGGGAGGCGGG - Intronic
1076979812 11:198390-198412 CAGAGTTGGGGGAGAGCCCCAGG + Intronic
1076987828 11:252349-252371 CTGAGCTGGGGGAGTGGGACGGG - Intronic
1077077710 11:708921-708943 GGGGGTTGGGGGAGGGCGGGTGG - Intronic
1077394664 11:2315150-2315172 GTGGGCTGGGGGAGGGCTGCCGG - Intronic
1077499432 11:2902502-2902524 CCGGGATGGGGGAGGGCGCCAGG + Exonic
1077505821 11:2929596-2929618 CTGAGATGGGAGGGGACGGCCGG - Intergenic
1078523232 11:12080400-12080422 GTGAGTTGCGGGGGGGCAGCGGG + Intergenic
1078674220 11:13394687-13394709 TGGGGTTGGGGGAGGGCGGAGGG - Intronic
1078718923 11:13865712-13865734 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1079719363 11:23790846-23790868 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1079988789 11:27225569-27225591 GTGGGGTGGGGGAGGGGGGCGGG + Intergenic
1080158529 11:29143215-29143237 CTGACTCGGGGGAGGGGGGAGGG - Intergenic
1081492936 11:43581202-43581224 CTGAGTTGGGGGATCGCGGACGG + Intronic
1081538974 11:44016392-44016414 CTGAGCTGGGGGAGGGGGAATGG + Intergenic
1081585244 11:44379765-44379787 AGGAGTGGGGGGAGGGAGGCTGG + Intergenic
1082627202 11:55500436-55500458 GTGGGTTGGGGTAGGGCGGAGGG + Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082807098 11:57458434-57458456 CTGAGGGGCGGGTGGGCGGCGGG - Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083268085 11:61556249-61556271 CTGGGCTGAGGGAGGGTGGCAGG - Intronic
1083656236 11:64230941-64230963 GTGAGTTGGGCGCGGGGGGCCGG + Intronic
1083664031 11:64265117-64265139 CTGGGTCGGGGGTGGGCTGCAGG + Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083782375 11:64925076-64925098 CTGAGGTGGGGGAGGGTGCCAGG + Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083923672 11:65793523-65793545 CTGGGGTGGGGGTGGGAGGCAGG + Intronic
1084321889 11:68377795-68377817 CAGAGCTGGGGGTGGGCGTCCGG + Intronic
1084422977 11:69069835-69069857 CTGACTGTGGGGAGGGCTGCAGG + Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084477132 11:69395469-69395491 CTGAGTCGGGAGAGGGCAGTCGG + Intergenic
1084560295 11:69901495-69901517 GAGAGTTGGGGGAAGGCGGAAGG - Intergenic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1085020000 11:73200584-73200606 CTGAGTGGGAGCAGGGTGGCTGG + Intergenic
1086107082 11:83157745-83157767 CTGAGTTGGAGGGGGGTGGGGGG - Intronic
1086264326 11:84979655-84979677 GTGGGGTGGGGGAGGGCGGAGGG + Intronic
1086736272 11:90308750-90308772 GTGGGGTGGGGGAGGGGGGCGGG + Intergenic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1087580547 11:100046137-100046159 TGGAGTTGGGGGAGGGGGGAGGG + Intronic
1088001320 11:104884989-104885011 CTAAGTTGGGGGAGGGCATTAGG + Intergenic
1089011104 11:115132488-115132510 CTGAGTTGGGAGGGGCCGGCAGG - Intergenic
1089136822 11:116255824-116255846 CGGGGTCGGGGGAGGGGGGCAGG + Intergenic
1089315677 11:117589407-117589429 TTGAGTTGGGGGAGGTGGGAGGG - Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089505154 11:118957681-118957703 CTGAGATGGGAAAGGGAGGCGGG - Intronic
1090401636 11:126453053-126453075 GTGAGTTGGGGGAGGTGGGTGGG - Intronic
1092849278 12:12612115-12612137 CTGAGCCGGGGGAGGGCTCCGGG + Exonic
1094429415 12:30350321-30350343 GTGGGTGGGGGGGGGGCGGCGGG + Intergenic
1095066089 12:37777382-37777404 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1095386042 12:41651071-41651093 CTGGGTTGGGAGAGGGCTCCTGG + Intergenic
1095916002 12:47479332-47479354 GTGGGTGGGGGGAGGGGGGCAGG + Intergenic
1096675251 12:53222561-53222583 AGGAGTTGGGGGAGGGCTCCAGG + Intronic
1096803879 12:54128443-54128465 CTGGGTTGGGGGTGGGGGGGTGG - Intergenic
1097178331 12:57156460-57156482 CTGAGTGGGTGGATGGGGGCTGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1099713802 12:86264789-86264811 CTGAGATCGGAGAGGGCGCCGGG - Intronic
1100048497 12:90413780-90413802 CTGAGTTGGAGGAGGGTTGGTGG - Intergenic
1100141737 12:91627276-91627298 ATGTGTTGGTGGAGGGCGGGGGG - Intergenic
1101227988 12:102708917-102708939 CTGAGTTGGGGCAGGGTAGGGGG + Intergenic
1102053219 12:109878422-109878444 CTGAGTTGGGGGATGGGGCACGG - Intronic
1102454095 12:113060902-113060924 CTGGGTTGGGTATGGGCGGCAGG + Intronic
1102486418 12:113260753-113260775 CTGAGAAGAGGGAGGGTGGCAGG - Intronic
1102596141 12:113993906-113993928 CTGAGTAGGGGGTGGGAGGGAGG - Intergenic
1102906851 12:116683157-116683179 CTGACTCGGGGGTGGGGGGCGGG - Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103139021 12:118532867-118532889 CTGAGTTGGGGGAGAAAGGGAGG - Intergenic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103443624 12:120980365-120980387 CTGGGGTGGGGGAGGGCTGGTGG + Intronic
1103595579 12:122022675-122022697 CGGGGCTGGCGGAGGGCGGCGGG - Intronic
1103611004 12:122124229-122124251 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1103611019 12:122124263-122124285 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1103611073 12:122124398-122124420 CTGAGGTGGGGGACGGCTGAGGG - Intronic
1103704512 12:122864116-122864138 CTGAGGTGGGGGGGGGGGGGGGG - Intergenic
1103726352 12:122999206-122999228 CTGAGCTGGAGGAGGAAGGCTGG + Intronic
1104052876 12:125208226-125208248 CAGAGTTGGGGAAGGTGGGCAGG + Intronic
1104917243 12:132272074-132272096 CTGAGTTGGGGGAGCCGGGCGGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1107102991 13:36614212-36614234 GTGAGTTGGTGGAGAGCGGAAGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111012716 13:82331806-82331828 TGGAGTCGGGGGAGGGCGGAAGG - Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111659784 13:91194490-91194512 CTGCTTTGGGGGAGGGCCTCAGG - Intergenic
1112505354 13:99971470-99971492 CGGAGTTGGGAGTGGGCGGGCGG + Exonic
1112918944 13:104586328-104586350 TTGAATTGGGGGAGGGGTGCAGG + Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113764718 13:112874197-112874219 CTGGTTTGGGGGAGAGCAGCAGG + Intronic
1113874787 13:113587333-113587355 CTGAGTTGGGGGTTGGCGCTGGG + Intronic
1113882609 13:113636033-113636055 CTGAGTTGGGTGGCGGTGGCCGG - Exonic
1113962958 13:114135424-114135446 CTGAGCTGGAGGTGGGTGGCAGG - Intergenic
1114615323 14:24065122-24065144 CTGAGTCGGGGGAGGGGGTGGGG - Exonic
1114671799 14:24415474-24415496 CTGAGGTGCGGGAGGGCCGCAGG + Exonic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115027205 14:28759252-28759274 CTCAGCTGGGGGAGGGCGCGCGG + Intergenic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1116417816 14:44699511-44699533 CTGAGTTGGGCAGGGGTGGCTGG + Intergenic
1116538548 14:46066539-46066561 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
1117202681 14:53408441-53408463 CTGCTGTGGGGGAGGGAGGCAGG - Intergenic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1117730591 14:58718321-58718343 CTGAACTGGGGGAGAGAGGCAGG - Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1119172900 14:72547993-72548015 GTGAGCAGGGGGAGGGAGGCAGG - Intronic
1119739373 14:77004214-77004236 CTGAGTTGGGGGTTGGGGGAAGG + Intergenic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120847374 14:89138436-89138458 CTGAGTTGGGGAAGGTGGGTAGG + Intronic
1120939537 14:89934057-89934079 ATGAGGTTGGGGAGGGCAGCAGG + Intronic
1121100400 14:91246197-91246219 CTGAGTTGCGGAAGTGTGGCTGG + Intronic
1121331967 14:93055433-93055455 GTGAGGTGGGGGAGGGGGACTGG - Intronic
1121369488 14:93344022-93344044 CTGGGGTGGGGGTGGGTGGCAGG + Intronic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122543778 14:102511295-102511317 CTGAGGTGGGGCAGGGCTGGTGG - Intergenic
1122594091 14:102877222-102877244 ATGAGTTGGGGGAGGGCCTGTGG - Intronic
1122619386 14:103046159-103046181 CTGAGGTGGAGGAGGGCTGGTGG - Intronic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122809564 14:104281336-104281358 GTGAGCAGGGGGAGGGCGGCAGG - Intergenic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122975198 14:105168188-105168210 CTGGGTGGGGGCGGGGCGGCGGG - Intronic
1122979485 14:105185220-105185242 CAGAGTCGGGGGAGGACGGAGGG - Intergenic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124648631 15:31458295-31458317 CTGAGTTGGGGGAGACCCCCAGG - Intergenic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125085199 15:35721737-35721759 CACTGTTGGGGGATGGCGGCAGG + Intergenic
1126350264 15:47738716-47738738 CTAAGTTGTGGGATGGTGGCTGG - Intronic
1126532674 15:49728131-49728153 ATGAGTTGGGGGTGGGAGGCGGG + Intergenic
1127702506 15:61514745-61514767 CTGAGTTGGGGCAGAGGGTCTGG + Intergenic
1127975912 15:63997179-63997201 CAGAGTTGGAGGAGTGGGGCAGG - Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128376659 15:67081370-67081392 CTCAGCTGGGGAAGGGAGGCTGG - Intronic
1129108825 15:73325697-73325719 AGGAGGTGGGTGAGGGCGGCAGG + Intronic
1129465374 15:75721729-75721751 CAGAGGTGGGGGTGGGTGGCAGG + Intergenic
1129655934 15:77525810-77525832 CTGAGTCGGGGGAGGTGGGCAGG + Intergenic
1129792356 15:78349835-78349857 CTGGGCTGGGGGAGGGGGGAAGG - Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1131071682 15:89470141-89470163 CTCTGCTGGGGGAGGGAGGCTGG + Intergenic
1131111646 15:89768198-89768220 CTGAGTAGGGGGAGCACAGCGGG - Intronic
1131266839 15:90920521-90920543 CTGATTTGTGGGATGGTGGCAGG + Exonic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131511317 15:93050974-93050996 CTGAGTATGCGGAGGGCTGCGGG + Intronic
1132422208 15:101680086-101680108 CTGGGTTGGGGGAGGGGGATGGG + Intronic
1132458233 16:35993-36015 CTGAGTTGGGGGGTTGCGGGGGG + Intergenic
1132674713 16:1116933-1116955 CTGAGTTGGGGAGGGTAGGCGGG - Intergenic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1136173373 16:28501946-28501968 CTGGGGTGGTGGAGGGTGGCCGG + Intronic
1136619053 16:31415908-31415930 CTGGGTTGGGCGAGGGCTGGGGG - Intronic
1137621356 16:49878516-49878538 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1137788025 16:51152715-51152737 CGGGGTGGGGGGAGGGCGGTGGG + Intergenic
1137790985 16:51174568-51174590 ATGAGTTTGGAGAGGGAGGCTGG - Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1139754548 16:69132288-69132310 CCGGGAAGGGGGAGGGCGGCGGG - Intronic
1139992588 16:70951975-70951997 CTAAGTTGTGGGAGGGCTGCAGG - Intronic
1140481848 16:75266315-75266337 CTCAGCTGGGGGAGGGCAGAGGG - Intronic
1140815151 16:78614445-78614467 CTGGCTGGGGTGAGGGCGGCAGG + Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1142206331 16:88784878-88784900 GTGAGTGGGGGGCGGGCGCCTGG - Intronic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142671068 17:1487570-1487592 CAGAGGCGGGGGAGGGCGGGAGG + Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143185479 17:5007481-5007503 CTGAGATGGGGGTGGCCGTCCGG + Exonic
1143342386 17:6223084-6223106 CTGAGTTGGGGGGAGGGGGGAGG + Intergenic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1144568733 17:16381354-16381376 CTGAGGGGGGCGAGGGCGGTTGG + Intronic
1145208599 17:20997296-20997318 CTGAGGTGAGGGAGGGCGTGAGG + Intergenic
1145968249 17:28936919-28936941 CTGAGCTGGATGAGGGCCGCAGG - Intronic
1146615404 17:34353140-34353162 ATGAGTTGTGGGAGGAGGGCAGG + Intergenic
1146688899 17:34859637-34859659 CTCAGTTGTGGGAGGGGGACAGG - Intergenic
1146706830 17:35006808-35006830 CAAAGTTGGGGGGGGGCGGTGGG - Exonic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147187928 17:38722655-38722677 CTGAGGTGGGGGTGGGGGGTGGG - Intronic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147429290 17:40361869-40361891 GTGGGGTGGGGGTGGGCGGCGGG - Intronic
1147472316 17:40674519-40674541 CTGAATTGGAGCAGTGCGGCAGG - Intergenic
1147603026 17:41757611-41757633 GTGAGCTGGGGGAGGGCAGGAGG - Intronic
1147629139 17:41918804-41918826 CCGGGTTGGGGGACGGAGGCAGG + Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148075119 17:44931321-44931343 CTGGGTCAGGGCAGGGCGGCTGG - Intronic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1148446843 17:47743087-47743109 CTGTGTTGGGGGAGTCCGGGTGG - Exonic
1148756868 17:49977727-49977749 CTGAGGTGGGGGTGGGGAGCTGG + Intergenic
1148777726 17:50105029-50105051 CTGAGATGGGGCAGGGAGACTGG - Intronic
1148782592 17:50130073-50130095 CGGGGGCGGGGGAGGGCGGCGGG + Intergenic
1149560566 17:57605278-57605300 GTGTGTTGGGGGAGGCCGGGTGG + Intronic
1149768167 17:59297787-59297809 CTGAGTGGGGTGTGGGGGGCGGG + Intergenic
1149772231 17:59331458-59331480 CTGGGCTAGGGGAGAGCGGCTGG - Intergenic
1150313063 17:64145429-64145451 GTGTGTTGGGGGGGGGCGGCGGG + Intergenic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150656688 17:67044250-67044272 CTGAGTTGGGAGAGGGCGAGAGG - Intergenic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151106125 17:71618882-71618904 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
1151546467 17:74796399-74796421 CTGATTTGGAGCAGGGAGGCAGG + Intronic
1152095446 17:78269366-78269388 CAGAGTGGGGGGTGGGGGGCCGG - Intergenic
1152123869 17:78434893-78434915 CTGTGTGGGGGGAGGGCTTCAGG + Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152552055 17:81034938-81034960 CGGAGAAGGGGGAGGGGGGCGGG - Intergenic
1152657818 17:81528089-81528111 CGGGGTTGGAGGAGGGGGGCAGG + Intergenic
1152762191 17:82114605-82114627 GTGACTAGGTGGAGGGCGGCTGG + Intronic
1152775591 17:82199767-82199789 CTGAGTGGAGGGAGGGTGTCTGG - Intronic
1152988759 18:343313-343335 CTCAGGTGGGGGAGGCCGGCCGG + Intronic
1153993898 18:10423191-10423213 CAGAGTCTGTGGAGGGCGGCTGG - Intergenic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154485014 18:14866360-14866382 CTGAGTGGTAGGAGGGGGGCTGG + Intergenic
1154485036 18:14866460-14866482 CTGAGCTGTAGGAGGGTGGCTGG + Intergenic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1155822107 18:30391028-30391050 TTCAGTTGGGGGTGGGCGGAGGG + Intergenic
1156472798 18:37388050-37388072 AGGAGTTGGGGGAGGGGGGAGGG + Intronic
1158495904 18:57954931-57954953 CTGAGTTGGGGCAAGGGGACAGG + Intergenic
1159954967 18:74512767-74512789 CTGAGTTGGGTGCTGGAGGCAGG - Intronic
1160340379 18:78084281-78084303 CTGAGGTGGGAGAGGGCTGCAGG + Intergenic
1160404823 18:78638146-78638168 CTGGGGCTGGGGAGGGCGGCTGG + Intergenic
1160490805 18:79335572-79335594 CAGAGTTGGGGGAGCCCTGCAGG - Intronic
1160708773 19:541261-541283 CGGACCTGGGGGAGGGGGGCCGG + Intronic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161209248 19:3057632-3057654 CAGTGTTGGGGGCGGGCGACAGG - Intronic
1161228542 19:3160266-3160288 ATGAGATGGGAGAGGGAGGCAGG - Intronic
1161740429 19:6017915-6017937 CTGAGTTGGGGGGGTGGGGATGG - Intronic
1161959593 19:7516290-7516312 CTGGGTGGGGGGCGGGCGGGCGG + Intronic
1162013657 19:7832115-7832137 CTGGGAGTGGGGAGGGCGGCGGG - Intronic
1162067624 19:8135938-8135960 GTGAGTTGGGGGTGGGCGGGTGG - Intronic
1162150901 19:8645011-8645033 CTGAGGTGGGGGATGGGGGGAGG - Intergenic
1162315910 19:9937706-9937728 CAGAGGTGGAGGAGGGGGGCGGG + Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162582848 19:11540912-11540934 CATAGTTGGGGGATGGGGGCTGG - Intronic
1162726882 19:12695195-12695217 TTGGGTTGGGGGATGGCGCCTGG - Intronic
1162784196 19:13023948-13023970 GTGAGTTGGGGGCGGGTGGGGGG - Intronic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1163444706 19:17339539-17339561 CTGGGTTGCGGGAGGGCGTGGGG + Exonic
1163519220 19:17781857-17781879 CTGTGTTGGGGGAGTCCAGCAGG + Intronic
1163547327 19:17948112-17948134 GTGGGTTGGGGGCGGGGGGCGGG - Intergenic
1163633735 19:18429228-18429250 CCGAGGCGGGGGAGGGGGGCGGG + Intronic
1163736914 19:18987413-18987435 GTGTGTTGGGGGTTGGCGGCAGG + Intergenic
1163806968 19:19405579-19405601 CTGAGTTGAGGGGGCGGGGCCGG - Intronic
1163833230 19:19557783-19557805 CTGGGTTGGGGGGGTGGGGCGGG + Intergenic
1165072229 19:33262045-33262067 CTCAGCTGGGGCAGGGTGGCAGG - Intergenic
1165149130 19:33750749-33750771 CTCCGTTGGGGGTGGGCGGCTGG - Intronic
1165354238 19:35293834-35293856 GTGGGGTGGGAGAGGGCGGCAGG + Intronic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166760926 19:45224165-45224187 AGGAGTGGGGGGAGGGTGGCGGG + Intronic
1166996617 19:46722600-46722622 CTGAGTGGGGAGAGCGCGTCAGG - Intronic
1167509485 19:49888537-49888559 CTGTGTCCGTGGAGGGCGGCGGG - Exonic
1167562934 19:50237296-50237318 CTGAGTTGGGGTAGGGAGGTTGG - Intronic
1167575280 19:50314869-50314891 CAGGGTCGGGGGAGCGCGGCGGG + Intronic
1167619007 19:50551127-50551149 GGGAGATGGCGGAGGGCGGCGGG - Intronic
1167859317 19:52270124-52270146 CTGTGTTGGGGGAGGTGGCCGGG + Intronic
1168069926 19:53943480-53943502 CGGGGTGGGGGGAGGGGGGCAGG + Exonic
1168185222 19:54696221-54696243 CTGAGATGGGGGTGGGCACCAGG - Intronic
1168282497 19:55312876-55312898 GGGAGATGGGGGAGGCCGGCGGG + Exonic
1168645875 19:58059194-58059216 GCGAGGTGGGGGAGGGCGGCCGG + Intergenic
1202701695 1_KI270712v1_random:169728-169750 CTGAGTTGGGTGGGGGAGGCTGG + Intergenic
925343965 2:3156940-3156962 ATGTGTTGGGGGAGGGCCGTGGG - Intergenic
926348835 2:11976637-11976659 CTGGGTTGGGGGTGGGGCGCTGG + Intergenic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
927012698 2:18922502-18922524 ATGTGGTGGGGGAGAGCGGCAGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927557890 2:24049029-24049051 CAGAGCTGGGGGAGGGAGGGAGG - Intronic
928649945 2:33393432-33393454 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
929456384 2:42069055-42069077 CTGAGTGCGGGGAGGGCTGGTGG - Intergenic
929564616 2:42976627-42976649 CTGAGTTGGGGGTGGCTGGTGGG + Intergenic
929713197 2:44285420-44285442 CAGAGATGTGGGAGGGCAGCCGG + Intronic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932396683 2:71453700-71453722 CGGAGCTCGGGAAGGGCGGCGGG + Intronic
932699892 2:73985186-73985208 CGGAGTGGGGGAGGGGCGGCGGG + Intergenic
933763574 2:85692412-85692434 CTGAGTTAGGGTAGGGCTGGGGG + Intronic
933858558 2:86441841-86441863 GTGTGGCGGGGGAGGGCGGCGGG + Intronic
934125170 2:88881424-88881446 CTGAGATGGGGAAGGCAGGCGGG - Intergenic
934172610 2:89553175-89553197 CTGAGTTGGGTGGGGGAGGCTGG + Intergenic
934282923 2:91627527-91627549 CTGAGTTGGGTGGGGGAGGCTGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934708686 2:96501816-96501838 CTGGGCTGGGGGAGGGAGGCTGG + Intronic
934713451 2:96529948-96529970 CTGGGGTGAGGGAGGGGGGCTGG + Intergenic
934770566 2:96905110-96905132 CTGGGGTGGGGGTGGGGGGCAGG + Intronic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
934944122 2:98524449-98524471 CTGGGTTGGGGGAGGAGGCCAGG + Intronic
935039772 2:99415064-99415086 CGGAGGTGGGGGAGGGAGGCAGG + Intronic
936080415 2:109429098-109429120 CTGAGAGGTGGGAGGGAGGCAGG + Intronic
936099444 2:109562367-109562389 GAGAGTTGGGGGAGGGGGGCAGG - Intronic
936948364 2:117951887-117951909 CAGAGTGGGGGAAGGGCTGCAGG - Intronic
937027372 2:118710884-118710906 ATGATTTGGGGGAGGGCTGGGGG - Intergenic
938954184 2:136283097-136283119 CTTGGGTGGGGGAGGGTGGCTGG - Intergenic
939557375 2:143692194-143692216 CTAAATTGGGGCAGGGGGGCAGG + Intronic
941384901 2:164841247-164841269 CTGGGGTGGGAGAGGCCGGCGGG + Exonic
941648784 2:168070586-168070608 TGGAGTTGGGGGAGGGGGGAGGG - Intronic
941726980 2:168871206-168871228 GTGGGTTGGGGGAGGGGGGAGGG + Exonic
941844470 2:170119536-170119558 CTGAGTTGGGGGTTGGGGGGTGG + Intergenic
941933254 2:170963486-170963508 CTGGGGCGGGGGAGGGGGGCGGG - Intronic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942276685 2:174328344-174328366 CTGAAATGGGGGAGGGGGACAGG - Intergenic
943143088 2:184007376-184007398 GTGAGTTGGGGGACAGAGGCAGG - Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944893574 2:204142157-204142179 CTGAGGTGGAGGAGGCCAGCAGG - Intergenic
945250846 2:207765782-207765804 TTGAACTGGGGGAGGGAGGCTGG - Exonic
947019212 2:225656115-225656137 TTGATTTGGGGGAGGGAGGTAGG + Intergenic
947739730 2:232479612-232479634 AGGCTTTGGGGGAGGGCGGCTGG + Intergenic
947991999 2:234495764-234495786 CTGAGCTGGGGGTGGGGGGCAGG + Exonic
948382919 2:237563666-237563688 CTGGCTTGGGGGAGGGCACCTGG + Intergenic
948657781 2:239487312-239487334 CTGAGTGAGGCCAGGGCGGCAGG + Intergenic
948687366 2:239677600-239677622 CTGAGGTGGGGCAGGGAGGCCGG - Intergenic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
948763983 2:240210250-240210272 CTGAGTAGGGGCGGGGTGGCGGG - Intergenic
948898955 2:240946412-240946434 TTGGGTTGGGGGAGGGCATCTGG + Intronic
1168803719 20:660905-660927 CTGAGTTGAGGGTAGGTGGCAGG + Intronic
1169141430 20:3229323-3229345 GTGAGTTGGGGCCGGGCGGTGGG - Intronic
1169221534 20:3825957-3825979 CTCAGTTGGGGGCGGGGGGTGGG + Exonic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1172486407 20:35300601-35300623 CTGACCTGGGGGAGGGAGGCAGG + Intergenic
1172502303 20:35436278-35436300 CTGAGGTGGGGGAGGTGGTCTGG - Intronic
1172798975 20:37563312-37563334 GGGAGTTGGGGGAGGGGGCCTGG + Intergenic
1174302101 20:49589859-49589881 GTGAGTTGGGGGAGAGTGGGAGG - Intergenic
1174360255 20:50024348-50024370 CTGAGGTGGGAGAGGGGGGTGGG + Intergenic
1175017892 20:55811309-55811331 CTGAATTGGGGCAGGTTGGCAGG - Intergenic
1175172511 20:57090444-57090466 CTGGATTTGGGGAGGGCGGAAGG + Intergenic
1175561956 20:59938779-59938801 ATGAGTTGGGGCAGGGTGGTGGG - Exonic
1175681812 20:60994783-60994805 GTGGGATGGGGGAGGGAGGCAGG - Intergenic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1175902383 20:62365178-62365200 ATGAGCTGGGCGAGGCCGGCTGG + Intronic
1175935255 20:62511018-62511040 CTGAGTTGGGGCAGGAAGGCAGG + Intergenic
1175938139 20:62524568-62524590 CTGTGTTGGGGGAGGGTCCCAGG + Intergenic
1175948785 20:62571568-62571590 CTGAGGTGGGGGAGGGGGATGGG + Intergenic
1176048530 20:63104791-63104813 CTGCCCTGGGGGAGAGCGGCTGG + Intergenic
1176180292 20:63746700-63746722 GTGAGTTGGGGGAGGGCACAGGG - Exonic
1176723788 21:10413788-10413810 CTGAGTGGTAGGAGGGTGGCTGG + Intergenic
1176796292 21:13373015-13373037 CTGAGCTGTAGGAGGGTGGCTGG - Intergenic
1176958600 21:15134292-15134314 CTGTTCTGGGGGAGGGGGGCAGG - Intergenic
1178307463 21:31502510-31502532 CAGATTTGGGGGAGGGTGGTAGG - Intronic
1178510571 21:33201828-33201850 CTGGGTTGGGGGATAGGGGCAGG + Intergenic
1178618631 21:34155117-34155139 CTGAGCTGGGGGAGGGTGTGGGG + Intergenic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1180941972 22:19665650-19665672 GTGAGGTGGGAGAGGGCGGTGGG + Intergenic
1181729037 22:24831356-24831378 CTGAGTTGGGGCAAAGTGGCTGG + Intronic
1182036549 22:27202979-27203001 CCGAGGAGGGGGAGGGCCGCGGG - Intergenic
1182489685 22:30663108-30663130 CTGTTTTTGGGGAGGGCTGCAGG + Exonic
1182592678 22:31394192-31394214 CTGGCTTGGGGGAGGGAGGGGGG - Intergenic
1183123473 22:35751398-35751420 GAGGGTTGGGGGATGGCGGCAGG + Intronic
1183195173 22:36348838-36348860 CCGAGGTGGGGGGGGGGGGCGGG - Intronic
1183450832 22:37894034-37894056 CTGAGATGGGGGTTGGTGGCTGG + Intergenic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183788458 22:40045385-40045407 GTGAGCTGGGGGAGGGCTTCCGG + Intronic
1183854700 22:40623462-40623484 CGGGGTTGGGGGAGGGGGGAGGG - Intronic
1183931816 22:41239771-41239793 CTGCGTGGGGGGTGGGGGGCAGG - Intronic
1184301241 22:43562500-43562522 CTGGGTTGGGGGTGGGAGGGAGG + Intronic
1184880786 22:47303120-47303142 CTGAGTAGAGGGTGGGAGGCTGG + Intergenic
1185177148 22:49334414-49334436 GTGAGGTGGCGGAGGGCGGGGGG - Intergenic
1185287526 22:50009208-50009230 CTGAGTTGGTGGTGCGGGGCGGG + Intronic
1185294924 22:50048486-50048508 CTGGGTTGGGGCAGTGTGGCTGG - Intronic
950680421 3:14581369-14581391 ATGAGTTGGGTGAGAGCAGCAGG + Intergenic
952119150 3:30220680-30220702 CTGAGCTGGTGGGGGGCAGCAGG + Intergenic
952377697 3:32781067-32781089 CTGGGGTGGGGGAGGGCCGAGGG - Intergenic
952450312 3:33425964-33425986 GGGAAGTGGGGGAGGGCGGCAGG + Intronic
952943039 3:38457797-38457819 CTTCCTTGGGGGAGGGCGGAGGG + Intronic
953198954 3:40759855-40759877 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
953882986 3:46701208-46701230 CTGAGGTGGGGGTGGGCGGGAGG - Intergenic
954298326 3:49686290-49686312 GTGAGGTGGGGGGGGGGGGCGGG - Intronic
954447724 3:50555561-50555583 TTGGGTTGGGGGAGAGGGGCAGG + Intergenic
954608936 3:51934126-51934148 GTGACCTGGGGGAGGGTGGCAGG - Intronic
954671191 3:52292155-52292177 CTGAGTTGGGGGAGGGTGTGTGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955225789 3:57059500-57059522 ATGAGTTGGGGGTGGGGGGAGGG + Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955368870 3:58333364-58333386 CCGAGTTGGGGGGCGGGGGCGGG + Intronic
956165785 3:66397256-66397278 CTCAGTTGGGGCAGGGAGGCTGG - Intronic
956379966 3:68654867-68654889 CTGAGTTTGGGGGGGGCGGGGGG + Intergenic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
960076207 3:113488593-113488615 CTCAGAAGGGGGAGGGCGGGAGG + Intronic
961492147 3:127263620-127263642 CTGGGTGGGGGGTGGGCAGCTGG - Intergenic
961501757 3:127341163-127341185 CTGGGTTGGGTGAGAGGGGCTGG - Intergenic
962254204 3:133859420-133859442 CTGGGTTGGGGGTGGGTGTCAGG + Intronic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
963248287 3:143082907-143082929 CTGAGGTGGGGGAAGGGGGGTGG - Intergenic
965165729 3:165193246-165193268 TGGAGATGGGGGAGGGGGGCAGG + Intronic
966872360 3:184299262-184299284 CGGAGATGGAGGAGGGAGGCCGG + Exonic
966914739 3:184578478-184578500 GAGAGCTTGGGGAGGGCGGCGGG - Intronic
967101733 3:186221444-186221466 CTGATTTGGCGGAGGGTGGAGGG + Intronic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968223720 3:196958887-196958909 ATGATTTGGGGGAGGGGGGCAGG + Intronic
968498354 4:931679-931701 GTGAGGTGGGGGATGGTGGCAGG - Intronic
968524415 4:1048697-1048719 CCAAGATGGGGAAGGGCGGCAGG - Intergenic
968697823 4:2041460-2041482 CTGGGTTGGGGGTGGGTAGCCGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
969027127 4:4182698-4182720 CTGAGTTGGGTGGGGGAGGCTGG - Intergenic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969479706 4:7441409-7441431 ATGAGCTGGGTGAGGGTGGCTGG + Intronic
969490443 4:7496470-7496492 CTGAGATGGGGGATGGGGGACGG - Intronic
969680277 4:8639593-8639615 CTGAGTTGGGAAAGGGAGGTAGG + Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
971495901 4:27264959-27264981 GTGAGTTTGGGGAGGCAGGCAGG + Intergenic
971966051 4:33557632-33557654 TGGAGTGGGGGGAGGGGGGCGGG - Intergenic
972254151 4:37335284-37335306 CTGACTGGGGGGTGGGCGGGGGG + Intronic
974489880 4:62551062-62551084 CTGAGATGGGAGAGGGTAGCTGG + Intergenic
976003416 4:80399690-80399712 TTGAGGTGGGGGAGGGGGGAGGG + Intronic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981907917 4:149944051-149944073 TGGGGTTGGGGGAGGGGGGCGGG - Intergenic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982273347 4:153614509-153614531 CTGAGTTGGTGGGGGGCGGCGGG + Intronic
983772091 4:171563631-171563653 CTGAGGTGGGGGCGGGGGGTGGG - Intergenic
984462692 4:180057985-180058007 CTGGTGTGGGGGAGGGCGGCCGG + Intergenic
985340439 4:188946755-188946777 GCCAGTTGGGGGAGGGCGGTGGG + Intergenic
985713717 5:1444660-1444682 CCGCGTTGGGAGAGGGCGTCGGG + Intronic
985857488 5:2441624-2441646 CTGAGGTCAGGGAGGGCTGCTGG - Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
985968002 5:3352262-3352284 GTGGGTTGAGGGAGGGGGGCAGG + Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
987210604 5:15678099-15678121 CTGAGTTGGCCAAGGGAGGCTGG + Intronic
987843582 5:23253448-23253470 CTGAAAGGGGGGAGGGCGGAGGG - Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989710301 5:44389317-44389339 TTGTTTTGGGGGACGGCGGCTGG + Intronic
991171100 5:63626737-63626759 GTGGGGTGGGGGAGGGCGGAGGG - Intergenic
991250114 5:64550721-64550743 CAGGGTTGGGGGAGGGGGGAGGG - Intronic
991472561 5:66984744-66984766 ATGAGTTGGAGGATGGGGGCGGG + Intronic
994262744 5:97679406-97679428 CGGGGTTGGGGGAGGGGGGAGGG - Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
995279619 5:110318349-110318371 CGGGGTTGGGGGAGGGGGGAGGG + Intronic
995363478 5:111327149-111327171 TGGAGTTGGGGGAGGGGGGAGGG - Intronic
995677317 5:114676738-114676760 CGGGGTTGGGGGAGGGGGGAGGG + Intergenic
996787298 5:127254239-127254261 TTGAGTTGGGGGACGGAGACTGG - Intergenic
996977899 5:129457219-129457241 TTTGGTTGGGGGAGGGCGGGTGG + Intergenic
997087981 5:130823600-130823622 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
998236535 5:140402565-140402587 TGGAGTTGGGGGTGGGGGGCGGG + Intronic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
1000255139 5:159530356-159530378 CTGAGGTGGGAGAAGGCGCCTGG - Intergenic
1000486349 5:161848807-161848829 GTGAGTTGGGGAGGGGCGTCGGG + Intronic
1001585910 5:172833967-172833989 TTGAGTTGGGGGCGGGGGGCGGG - Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002132415 5:177089703-177089725 CTGAGGTGGGAGAGGGTGGCAGG + Intronic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1002467093 5:179413008-179413030 CCGTGCTGGGGGAGGGCGGAAGG - Intergenic
1003129544 6:3383776-3383798 GTGAGGTGGGGGCGGGCGACGGG + Intronic
1003268718 6:4589026-4589048 CCGAGCTGGGGGTGGGGGGCTGG - Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005453030 6:25992466-25992488 GGGAGTTGGGGGATGGCGGGCGG + Intergenic
1005990118 6:30897293-30897315 CTGAGGTGGGGCAGGGGGGTGGG + Intronic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007220982 6:40278682-40278704 CTGATTTGGGGGAGGTTGGTTGG + Intergenic
1007398942 6:41592850-41592872 CTGGGCTGGGCAAGGGCGGCAGG - Intronic
1007597401 6:43059969-43059991 GTGAGATGGGCGGGGGCGGCAGG - Exonic
1007655536 6:43449119-43449141 GTGAGCTGGGTGAGGGGGGCCGG + Exonic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007783498 6:44267273-44267295 AAGAGTTGGGGGAGGGCTGAGGG + Intergenic
1009307067 6:62103542-62103564 CAGAGGTGGGGGTGGGGGGCGGG - Intronic
1010319925 6:74495279-74495301 ATGAGGTGGGGGAGGGGGGAGGG - Intergenic
1010932503 6:81819595-81819617 CCGAGTTGGGGGAAGAAGGCTGG - Intergenic
1011093598 6:83633951-83633973 GTGGGTGGGGGGAGGGCGGAGGG + Intronic
1012565339 6:100642013-100642035 CGGAGTGGGGGGAGGGGGGAGGG + Intronic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1014040800 6:116822710-116822732 GTGGGTTGGGGGAGGGGGGAGGG + Intronic
1014359248 6:120455284-120455306 TGGAGTTGGGGGAGGGGGGAGGG + Intergenic
1015407583 6:132855103-132855125 CTGGGTTGGGGGATGGCTGTGGG + Intergenic
1015541056 6:134314339-134314361 CTTGGTTGGGGGAGGGGGGTAGG + Intronic
1015645204 6:135379920-135379942 GGGAGTTGGGGGAGGGAGGGAGG - Intronic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1016995859 6:149962187-149962209 CTGACTTCAGGGAGGGTGGCAGG + Intergenic
1017002720 6:150006981-150007003 CTGACTTCAGGGAGGGCGGCAGG - Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017615577 6:156243508-156243530 CTGAACTGGGGGAGGGGAGCAGG - Intergenic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019209479 6:170393813-170393835 CTGTGTTGGGGAAGGGCTGTAGG + Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019641517 7:2106132-2106154 CTGTGCTGGGGGTGGGAGGCGGG - Intronic
1019801499 7:3091459-3091481 CTGGGTGGTGGGAGGGCTGCTGG + Intergenic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1021172231 7:17413036-17413058 CTGAGTGGGGGCAGGGATGCTGG - Intergenic
1021272595 7:18609771-18609793 CGGAGTTGGGGGAGGGGGGAGGG - Intronic
1021929799 7:25568945-25568967 CTGAGGTGGGGGTGGGAGGTAGG - Intergenic
1021979341 7:26039532-26039554 CTTTGTTGGGGCTGGGCGGCAGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022500482 7:30879527-30879549 CTGAGGTGGGAGAGGAAGGCAGG - Intronic
1022739740 7:33109497-33109519 GTGAGTTGCGGGGCGGCGGCGGG - Intergenic
1023818668 7:43968481-43968503 GTGAGTTGGGGTGGGGCGGGGGG + Intergenic
1024000851 7:45188715-45188737 CTGGGTTGGGGGCGGGGGGGTGG - Intergenic
1026000838 7:66558169-66558191 CTGAGTTGGGGTGGGGGGGCAGG - Intergenic
1026009896 7:66628739-66628761 CTGGGTTGGGGGGGGGGGGGGGG - Intergenic
1026773287 7:73215389-73215411 CTGACGTAGGGCAGGGCGGCGGG + Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026962672 7:74418388-74418410 CTGAGCTGGGGGTGGGGGACAGG - Intergenic
1027014147 7:74768785-74768807 CTGACGTAGGGCAGGGCGGCGGG + Intergenic
1027073887 7:75177247-75177269 CTGACGTAGGGCAGGGCGGCGGG - Intergenic
1027187198 7:75979652-75979674 CTCAGCAGGGGGAGGCCGGCAGG + Intronic
1027381464 7:77614116-77614138 CTGAGGTGGGGGAGGACTGTTGG - Intronic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029140721 7:98407926-98407948 CTGGGTTGGGGTAGGGGGGCAGG - Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029360095 7:100082013-100082035 CGGCCTTGGGGGCGGGCGGCGGG + Intronic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029704796 7:102270574-102270596 CAGAATTGGGGGATGGCTGCTGG - Intronic
1029743718 7:102505446-102505468 GTGAGTTGGGGTGGGGCGGGGGG + Intronic
1029761705 7:102604609-102604631 GTGAGTTGGGGTGGGGCGGGGGG + Intronic
1030348378 7:108456987-108457009 CTGCGGTGGTGGGGGGCGGCGGG - Intergenic
1031797584 7:126195687-126195709 GTGGGGTGGGGGAGGGGGGCGGG + Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032512920 7:132486442-132486464 CTGAGTTGGGAAAGGAAGGCTGG - Intronic
1032834737 7:135662434-135662456 CTGAGTGGGAGGAGCGGGGCGGG + Intergenic
1032852128 7:135804166-135804188 CTGAGGTGGGGGAGGTAGGGAGG - Intergenic
1033157939 7:138972358-138972380 GAGAGGTGGGGGAGGGCGGGAGG - Intronic
1033444734 7:141410447-141410469 CAGAGGTGGGGGAGGGAGGGAGG - Intronic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1034940031 7:155224750-155224772 CTGAGAAGGCGGAGGGCTGCTGG + Intergenic
1035264892 7:157685174-157685196 ATGAGGGGTGGGAGGGCGGCGGG - Intronic
1035288043 7:157818876-157818898 GTGTGTTGGGCGAGGGCTGCTGG - Intronic
1035367359 7:158357843-158357865 CAGAGTTGAGGGCTGGCGGCTGG - Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1036739057 8:11345581-11345603 CTGCATTGGGGAATGGCGGCCGG - Intergenic
1036753333 8:11456767-11456789 CTGGATTAGGGGAGTGCGGCTGG + Intronic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1037817897 8:22121339-22121361 CTGAGGTGGGGGATGCTGGCTGG - Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039518451 8:38152081-38152103 CTGAGTCGCGGGGGGGCGGGGGG + Intergenic
1040655808 8:49506242-49506264 TTGGGTTGGGGGAGGGGGGAAGG + Intergenic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1042835156 8:73072874-73072896 CAGAGTTGGGGGAGGGTTGTGGG - Intronic
1043033166 8:75164526-75164548 GTAAGTTGGTGGAGGGCGGGGGG + Intergenic
1043463750 8:80486135-80486157 CCGGGCTGGGGGAGGGGGGCTGG - Intronic
1044183547 8:89224203-89224225 TGGAGTTGGGGGAGGGAGGTGGG + Intergenic
1044704640 8:94996654-94996676 ATGAATTGGGGGAAGGCGGTGGG - Intronic
1045189000 8:99865049-99865071 CTGACCTGGGGCAGTGCGGCTGG - Intronic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1047633307 8:126731786-126731808 TTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1048319563 8:133387817-133387839 CTGGGGTGGGGGAGGAGGGCAGG + Intergenic
1048447677 8:134504217-134504239 CTGAGGTGGGGGAGGGAGTTGGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049404325 8:142444948-142444970 CTGAGCTGGGGGTGGGAGGGGGG + Intergenic
1049409806 8:142467497-142467519 CTGAGTTGAGGAAGTGGGGCTGG + Intronic
1049674508 8:143883712-143883734 CTGCGCTGTGGCAGGGCGGCTGG - Intergenic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050392151 9:5155325-5155347 CAGGGTTGGGGGAGGGGGGAGGG + Intronic
1051459387 9:17294894-17294916 GGGAGTGGGGGGAGGGCGGGGGG + Intronic
1051629318 9:19127613-19127635 CGGCGTTGGGGGAGGGCGCCGGG - Intronic
1051676129 9:19560298-19560320 ATGAATTGGGGGTGGGGGGCGGG - Intronic
1052604540 9:30682074-30682096 ATGGGTTGGGGGAGGGGGGAGGG + Intergenic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1053291474 9:36882312-36882334 CTGAGTGGAGCGAGGGTGGCTGG - Intronic
1053618208 9:39791599-39791621 CTGAGTGGGTGGAGCGCGTCTGG - Intergenic
1054265948 9:62915830-62915852 CTGAGTGGGTGGAGCGCGTCTGG + Intergenic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056498803 9:87188111-87188133 ATGTGGTGGGGGAGGGGGGCTGG - Intergenic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057210484 9:93198517-93198539 TTGAGTTGGGGGAGTGTGCCCGG + Intronic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057565616 9:96163948-96163970 CTGTGATGGGGCAGGGTGGCAGG - Intergenic
1058117240 9:101098320-101098342 ATGAGATGGGGGAGGAAGGCAGG + Intronic
1060001039 9:119958837-119958859 TTTAGTTGGGGGAGGGGGTCAGG - Intergenic
1060359539 9:122941467-122941489 CTGAGGCGGGGGGGAGCGGCTGG - Intronic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060984174 9:127810115-127810137 CCAACTTGGGGGTGGGCGGCAGG + Intronic
1061021778 9:128020386-128020408 CTAAGTTGGGGGTGGGTGGGTGG + Intergenic
1061081648 9:128374427-128374449 CTGGGGTGGGGGAGGGTGACAGG - Intronic
1061262521 9:129488162-129488184 CAGATTTGGGGGAGGGGGGTTGG - Intergenic
1061306454 9:129735818-129735840 CTGGGTTGGGGGTGGGTGTCGGG - Intergenic
1061372985 9:130208218-130208240 GTGAGGTGGGGGTGGGGGGCGGG + Intronic
1061479200 9:130888242-130888264 CTGAGCTGGGAAAGGGCGGTGGG - Intergenic
1061488775 9:130933934-130933956 AGGAGATGGGGGTGGGCGGCAGG - Intronic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1062344836 9:136109849-136109871 CTGGGCTGGGGGAGGGGCGCCGG + Intergenic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062560537 9:137139741-137139763 CGGAGGTGGGGGAGGGCACCTGG - Exonic
1062577482 9:137215390-137215412 GTGAGTCTGGGGAGGACGGCGGG - Exonic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1203366287 Un_KI270442v1:260012-260034 GTGAGGTGGGGGAGGGGGGAAGG + Intergenic
1185694294 X:2183805-2183827 CGGCGTTGGGGGAGGGGGGGTGG - Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188520111 X:31029424-31029446 CTGAGTTGGGGAAGGTAGGCAGG + Intergenic
1189002602 X:36962663-36962685 CCGAGTTGGGTGGTGGCGGCCGG + Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190331821 X:49240657-49240679 CTGAGTTGCGGGGGGGCTACAGG - Intronic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1191037887 X:56047407-56047429 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1191196142 X:57725618-57725640 GTGAGATGGGGGAGGGGGGAGGG - Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192172388 X:68865145-68865167 CTGAGGTGGGGGAGAGGGGAGGG - Intergenic
1192207763 X:69107458-69107480 CTGAGTAGGTGGAGGAGGGCAGG + Intergenic
1192300645 X:69898132-69898154 CTGATTTGGTGGAGGGGGGTTGG + Intronic
1192838733 X:74831334-74831356 TGGGGTTGGGGGAGGGGGGCGGG - Intronic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1193701951 X:84773841-84773863 CAGAGTCGGGGGAGGGGGGAGGG - Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1195086497 X:101418516-101418538 AGGAGGAGGGGGAGGGCGGCAGG + Intronic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195337849 X:103874256-103874278 TGGAGTTGGGGGAGGGGGGAGGG + Intergenic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1196430103 X:115615372-115615394 TTTACTTAGGGGAGGGCGGCGGG + Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1197050141 X:122047343-122047365 CTCGGTGGGGGGAGGGGGGCGGG + Intergenic
1197417667 X:126194551-126194573 TGGGGTTGGGGGAGGGGGGCGGG + Intergenic
1197450896 X:126615967-126615989 TGGAGTTGGGGGAGGGGGGACGG + Intergenic
1197711246 X:129670894-129670916 TGGAGTTGGGGGAGGGGGGAGGG - Intergenic
1198030737 X:132751244-132751266 CTGAGGTGGGGCGGGGCGGGGGG + Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198341279 X:135715850-135715872 ATCTGTTGGGGGAGGGGGGCTGG - Intronic
1198772375 X:140144711-140144733 CTGGGTGGGGGGTGGGCGGGGGG - Intergenic
1200045763 X:153400561-153400583 CTGACTTGGGGGTGGAGGGCGGG - Intergenic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200977149 Y:9225610-9225632 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201076442 Y:10193442-10193464 GTGGGGTGGGGGAGGGGGGCAGG + Intergenic
1201415085 Y:13740862-13740884 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201572738 Y:15431909-15431931 GGGAGTTGGGGGAGGGGGGAGGG + Intergenic
1201651294 Y:16290570-16290592 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202584726 Y:26410141-26410163 GTGAGTTGGGGGATGGCAGTGGG + Intergenic